Overview

Comprehensive Description

Biology/Natural History: This species is a scavenger, or eats small invertebrates. Predators include staghorn sculpin, starry flounder, the seastar Astropecten verrelli, and the giant octopus Enteroctopus dofleini. Females usually are found buried in the mud. Seasonally found in bays but cannot osmoregulate and does not tolerate brackish conditions. In Puget Sound eggs were borne from December to April. Males protect females after mating. Megalopae and juveniles often cling to large jellyfish such as Pelagia colorata.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with all Cancer crabs, this species has 5 teeth between the eyes. Its carapace is widest at the 9th tooth lateral to the eyes, and behind this point there is a distinct 10th tooth. The tips of the chelae are white (photo), and there are no spiny ridges on the carpus, propodus, and dactyl of the chelae (although there are two blunt teeth on the dorsal ridge of the propodus) (photo). The carapace is slightly convex dorsally. The dactyls of the pereopods (walking legs) are cylindrical. The dorsal surface of the upper part of the legs is purple in many individuals. Carapace width to 11.5 cm (males) or 10.6 cm (females) but usually not over 6 cm.
  • Wicksten,Mary K., 2009. ; Decapod Crustacea of the Californian and OregonianZoogeographic Provinces. ; UC San Diego Scripps Institution of OceanographyLibrary, Scripps Institution of Oceanography. ; http://escholarship.org/uc/item/7sk92dz ;418 pages. ; Published online only. ; This excellent key coversdecapods (crustaceans such as crabs, shrimp, spiny lobsters, hermit crabs,and crayfish) from shallow and deep water from Puget Sound south to thePacific coast of Baja California. ; Includes many subkeys, drawings,and photos. ; No glossary, table of contents, or index. ; Thisis the place to go for the most up-to-date key for decapods. ; MaryWicksten plans to publish an updated version of this key soon.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Wicksten+2009 External link.
  • Jensen, Gregory C., 1995. ;Pacific Coast Crabs and Shrimps. ; Sea Challengers, Monterey, CA. ;87 pp. ; ISBN 0-930118-20-0. ; This paperback contains excellentpictures and brief descriptions of many crabs and shrimp from along thePacific coast. ; Sections are arranged by animal group. ; Includesa short glossary.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Jensen+1995 External link.
  • Hart, Josephine F.L., 1982. ;Crabs and their relatives of British Columbia. ; British Columbia ProvincialMuseum Handbook 40. ; Paperback. ; 267 pages. ; This smallpaperback contains keys and individual descriptions and drawings of 95species of true crabs, hermit crabs, other anomurans, mud and ghost shrimp(but not shrimp or prawns) found off British Columbia. ; An introductiongives an extensive discussion of the general biology and anatomy of crabsand other similar crustaceans, including topics such as sexual dimorphism,larvae, and parasites. ; A variety of drawings and tables are included. ;The general characteristics of each of the families included in the bookare discussed. ; Keys to the families of each section (Thalassinidea,Anomura, Brachyrua) are included but one needs to know beforehand whichsection the animal is in. ; Keys are also included for the membersof each family. ; A useful key for the serious student wanting to identifycrabs.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Hart+1982 External link.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Prince William Sound, Alaska to Baja California, Mexico

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Metacarcinus magister has a carapace widest at the 10th tooth, with no teeth behind that point, and also has spiny ridges on the carpus, propodus, and dactyl of the chela. It also has more flattened dactyls on the pereopods and the dorsal surface of the upper parts of the legs is not purple.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 138 specimens in 1 taxon.
Water temperature and chemistry ranges based on 34 samples.

Environmental ranges
  Depth range (m): 0 - 188.5
  Temperature range (°C): 6.972 - 11.024
  Nitrate (umol/L): 6.665 - 24.359
  Salinity (PPS): 31.235 - 33.403
  Oxygen (ml/l): 3.572 - 6.794
  Phosphate (umol/l): 0.943 - 2.174
  Silicate (umol/l): 13.221 - 39.961

Graphical representation

Depth range (m): 0 - 188.5

Temperature range (°C): 6.972 - 11.024

Nitrate (umol/L): 6.665 - 24.359

Salinity (PPS): 31.235 - 33.403

Oxygen (ml/l): 3.572 - 6.794

Phosphate (umol/l): 0.943 - 2.174

Silicate (umol/l): 13.221 - 39.961
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Intertidal to 174 m

Habitat: Mainly subtidal on sand and mud, sometimes near eelgrass beds. May be on pilings.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Metacarcinus gracilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTTCCTCCCTCCTTAACATTGCTCCTTATAAGAGGTATAGTAGAAAGTGGAGTTGGGACAGGATGAACTGTTTNCCCTCCTTTGGCAGGTGCTATTGCTCACGCTGGAGCCTCAGTTGATATAGGAATTTTCTCCTTACACTTAGCAGGAGTTTCTTCTATCTTAGGGGCTGTAAACTTTATAACAACTGTGATTAATATACGGTCCTTTGGAATAACCTTAGACCAAATACCTCTCTTTGTTTGAGCTGTATTTATTACCGCTATCCTGTTACTTTTATCTCTCCCTGTTTTAGCAGGTGCAATTACTATGTTACTAACTGATCGAAACCTTAATACTTCTTTCTTTGATCCTGCGGGCGNGGGGGGACCTGTTCTCTATCAACACCTTTTTTGATTTTTTGGACACCCAGAAGTCTATATTCTTATCTTACCTGCTTTCGGAATAATCTCCCATATTGTAAGACAAGAATCTGGTAAAAAAGAATCCTTTGGGACCCTTGGAATAATTTATGCTATACTAGCCATTGGTATCTTAGGTTTTGTAGTCTGAGCCCACCATATATTCACAGTCGGAATAGACGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Metacarcinus gracilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Metacarcinus gracilis

Metacarcinus gracilis (formerly Cancer gracilis) or commonly the graceful rock crab or slender crab, is one of only two members of the genus Metacarcinus whose chelae (claws) are white tipped, the other crab being M. magister (Dungeness crab).[2] M. gracilis has been caught from Alaska to Bahía Magdelena, Baja California.[3] Although M. gracilis is only found in the Pacific Ocean, it has cousins in the Atlantic Ocean. The genus Cancer (sensu lato) apparently evolved in the Pacific Ocean and later migrated to the Atlantic Ocean.[4] Larvae and small juveniles of this species are often seen riding jellyfish, especially Phacellophora camtschatica. The juvenile crabs steal food from the jellyfish and also clean off parasitic amphipods.[5]

Morphology

Like the other members of the family Cancridae, the slender crab has a very broad and oval carapace with dull, tooth-like protrusions toward the front of the carapace. Female crabs can be distinguished from males by a broad tail flap on their undersides, which are used for protecting their eggs when they are gravid. The slender crab carapace is usually olive brown, and its legs vary from yellowish-brown to purple. M. gracilis only grows to a width of about 3.5 inches (9 cm) and resembles a juvenile M. magister. Often the two species can be confused, as M. gracilis looks very similar to a juvenile Dungeness crab. They can readily be distinguished from each other, though, by the appearance of hair on the posterior three legs of M. magister where M. gracilis is almost always hairless. Another telling characteristic of the slender crab is that the last segment of its tail flap is pointed, where M. magister is curved.

References

  1. ^ a b P. K. L. Ng, D. Guinot & P. J. F. Davie (2008). "Systema Brachyurorum: Part I. An annotated checklist of extant Brachyuran crabs of the world" (PDF). Raffles Bulletin of Zoology 17: 1–286. http://rmbr.nus.edu.sg/rbz/biblio/s17/s17rbz.pdf.
  2. ^ Eugene N. Kozloff (1983). Seashore Life of the Northern Pacific Coast. Seattle: University of Washington Press. ISBN 9780295960845.
  3. ^ J. Dale Nations (1975). "The genus Cancer (Crustacea: Bachyura): systematics, biogeography, and fossil record" (PDF). Natural History Museum of Los Angeles County Science Bulletin 23: 1–104. http://decapoda.nhm.org/pdfs/12412/12412.pdf.
  4. ^ Michelle K. Harrison and Bernard J. Crespi (1999). "Phylogenetics of Cancer Crabs (Crustacea: Decapoda: Brachyura)" (PDF). Molecular Phylogenetics and Evolution 12 (2): 186–199. doi:10.1006/mpev.1998.0608. PMID 10381321. http://decapoda.arthroinfo.org/pdfs/4160/4160.pdf.
  5. ^ Trisha Towanda & Erik V. Thuesen (2006). "Ectosymbiotic behavior of Cancer gracilis and its trophic relationships with its host Phacellophora camtschatica and the parasitoid Hyperia medusarum". Marine Ecology Progress Series 315: 221–236. doi:10.3354/meps315221.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!