Overview

Comprehensive Description

Biology/Natural History: This crab is the largest edible crab from Alaska to California, making this species important for fisheries commercially and economically. There appears to be five subspecies in California alone. The female Dungeness crab can lay up to 2.5 million eggs and can live up to at least 6 years. Females can store sperm received during one mating season and use it during the next season. This species is a carnivore that feeds on more than 40 different species including small clams, oysters, fish, shrimp, worms and according to recent studies even feeds on Velella nematocysts. The larvae of this species is often attached to the bells of jelly fishes and to their tentacles; these larvae feed on the gonozooids, and by doing so gain protection from pelagic fish predators and are transported to juvenile crab habitats nearshore as long as associated with the cnidarian. Dungeness crab larvae feed primarily on zooplankton, however phytoplankton are also eaten. The larvae are crepuscular migrators, being found near the surface at dawn and dusk but deeper in midday and midnight. The stage 1 zoeae are nearest the surface with later zoeal stages in deeper water. In spring, larvae of this species may be advected north along the coast as far as Alaska (Park et al., 2007). In springtime, adults of this crab can be found buried in sand or in tidepools, where it can hide and wait for its new shell to harden. On average, males will cover more ground in an hour than females, and ovigerous females move less than nonovigerous females or males. Near Vancouver Island, adults have more epibionts than do juveniles (McGraw, 2006). Common epibionts include barnacles (especially Balanus crenatus) on the dorsal surface, green, red, and brown algae (especially on the antennae), tube-dwelling polychaetes (mainly on the ventral surfaces), hydrozoans (mainly on ventral surfaces and limbs), bryozoans (especially Membranipora membranacea) on any region of the carapace. A few had sponge, tunicate, or mollusk epibionts.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A Red-brown to purple carapace with a spine-tipped edge on the front half; contains ten small teeth on the anterolateral margins; tenth tooth is the most prominent. There are no teeth on the posterolateral margins. Width of carapace up to 23 cm. Chelipeds are purple to brownish at the base and the hands are white with purple. The carpus, propodus, and dactyl of the chelae have spiny ridges. This species alone accounts for more than 99 percent of all crab species taken for commercial reasons.
  • Wicksten,Mary K., 2009. ; Decapod Crustacea of the Californian and OregonianZoogeographic Provinces. ; UC San Diego Scripps Institution of OceanographyLibrary, Scripps Institution of Oceanography. ; http://escholarship.org/uc/item/7sk92dz ;418 pages. ; Published online only. ; This excellent key coversdecapods (crustaceans such as crabs, shrimp, spiny lobsters, hermit crabs,and crayfish) from shallow and deep water from Puget Sound south to thePacific coast of Baja California. ; Includes many subkeys, drawings,and photos. ; No glossary, table of contents, or index. ; Thisis the place to go for the most up-to-date key for decapods. ; MaryWicksten plans to publish an updated version of this key soon.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Wicksten+2009 External link.
  • Hart, Josephine F.L., 1982. ;Crabs and their relatives of British Columbia. ; British Columbia ProvincialMuseum Handbook 40. ; Paperback. ; 267 pages. ; This smallpaperback contains keys and individual descriptions and drawings of 95species of true crabs, hermit crabs, other anomurans, mud and ghost shrimp(but not shrimp or prawns) found off British Columbia. ; An introductiongives an extensive discussion of the general biology and anatomy of crabsand other similar crustaceans, including topics such as sexual dimorphism,larvae, and parasites. ; A variety of drawings and tables are included. ;The general characteristics of each of the families included in the bookare discussed. ; Keys to the families of each section (Thalassinidea,Anomura, Brachyrua) are included but one needs to know beforehand whichsection the animal is in. ; Keys are also included for the membersof each family. ; A useful key for the serious student wanting to identifycrabs.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Hart+1982 External link.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Cancer magister, commonly known as Dungeness crab, is found in the costal waters from Point Concepcion, California, to the Pribilof Islands, Alaska. The Dungeness crabs inhabit the estuaries from Morro Bay, California, to Puget Sound, Washington.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Occurs from Alaska to Santa Barbara, California.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cancer magister is a decapod. Decopods' thoracic segment is fused with that of the head, to form the cephalothorax, which is covered by a carapace. The Dungeness crab has five pairs of thoracic legs. The first pair of legs is larger then the last four and has pinching claws. Cancer magister is a walking crab and therefore, the last pair of legs is adapted for walking. It has a flat and broad body, oval in shape. The anterior margin of the carapace has nine small teeth on each side, forming an elliptical curve. At the end of the curve, a large, pointed tooth projects directly outward. From this tooth, the carapace slopes backward, forming a narrow posterior end. Males range from 18 to 23 centimeters (about 7 to 9 inches)in width and 10 to 13 centimeters (4 to 5 inches) long. The color of the carapace is reddish-brown, fading towards the back. The legs and ventral side are yellowish.

Range length: 10 to 13 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Headstrom, R. 1979. Lobsters, Crabs, Shrimps and Their Relatives. New York: A.S. Barnes and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Cancer magister Dana, 1852
Catalog Number: USNM 2370
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Dry
Collector(s): J. Dana
Locality: Puget Sound, Washington, United States, North Pacific Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: A similar, somewhat larger crab is the Furrowed Rock Crab (Romaleon branneri). This species is not common in the intertidal region, unlike M. magister, and differs in that the dactyls of its chelae have black tips and spines that line the upper margin of the movable finger of the claws. Cancer productus, often found in the intertidal in the Pacific Northwest, also has black tips to the dactyls of the chelae. Metacarcinus gracilis has a distinct tooth behind the widest point of the carapace and has no spiny ridges on the carpus, propodus, and dactyl of the chelae.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Dungeness crabs are found on the Pacific coast in sandy bottoms below the tidal mark. They can also be found at lowtide in sandy or muddy bays where there is a good growth of eel grass. Dungeness crabs are intolerant of low dissolved oxygen conditions. Also, even low amounts of ammonia are toxic to the crabs. Dungeness crabs also tend to grow better in water that is above six degrees Celsius (Kozloff 1973).

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 191 specimens in 1 taxon.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): -0.5 - 204.5
  Temperature range (°C): 6.630 - 12.466
  Nitrate (umol/L): 3.089 - 30.351
  Salinity (PPS): 31.144 - 33.811
  Oxygen (ml/l): 2.565 - 7.455
  Phosphate (umol/l): 0.565 - 2.545
  Silicate (umol/l): 9.560 - 46.900

Graphical representation

Depth range (m): -0.5 - 204.5

Temperature range (°C): 6.630 - 12.466

Nitrate (umol/L): 3.089 - 30.351

Salinity (PPS): 31.144 - 33.811

Oxygen (ml/l): 2.565 - 7.455

Phosphate (umol/l): 0.565 - 2.545

Silicate (umol/l): 9.560 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Lives intertidally to a depth of 230 m.

Habitat: Most common in sand or muddy-sand bottoms in subtidal regions, but are often found in or near eelgrass beds.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Cancer magister eat a variety of marine invertebrates and fish. As juveniles, the Dungeness crabs feed on fish, shrimp, molluscs and crustaceans. Adults feed on bivalves, crustaceans and fishes. The crabs are able to open shells by chipping away at them with their heavy pinching claws.

Animal Foods: carrion ; mollusks; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Seals, sea lions, and a variety of fish eat Dungeness crabs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Males attract the females by use of pheromones, which are chemical scents. During mating, the male crabs clasp the female so that the undersides of each are close. The male's breeding structures place the sperm into the female's body. This is only possible when the female is soft shelled, right after molting. This lasts less than thirty minutes. Mating occurs in near-shore costal locations, outside of estuaries. The eggs are not fertilized and spawned until the fall, following the summer breeding. After fertilization, about half a million to one million eggs are attatched to the female's abdomen. These eggs are brooded there until spring. The larvae are planktonic and use tidal currents to travel into estuaries. The larvae pass through six stages over a 105 to 125 day period. The last two stages are zoea and megalopa. Zoea have a jointed abdomen and a spined carapace behind the head with large eyes. Megalops have big eyes, an extended abdomen, elongated carapace and swimming legs. After the first molting, the form changes to that similar to the adults. Growth after this point occurs by shedding its shell, molting, at certain periods of time, until it reahces full growth (Headstrom 1979, Mash 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cancer magister

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACATTATATTTTATTTTCGGAGCCTGAGCTGGGATAGTTGGTACTTCACTGAGATTAATTATTCGCGCTGAATTAGGACAACCAGGAACTCTTATTAGAAACGATCAAATTTATAATGTTGTTGTTACTGCTCACGCTTTTGTAATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTGATGCTAGGNGCACCCGATATAGCTTTCCCTCGTATAAACAATATAAGTTTCTGATTATTACCTCCTTCTTTAACCTTACTTCTTATAAGAGGAATAGTAGAAAGAGGAGTAGGAACAGGATGGACCGTCTACCCTCCNTTAGCGGGGGCTATCGCCCATGCCGGAGCCTCAGTCGATATGGGAATCTTTTCCCTTCATTTAGCTGGGGTTTCCTCTATTTTAGGAGCAGTAAATTTTATAACAACCGTAATTAACATACGTTCTTTTGGGATAACTTTAGATCAAATACCACTCTTCGTTTGAGCTGTATTTATCACCGCTATTCTTTTACTACTATCCCTTCCTGTACTAGCAGGNGCCATCACTATACTTCTAACTGACCGAAATCTTAACACATCTTTCTTTGATCCGGCAGGAGGAGGAGACCCTGTTCTTTACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cancer magister

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Metacarcinus magister

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTGATTAGTTCCCCTAATGCTAGGAGCACCCGATATAGCTTTCCCTCGTATAAATAATATAAGTTTCTGACTATTACCTCCTTCTTTAACCTTACTTCTTATAAGAGGAATAGTAGAAAGAGGAGTAGGAACAGGATGGACCGTCTACCCTCCCTTAGCGGGGGCTATCGCTCATGCCGGAGCCTCAGTCGATATAGGAATCTTTTCCCTTCATTTACGTGGGGTTTCCTCTATTTTAGGAGCAGTAAATTTTATAACAACCGTAATTAACATACGTTCTTTTGGGATAACTTTAGATCAAATACCACTCTTCGTTTGAGCTGTATTTATCACCGCTATTCTTTTACTACTATCCCTTCCTGTACTAGCAGGTGCCATCACTATACTTCTAACTGACCGAAATCTTAACACATCTTTCTTTGATCCGGCAAGGGNAGGAGACCCTGTTCTTTACCAACACCTTTTTTGACTNNNTGGGCACCCTGAAGTGTACATTCTTATTCTACCTGCTTTCGGCATAATCTCTCATATTGTAAGCCAAGAGTCTGGAAAAAAAGAATCTTTTGGAACTTTAGGAATAATCTATGCTATGTTAGCCATTGGTATTTTAGGATTTGTTGTTTGAGCTCATCATATATTTACAGTTGGTATAGACGTCGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Metacarcinus magister

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Dungeness crabs are affected by many insecticides. The insecticide carbaryl, also known as Sevin, is particularly toxic to the Dungeness crab. Other toxins include other insecticides and fungicides as well as ammonia. Urban pollutants such as heavy metals, PCB's and hydrocarbons also affect the Dungeness crab. Runoff of pesticides and herbicides affect the Dungeness crab populations as well. Dungeness crabs are not endangered, however, these chemicals can kill or upset the health of Dungeness crab populations.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Dungeness carbs are an important commercial shellfish. Male crabs are harvested along the coast of North America from Alaska to California. The fishery is worth tens of millions of dollars, due to the thousands of crabs caught annually.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dungeness crab

The Dungeness crab, Metacarcinus magister (formerly Cancer magister), is a species of crab that inhabits eelgrass beds and water bottoms on the west coast of North America. It typically grows to 20 cm (7.9 in) across the carapace and is a popular seafood prized for its sweet and tender flesh. Its common name comes from the port of Dungeness, Washington.

Contents

Description

Close-up of the head: the two eyes sit on eyestalks, with an antennule on either side of the rostrum (centre, above the mouth)

The carapace widths of mature Dungeness crabs may reach 25 centimetres (9.8 in) in some areas off the coast of Washington, but are typically under 20 centimetres (7.9 in).[2] They are a popular delicacy, and are the most commercially important crab in the Pacific Northwest, as well as the western states generally.[3] The annual Dungeness Crab and Seafood Festival is held in Port Angeles each October.[4]

Dungeness crabs have a wide, long, hard shell, which they must periodically moult to grow; this process is called ecdysis. They have five pairs of legs, which are similarly armoured, the foremost pair of which ends in claws the crab uses both as defence and to tear apart large food items. The crab uses its smaller appendages to pass the food particles into its mouth. Once inside the crab's stomach, food is further digested by the "gastric mill", a collection of tooth-like structures. M. magister prefers to eat clams, other crustaceans and small fish, but is also an effective scavenger. Dungeness crabs can bury themselves completely in the sand if threatened.

Life cycle and ecology

Mature female crabs generally moult between May and August, and mating occurs immediately after the female has moulted and before the new exoskeleton hardens.[5] Males are attracted to potential mates by pheromones present in the urine of females. Upon locating an available female, the male initiates a protective premating embrace that lasts for several days. In this embrace, the female is tucked underneath the male, oriented such that their abdomens touch and their heads face each other. Mating occurs only after the female has moulted, and the female signals her readiness to moult by urinating on or near the antennae of the male. The female extrudes the eggs from her body several months later; however, they remain attached under her abdomen for three to five months until they hatch. Young crabs are free-swimming after hatching, and go through five larval stages before reaching maturity after about 10 moults or two years.

Distribution

The Dungeness crab is named after Dungeness, Washington,[6] which is located approximately five miles north of Sequim and 15 miles (24 km) east of Port Angeles. Its range extends from Alaska's Aleutian Islands to Point Conception, California.[7]

Dungeness crabs have recently been found in the Atlantic Ocean, far from their known range, raising concern about their possible effects on the local wildlife.[8]

Culinary use

Dungeness crab ready to eat at Fisherman's Wharf, San Francisco

About one-quarter of the crab's weight is meat.[9] The flesh has what is considered to be a delicate flavour and slightly sweet taste.[10] Dungeness crabs can typically be purchased either live or cooked. Larger crabs are valued for the higher meat-to-shell ratio. Live crabs are cooked simply by dropping them into boiling salt water, waiting for a boil to return, and then allowing it to continue for 15 minutes, after which time the crabs are removed and placed into cold water to cool, and then cleaned. Another method of preparing crab is called half backing. Half backing is done by flipping the crab upside down and chopping it in half (from head to "tail"), afterwhich the guts and lungs can be scooped or hosed out. Many consider half backing to be superior to cooking the entire crab, because the meat is not contaminated by the flavor and or toxins of the guts. Furthermore half backed crabs boil faster or can be quickly steamed instead of boiled. Two common tools for removing crab meat from the shell are a crab cracker and a shrimp fork. Sometimes, a cleaver, mallet, or small hammer is used for cracking Dungeness crab, but the use of these devices is not recommended, as the integrity of the meat may be compromised due to the impact.[11]

Sustainability

Seafood Watch has given the Dungeness crab a sustainable seafood rating of 'Best Choice'.[12]

"State crustacean" designation in Oregon

In 2009, based on lobbying from schoolchildren at Sunset Primary School in West Linn, Oregon, and citing its importance to the Oregon economy, the Oregon State Legislature designated the Dungeness crab as the state crustacean of Oregon.[13]

References

  1. ^ a b Peter K. L. Ng, Danièle Guinot & Peter J. F. Davie (2008). "Systema Brachyurorum: Part I. An annotated checklist of extant Brachyuran crabs of the world" (PDF). Raffles Bulletin of Zoology 17: 1–286. 
  2. ^ "2006-2007 Fishing in Washington Rule Pamphlet" (PDF). Washington Department of Fish and Wildlife. p. 130. Archived from the original on June 17, 2009. 
  3. ^ "Species Fact Sheet. Cancer magister Dana, 1852". FAO. January 22, 2004. 
  4. ^ "Dungeness Crab and Seafood Festival". 
  5. ^ "Dungeness Crab Biology". Fisheries and Oceans Canada. Retrieved April 20, 2011. 
  6. ^ "The Dungeness Crab". Dungeness community website. Retrieved August 28, 2006. 
  7. ^ "Seafood Watch Dungeness Crab Report" (PDF). Monterey Bay Aquarium. Retrieved June 10, 2010. 
  8. ^ Andrea Cohen (August 9, 2006). "Crab nabbed; circumstances fishy". MIT News Office. 
  9. ^ Saekel, Karola (November 18, 1998). "For Bay Area Crab Lovers, The Boats Are Coming In". San Francisco Chronicle. Retrieved October 7, 2008. 
  10. ^ Gary Rainer Puetz (2008). Cooking with the Seafood Steward. Arnica Publishing. ISBN 978-0-9801942-5-8. 
  11. ^ "Online video teaching how to crack and clean Dungeness crab". 
  12. ^ "Seafood Recommendations: Dungeness Crab". Seafood WATCH. Retrieved December 19, 2009. 
  13. ^ "House Joint Resolution 37, 2009 (Enrolled)". Oregon State Legislature. Retrieved October 23, 2009. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!