Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"The Mexican Spiny Pocket Mouse occurs in central and northeastern Mexico and the extreme south of Texas. It inhabits a variety of semi-arid brushy or rocky habitats, and is common where it lives. The ""pockets"" of the pocket Mouse are fur-lined cheek pouches, where seeds are carried from the foraging area to the burrow. Mexican Spiny Pocket Mice are grayish-brown, with white underparts. On the back, a mixture of stiff spiny hairs and soft ones gives the animal a somewhat coarse appearance. These Mice are nocturnal and are active year-round."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Merriam, C.H., 1902.  Twenty new pocket mice (Heteromys and Liomys) from Mexico, p. 44.  Proceedings of the Biological Society of Washington, 15:41-50.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

From extreme south Texas, United States (just north of the Rio Grande River) southward throughout most of central Mexico (Patton 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Liomys irroratus is found mainly in Mexico, though the species has been reported in southern Texas. It ranges from southern Texas in the United States and from southcentral Chihuahua to Oaxaca in Mexico.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern Texas (Cameron, Hidalgo, and Willacy counties), and south-central Chihuahua to Oaxaca, Mexico (Patton, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Liomys irroratus is a medium-sized mouse with rough pelage covering the upper body. The hairs are flattened with sharp points and grooves. The upper fur is dark gray with an orange tint. White fur covers the underside of the mouse except for the heel of the hind foot. The tail is covered with sparse hairs and is bicolored, brown above and white below. They possess external, fur lined, cheek pouches. The dental formula is that of a typical heteromyid rodent: I 1/1, C 0/0, PM 1/1, M 3/3. The average weight of Liomys irroratus is between 50 and 60 grams for males, and between 35 and 50 grams for females. The average total length of this species is 237 mm, with a tail length of 122 mm, and a hind foot length of 30mm.

Range mass: 50 to 60 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 30 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 238 mm males; 226 mm females
Range: 216-262 mm males; 207-251 mm females

Weight:
Range: 40-60 g males; 35-50 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It prefers dry shrubland habitat. Occupies dense brushy areas along ridges that are remnants of old banks of Rio Grande.

Like other pocket mice, it forages for seeds and stores them in the fur-lined cheek pouches. In southern Texas, its diet includes seeds of hackberry, mesquite, and other shrubs. It is nocturnal, staying in burrows during the day. The entrance to the burrow is often covered with leaves or other vegetation, or with a small mound of soil. This species breeds throughout the year, but peak reproductive period appears to be during the fall or winter. The number of young varies from two to eight, with an average litter size of four (Wilson and Ruff 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This mouse lives in dense vegetation and near rocky mountain slopes or stone fences. It has been found in the dense brush along the banks of the Rio Grande River and beside oxbow lakes, in subtropical palm forests, thickets of prickly pear cactus, and in chaparral. They build burrows that have their opening closed off by vegetation or mounds of dirt.

Terrestrial Biomes: chaparral ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Lives in dense brush on ridges forming the old Rio Grande river bed. Usually closely associated with prickly pear thickets. Nests are in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Mexican Spiny Pocket Mouse feeds on the seeds of hackberry, mesquite, and other shrubs as well as herbaceous plants. These mice have been known to store seeds in burrows.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on seeds of shrubs and weeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Strictly nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little is known about the breeding habits of Liomys irroratus. Litter sizes range from two to eight, with an average of four. Immature individuals are found throughout the year except for the month of May, suggesting that breeding occurs throughout the year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding may occur throughout the year; probably most concentrated from November-February. Possibly 2-3 litters per year, 3-6 young per litter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liomys irroratus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2141-09|EU107501|Liomys irroratus| AATCGCTGACTCTTCTCTACTAACCATAAAGACATCGGCACCTTATACATAATTTTCGGGGCTTGAGCAGGAATAGTAGGAACTGGTCTT---AGCATCTTAATCCGGGCTGAGTTAGGTCAACCCGGGTCCCTATTAGGAGAT---GACCAAATTTATAACGTAATTGTAACCGCACACGCCTTTGTTATAATCTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGGAACTGGTTAGTACCCTTAATA---ATTGGAGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGGCTCCTACCCCCCTCTTTCCTTCTCCTTCTAGCCTCCTCAATAGTTGAAGCAGGTGCAGGAACAGGTTGAACTGTGTACCCACCTCTTGCAGGAAACCTTGCACACGCAGGAGCATCTGTTGACCTA---GCTATTTTTTCTCTTCACCTGGCCGGGGTATCTTCAATCTTAGGGGCCATTAATTTTATTACAACTATCATCAACATAAAACCACCTGCCATATCACAGTACCAAACTCCTCTCTTTGTATGATCAGTATTAATTACTGCTGTACTCCTTCTGCTGTCCTTACCTGTCCTAGCCGCT---GGAATTACCATACTACTAACAGACCGTAACCTAAATACTACCTTTTTTGATCCAGCAGGAGGAGGGGATCCTATCCTATATCAGCACTTATTCTGATTCTTTGGACATCCTGAAGTATATATTCTAATTCTCCCAGGATTTGGGATAATCTCTCATATCGTAACATACTACTCAGGCAAAAAA---GAACCATTTGGTTATATAGGGATAGTATGAGCCATAATATCAATCGGATTTCTAGGATTTATTGTTTGAGCCCATCACATATTTACAGTCGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Liomys irroratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 15
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common but limited (Wilson and Ruff 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Liomys irroratus is not known to have any adverse affects on human populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mexican Spiny Pocket Mouse

The Mexican Spiny Pocket Mouse (Liomys irroratus) is a species of rodent in the Heteromyidae family. It is found in Mexico and in Texas in the United States.[1]

References

  1. ^ a b Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T. (2008). Liomys irroratus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 16 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!