Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"The Banner-tailed Kangaroo Rat confines its activities to small areas near the large earthen mounds that contain its complex burrow systems. Usually gentle and timid, this Kangaroo Rat will fight furiously to defend its territory from invasion by other Banner-tailed Kangaroo Rats. Foot-drumming on top of the mounds is used as a warning signal. Like other kangaroo rats, it sandbathes, both to clean its fur and to scent-mark its territory. The white tip on the end of its long tail waves as the animal moves around, giving this Kangaroo Rat both its common name, Banner-tailed, and its Latin scientific name, ""spectabilis,"" which means visible, worth seeing, notable, admirable, or remarkable."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Merriam, C.H., 1890.  Descriptions of three new kangaroo rats, with remarks on the identity of Dipodomys ordii of Woodhouse, p. 46.  North American Fauna, 4:41-49.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Geographic Range

The banner-tailed kangaroo rat occurs in southwestern North America, from northeastern Arizona southward to Aguascalientes and San Luis Potosi, and from southern Arizona eastward to west Texas. Six of seven subspecies of this kangaroo rat occupies the same range. The seventh subspecies occurs further south (Best 1988).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range Description

This species has a disjunct distribution. The northern portion of its range is from north-eastern Arizona, northern New Mexico, and far western Texas (USA), southward to northern Sonora and Chihuahua (Mexico). The southern portion of its range is in central Mexico, primarily in Aguascalientes and San Luis Potosi states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern and northeastern Arizona, northwestern and central New Mexico, and western Texas south to northern Sonora, and southern Chihuahua; disjunct population in north-central Mexico (Aguascalientes, Zacatecas, San Luis Potosi). See map in Best (1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Banner-tailed kangaroo rats are the largest in their genus. Dorsally, the bannertails are a light ochraceous-buff mixed with black-tipped hairs. This buff shade is purest on the sides and palest on the cheeks. The ventral surface, forelimbs, the dorsal surface and sides of hind feet, hip stripes, supraorbital and postauricular spots, and the distal end of the tail are all pure white. An ochraceous-buff hip patch extends down the leg behind the ankle and forms a large dark spot that reaches the heel and leaves a white spot anteriorly (Best 1988).

The tail is long and the proximal half is covered with short hairs whereas the distal half is covered with long hairs. Dorsal and ventral tail stripes are gray-black to dusky and they unite to form a continuous black band around the tail subterminally. Lateral tail stripes are white and gradually narrow beyond the proximal half of the tail and disappear at the subterminal band. At the base of the tail, the white ring is nearly complete with gray to black hairs ventrally (Best 1988).

Adult bannertails molt once a year. New hair first appears on the snout and cheeks, then proceeds posteriorly to the level of the ears. Mid-dorsally, a saddle-shaped area of new hairs appears and then the molt continues anteriorly. Later, molt proceeds laterally to the shoulders and sides and posteriorly to the hind legs and rump (Best 1988).

Bannertails are highly adapted for saltatorial locomotion. Their hindlegs and four-toed hindfeet are much longer than their forelegs (Best 1988).

These kangaroo rats are extremely sexually dimorphic. Males are significantly larger in characteristics such as total length, length of tail, greatest length, width, and depth of cranium, and maxillary arch spread. Male bannertails also have the largest baculum in the genus (Best 1988).

A skin glad is located in the mid-dorsal skin over the arch of the back. This gland secretes excess oil which is usually absorbed by sand and dust. This excess oil may allow bannertails to swim better, stay drier, and float higher than other small rodents (Best 1988).

Cheek pouches are used for seed collection (Biota Information System of New Mexico 1997).

Average mass: 145 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Size

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 342 mm males; 338 mm females
Range: 315-349 mm males; 310-345 mm females

Weight:
Average: 126 g males; 120 g females
Range: 100-132 g males; 98-130 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Length: 37 cm

Weight: 132 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Bannertails occur in areas with well-developed grasslands and scattered shrubs (Findley et al 1975). Heavier soils are preferred because light soils may be unable to support the bannertails' complex burrow systems. Basins are avoided where basal cover of grass is low (Biota Information System of New Mexico 1997).

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Desert grasslands with scattered shrubs. However, these kangaroo rats disappear when invasive shrub cover exceeds 20%. Thus, their presence is an indicator of the health of desert grasslands (Krogh et al. 2002; Waser and Ayers 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers dry, gravelly soil of arid or semi-arid grasslands and foothill slopes with scattered mesquite, junipers, or mixed stands of creosote-bush and acacias. When inactive, occupies underground burrow (in open or at base of shrub) in large mound. Young are born in one of several burrow chambers; young share natal burrow with mother for 2-6 months after weaning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Banner-tailed kangaroo rats are primarily granivorous, surviving on many species of grass seeds. Seeds are collected during seed production months in the spring and fall and transported to underground caches via cheek pouches (Biota Information System of New Mexico 1997). Stored food may be segregated by species, though material is often mixed (Best 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Primarily seeds in addition to some green vegetation. Stores seeds in chambers in den mound (Reichman et al. 1985); relies on these stores during periods of low seed availability in winter and spring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary males and females defend territories throughout the year. Home range averaged about 400-700 sq m in New Mexico; usually stayed within 160 m of burrow mound. Density of active mounds was 1.7/ha in central New Mexico (Best 1988). Usually 1 individual/mound except when young present. Mounds usually are rather uniformly spaced. In southeastern Arizona, maximum density (six-month average) was 9-10/ha; up to 26/ha on a monthly basis; a catastrophic population decline occurred after the heavy rains of a tropical storm, which possibly affected seed stores (Valone et al. 1995).

Dispersal distances generally are very short; most individuals breed within one home range diameter of natal site.

Has a strong effect on microhabitat selection by local desert rodent communities (Bowers and Brown 1992) and may impact populations of other rodents (Valone et al. 1995). With other kangaroo rats, affects vegetation structure and plant species diversity in the Chihuahuan Desert (Heske et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout the year, but remains in burrow when weather rainy, wet, or cold (Vorhis and Taylor 1922). Activity peaks in early evening. Sometimes active in daylight. Moonlight may reduce activity under certain circumstances. Best 1988.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.7 years (captivity) Observations: One wild born specimen was about 12.7 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Lifespan/Longevity

Range lifespan

Status: captivity:
12.7 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Banner-tailed kangaroo rat reproduction occurs year-round. Males are attracted to urine of estrous females and they will compete for access to her. Mating patterns include mutual circling and nonlocking copulation with a single mount. After copulation, the vagina becomes plugged with a translucent material with a consistency of stiff gelatin (Best 1988). Females typically have one or two litters of one to three offspring a year (Jones 1984). At birth, young are toothless, hairless, wrinkled, eyes and ears are closed, and they show the color pattern of adults in shades of pink. Young males grow faster in terms of mass than young females (Best 1988). Young are weaned at about one month of age (Jones 1984). Both male and female young are known to remain in their natal burrows for three to seven months. Many offspring remain in natal home ranges through reproductive maturity. This natal philopatry is common in gregarious mammals. This may provide juvenilles with access to essential resources that are not readily available outside natal home ranges. Also, mound availability is limited (Jones 1984).

Average birth mass: 7.75 g.

Average gestation period: 23 days.

Average number of offspring: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Pregnancies have been recorded January-September in north (peak in April), December-August in south (peaks in December, June-July). Litter size is 1-3. Up to 4 litters/year. Gestation lasts about 3-4 weeks. Young in mid-August may be offspring of females born in mid-winter or second litter of year. In southeastern Arizona, juveniles become active above ground mainly March-August, reside in maternal mound for 1-6 months after weaning, mature in 300 days. Reproductive output is highest following summers of heavy rainfall.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dipodomys spectabilis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1831-08|EF156845|Dipodomys spectabilis| AACCGTTGACTATTCTCAACTAATCATAAAGACATCGGAACCCTCTATATAATCTTTGGTGCTTGAGCCGGAATAGTAGGAACAGGACTA---AGCATCCTAATTCGAGCAGAACTAGGCCAACCTGGCTCCCTATTAGGAGAT---GACCAAATCTACAATGTAATTGTCACTGCCCACGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATGATCGGCGGGTTCGGAAACTGACTAGTCCCCCTAATA---ATTGGTGCACCCGACATAGCCTTCCCACGAATAAATAACATAAGCTTCTGACTCTTACCACCTTCCTTCCTCCTCCTGCTAGCATCCTCCATAGTTGAATCTGGAGCCGGAACAGGATGAACTGTGTACCCACCTCTAGCAGGAAATCTAGCACATGCTGGAGCCTCTGTCGACCTG---ACAATTTTCTCTCTTCACCTAGCAGGAGTATCCTCTATTCTCGGAGCTATTAATTTCATTACTACCATCATCAACATGAAACCACCCGCTATATCACAATATCAAACACCCCTATTTGTCTGATCTGTCCTCATCACAGCCGTTCTTCTCCTGCTATCCCTCCCAGTACTAGCTGCA---GGAATTACTATACTCCTAACAGACCGTAATCTTAACACAACCTTCTTCGACCCCGCAGGAGGTGGAGACCCAGTACTTTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTTATTCTTCCCGGATTCGGAATAATCTCACACATTGTCACATATTATTCAGGAAAAAAA---GAACCCTTCGGATATATAGGCATGGTCTGAGCTATGATGTCTATTGGATTCCTAGGTTTCATTGTATGGGCACACCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dipodomys spectabilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Banner-tailed kangaroo rat habitats may be at risk due to land development by humans.

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Frey, J. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
Listed as Near Threatened because it is probably in significant decline (but probably at a rate of less than 30% over ten years) due to widespread degradation of its desert grassland habitat through much of its range, thus making the species close to qualifying for Vulnerable under criterion A2c.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species can be locally common.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Degradation of desert grasslands, with replacement by mesquite or creosote bush communities, is a major threat (Whitford 1997). Declines in some areas correspond with increases in the density of woody plants associated with grassland degradation. Heavy rains associated with tropical storms possibly may impact seed stores and cause major population declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Heavy rains associated with tropical storms possibly may impact seed stores and cause major population declines (Valone et al. 1995). Declines in some areas correspond with increases in the density of woody plants associated with grassland degradation (Waser and Ayers 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Bannertails are highly palatable to man (Best 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Economic Uses

Comments: Eaten by humans in parts of San Luis Potosi (Best 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Banner tails carry many fleas which could be passed on to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Wikipedia

Banner-tailed Kangaroo Rat

The Banner-tailed Kangaroo Rat (Dipodomys spectabilis) is a species of rodent in the Heteromyidae family. They are found in Mexico and Arizona, New Mexico and Texas in the United States.[1]

References

  1. ^ a b Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Frey, J. & Lacher, T. (2008). Dipodomys spectabilis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
  • Patton, J. L. 2005. Family Heteromyidae. Pp. 844-858 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Names and Taxonomy

Taxonomy

Comments: Has been regarded as conspecific with D. nelsoni by one author, but this not substantiated by further studies. Patton (in Wilson and Reeder 1993, 2005) recognized D. spectabilis and D. nelsoni as distinct species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!