Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"By occupying the short grass prairie of the Great Plains, and a variety of habitats where there are fine-textured, sandy soils, Ord's Kangaroo Rat has managed a truly enormous geographic distribution. The varied habitats that it occupies include semi-arid grasslands, mixed-grasslands, and scrublands. This ecological variation, together with the considerable geographic range, has contributed to the fact that more than 30 subspecies have been named. Ord's Kangaroo Rats are most active on cloudy nights. They usually stay in their burrows in bad weather and especially on clear, moonlit nights when owls can spot them most easily. Other predators include foxes, coyotes, badgers, and long-tailed weasels."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Woodhouse, S.W., 1853.  Description of a new species of pouched rat, of the genus Dipodomys, Gray, p.235.  Proceedings of the Academy of Natural Sciences of Philadelphia, 6:235-236.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Geographic Range

Dipodomys ordii are the most widespread of all Kangaroo rats. They are found through much of western North America from Saskatchewan to Mexico. The Kansas plains, Great Sandhills of Sakatchewan and the California sagebrush are all common habitats. (Banfield 1974; La Flamme 2000)

Biogeographic Regions: nearctic (Native )

  • Banfield, A. 1974. The Mammals of Canada. Toronto: University of Toronto Press.
  • La Flamme, J. 2000. "Kangaroo Rat (Canadian Museum of Nature)" (On-line). Accessed Nov 15, 2000 at http://www.nature.ca/notebooks/english/kangarat.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range Description

Ranges from southern Alberta and Saskatchewan (Canada) in the north to southern Hidalgo, Mexico in the south. Eastward from central Oregon and eastern California to central Kansas and Oklahoma (United States).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Mexican Highlands, Great Plains, and Great Basin of western North America: southern Alberta and Saskatchewan (Gummer, 1995 COSEWIC report)to southern Hidalgo, west to southern Washington, Oregon, northeastern California, Arizona, and northeastern Sonora; east to southwestern North Dakota, South Dakota, Nebraska, Kansas, Oklahoma, and western Texas (Garrison and Best 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Total length ranges from 210-365 mm in males, and 208-360 mm in females. Tail length is, on average, 129 mm in males and 127 mm in females. The long tail is dark on top with two white bands on each side tapering to a grey tuft of longer hairs at the end. Ord's kangaroo rats have small forelimbs and long, strong hindlegs which are modified for jumping (Feldner 1996; Walker 1975).

Coloration of the long silky fur is rich and tawny on top with a scattering of black hairs along the middorsal line. D. ordii have distict white markings which include underparts of the feet, upper lip, spots above the eyes and across the hips.

There are no pelage differences between males and females but there are seasonal variations in weight for all D. ordii. Their weight peaks around mating season (Banfield 1974).

Range mass: 55 to 96 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.339 W.

  • Feldner, J. 1996. "Kangaroo Rats (Desert Usa.com)" (On-line). Accessed Nov 15,2000 at http://www.desertusa.com/aug96/du_krat.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Size

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 243 mm males; 242 mm females
Range: 210-365 mm males; 208-360 mm females

Weight:
Average: 52 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Length: 24 cm

Weight: 52 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

D. ordii can be found on the riverbanks and the Great Sand Hills of Saskatchewan, throughout the Kansas plains, and the deserts of the southwestern United States (Banfield 1974; La Flamme 2000; Walker 1975).

In general, D. ordii prefers arid climates with sparse vegetation covering the sandy ground. Open ground is better for this animal, as it has been observed that an increase in grass cover leads to a decrease in population. Their burrows are rarely located in hard and gravelly soils and they are one of the few animals that are able to establish in shifting dunes (Banfield 1974; Davis and Schmidly 1994).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Other Habitat Features: agricultural

  • Davis, W., D. Schmidly. 1994. "Ord's Kangaroo Rat (The Mammals of Texas -online edition)" (On-line). Accessed Nov 19, 2000 at http://www.nsrl.ttu.edu/tmot1/dipoordi.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Occurs in a variety of vegetation types, but all are associated with fine-textured, sandy soils. Vegetation includes semi-arid grasslands, mixed-grasslands, and scrublands.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers sandy soil in open, sparsely vegetated areas; grasslands and shrublands (e.g. sagebrush, rabbitbrush, greasewood, Atriplex) that have open bare soil; also woodland (pinyon/juniper, oak, mesquite). In underground burrows when inactive. Burrows often at the base of shrubs or grasses. Young are born in grass-lined nests in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Ord's kangaroo rats is primarily composed of seeds. These seeds are gathered in fur lined cheek pouches for transport back to their burrows for storage. D. ordii forage for up to 25 yards from their burrow entrance. In the summer, D. ordii also feed on grasshoppers and moths. Water retention is very efficient in Ord's kangaroo rats and they use the water produced from metabolism for their bodily requirements. As a result, they have very little need for water consumption and will only drink water when absolutely necessary.

(Feldner 1996; Walker 1975)

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Feeds on a wide variety of seeds (mainly of grasses and forbs). May eat green vegetation when available. Eats some insects and other arthropods. Stores food in burrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

In encounters with particularily threating predators, D. ordii will turn around and face away from the enemy and use their hind legs to spray sand into the enemy's eyes. D. ordii can evade predators with long jumps measuring up to 2 meters long.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

General Ecology

Solitary except during breeding season. Population density in Nevada was 1-5/2.7 ha; in Texas, 10-27/ha; up to 53/ha in some areas. Annual home range about 1 ha or less. May live at least 2 years. Predators include rattlesnakes, skunks, coyotes, foxes, owls, etc. With other kangaroo rats, affects vegetation structure and plant species diversity in the Chihuahuan Desert (Heske et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Kangaroo rats have a keen sense of smell, extraordinary hearing, and good night vision.

D. ordii individuals have an oil secreting gland located between the shoulders. They bathe regularily in sand to prevent the fur from becoming oily and matted. Secretions from the gland also allow D. ordii to distinguish individuals and sexes (Walker 1975).

Ord's kangaroo rats rarely make any vocal calls, the sounds that are made are usually soft squeaks. Instead they use their hind legs to make loud thumping noises in their burrow when the entrance is disturbed (Feldner 1996; Walker 1975).

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; vibrations

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Cyclicity

Comments: Active throughout most of year. May become dormant below ground in winter, especially in north. Strictly nocturnal. In spring in Utah, activity peaks shortly after sunset; secondary peak shortly before dawn; individuals active a maximum of 2 hours/night. In Nevada, activity occurred only after midnight in winter, mainly after midnight in summer. Activity increases under cloud cover, especially in winter; decreases in inclement weather, clear nights, and under moonlight; ceases when temperature less than -11 C or when snow cover more than 40% (Garrison and Best 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Lifespan/Longevity

Average lifespan

Status: captivity:
9.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

D. ordii are solitary animals that will only let potential mates approach during the mating seasons in spring and fall. Exact timing of mating seasons varies geographically. Females breed only when there is a favorable moist season, few breed during drought.

During estrus, which lasts for a few days, this species will pursue each other playfully. With an approximate gestation period of a month and sexual maturity at 2 months, the population can expand rapidly after a favorable season. (Banfield 1974)

Breeding interval: Ord's kangaroo rats breed when conditions are appropriate, with abundant food sources for both mother and young.

Breeding season: Breeding seasons are typically in the spring and fall, but vary throughout the range of Ord's kangaroo rats.

Average age at sexual or reproductive maturity (female): 2 months.

Average age at sexual or reproductive maturity (male): 2 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 5 g.

Average gestation period: 29 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (female)

Sex: female:
61 days.

  • Banfield, A. 1974. The Mammals of Canada. Toronto: University of Toronto Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Reproductive patterns vary geographically; reproduction generally begins with appearance of green vegetation. Females are seasonally polyestrous. In New Mexico breeding may last from February-June; in Texas from August-February, August-March in Oklahoma; in Canada breeding occurs in spring. Gestation is 28-32 days. Average litter size is 3, varies with conditions. Sexual mature in about 83 days. In Oklahoma, many produce 2 litters per year in favorable years, and females born early in season produce a litter before end of same season (Caire et al. 1989). Drought may inhibit reproduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dipodomys ordii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2130-09|EU107512|Dipodomys ordii| AACCGTTGATTATTCTCTTCAAACCATAAAGACATCGGAACCCTCTATATAATTTTTGGTGCTTGAGCCGGAATAGTAGGAACAGGCCTA---AGCATTCTTATCCGAGCAGAGCTAGGTCAACCTGGCTCATTATTAGGAGAC---GATCAAATTTACAATGTAATTGTCACTGCCCATGCATTCGTAATAATCTTCTTCATAGTTATACCAATTCTAATTGGTGGATTTGGGAACTGATTAGTCCCACTAATA---ATTGGCGCACCAGATATAGCTTTCCCACGAATAAACAACATAAGCTTTTGATTACTTCCACCTTCCTTTCTTCTACTTCTAGCATCATCAATAATTGAATCAGGAACCGGAACAGGATGAACTGTCTACCCTCCTCTGGCAGGAAATCTTGCACACGCCGGAGCTTCCGTTGATCTT---ACAATTTTCTCTCTTCACCTAGCAGGTGTATCATCAATTCTAGGAGCAATCAATTTTATTACAACTATCATTAACATAAAACCACCAGCAATATCACAATATCAAACACCACTGTTCGTTTGATCCGTACTTATCACAGCTGTACTACTCTTACTATCCCTACCTGTTCTGGCCGCA---GGCATTACAATACTCTTAACAGACCGAAATCTCAACACAACATTCTTTGATCCAGCTGGAGGAGGAGACCCAGTACTTTATCAACACCTATTCTGATTCTTTGGCCACCCCGAAGTGTATATTCTTATTCTTCCCGGATTTGGAATAATTTCACATATCGTGACATACTATTCTGGAAAAAAA---GAACCCTTTGGATACATAGGAATAGTATGAGCCATAATATCTATTGGATTCCTAGGATTTATCGTATGAGCCCACCACATATTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dipodomys ordii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 9
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Ord's kangaroo rats are one of the most common kangaroo rats. In western Canada, however, D. ordii is considered vulnerable.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & Timm, R.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Wide ranging and common. Very abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known. In, Mexico it inhabits areas with low human activity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Very abundant in protected areas in the United States and probably in Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ord's kangaroo rats do not adversely affect humans over most of their range. However in areas of Texas, D. ordii are reputed to do damage by gathering the seeds of newly planted crops (Davis and Schmidly 1994).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Economic Importance for Humans: Positive

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Risks

Species Impact: This and other rodents can constrain the establishment of large-seeded grass species (Hoffman et al. 1995, Ecological Applications 5:200-208).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ord's Kangaroo Rat

Ord's Kangaroo Rat, Dipodomys ordii, is a kangaroo rat that is native to Western North America, specifically the Great Plains and the Great Basin with its range extending from extreme southern Canada to central Mexico.[2]

Ord's Kangaroo Rat has a 5th toe on its hind foot which distinguishes it from Dipodomys elator. It is bicolored with gold-brown dorsal hair and a white stomach. It has a long tail with a bushy tip, and is dark dorsally and ventrally with a white lateral stripe. Its hind foot is modified for jumping and exceeds 35 mm in length, and its total length exceeds 240 mm. Its tail is usually less than 160 mm, distinguishing it from Dipodomys elator (which exceeds 160 mm).

Though a common species in the United States, the population in Canada is considered endangered.[3]

Contents

Taxononmy

The currently accepted scientific name for Ord's kangaroo rat is Dipodomys ordii Woodhouse. It belongs to the family Heteromyidae, kangaroo rats and mice. Hall[4] listed 35 subspecies; however, Kennedy and Schnell reported that many of these subspecies are probably not legitimate since they were based on the assumption that there is little sexual dimorphism in the species. It has now been established that there is much sexual dimorphism within the taxon.[5]

Distribution

Ord's kangaroo rat ranges from southern Alberta and southern Saskatchewan to southern Hidalgo, Mexico, and from central Oregon and eastern California east to central Kansas and Oklahoma.[6].

Ord's kangaroo rats occur mainly in semiarid, open habitats. In Nevada they were trapped in desert scrub and gravelly soil, flat pebble desert, and washes.[7] In Utah, Ord's kangaroo rats have an affinity for open shrublands and grasslands on sandy soils.[6] In southeastern Idaho big sagebrush/crested wheatgrass (Agropyron cristatum) range, most Ord's kangaroo rat captures occurred on disturbed sites or areas of sparse cover: Russian-thistle (Salsola kali), cheatgrass (Bromus tectorum), and green rabbitbrush (Chrysothamnus viscidiflorus), followed by disturbed areas seeded to crested wheatgrass, then undisturbed big sagebrush.[8] In western South Dakota, Ord's kangaroo rats are associated with black-tailed prairie dog (Cynomys ludovicianus) towns.[9] In Wyoming, Ord's kangaroo rats are abundant in sand dune communities where vegetation is greater than 10 inches (25 cm) tall and bare soil exceeds 40% [6]. In Colorado, Ord's kangaroo rats were primarily captured in open areas with firm soil. Firm or lightly compacted soils are needed for burrow construction; highly compacted soils are too hard to dig into.[10] In areas of desert pavement or tough clay soils in the Trans-Pecos region of Texas, Ord's kangaroo rats are confined to pockets of windblown sand and alluvial soils along arroyos [11].

There is strong intraspecific competition and little interspecific competition among Dipodomys species.[12] In New Mexico, where Ord's kangaroo rats are sympatric with Merriam's kangaroo rats (Dipodomys merriamii), Ord's kangaroo rats were mostly captured in grassy microhabitats, and Merriam's kangaroo rats were captured more often around creosotebush.[12] Herbicide defoliation of shrubs (for rangeland improvement) reduced live canopy cover of creosotebush and resulted in an increase in bush muhly (Muhlenbergia porteri). After treatment Ord's kangaroo rat replaced Merriam's kangaroo rat as the dominant rodent. It was suggested that this was due to the change in habitat structure to open grass.[13]

Removal experiments to establish single species populations of kangaroo rats were unsuccessful since many kangaroo rats are transient and quickly occupy vacated habitats.[12] Only one adult occupies a given burrow system, except for a brief period during breeding activity. There is little territoriality above groud except near the burrow entrance, which is defended.[7]

In New Mexico, Ord's kangaroo rat annual home ranges in mesquite averaged 3.35 acres (1.36 ha).[6] In Nevada sagebrush/grassland, Ord's kangaroo rat home ranges were estimated as 1.53 acres (0.62 ha) by the circular method and 1.06 acres (0.43 ha) by the principal component method. Home range movements increased through spring and again in late fall and early winter. There was no significant difference between male and female Ord's kangaroo rat home ranges; however, female home ranges decreased during reproductive periods.[14] Recapture data for Ord's kangaroo rats in Arizona indicate that they do not travel far from the home range; most Ord's kangaroo rats were recaptured within 165 ft (50 m) of the original capture site. Data on the lifetime movements of individuals indicated that most were recaptured within 330 feet (100 m) of the original capture site.[15]

In sagebrush in the Great Basin, Ord's kangaroo rats reach an average density of 113 Ord's kangaroo rats per 10 hectares.[16] In intermountain salt-desert shrublands, Ord's kangaroo rat population density average 28 individuals per 10 hectares in shadscale communities and 135 individuals per 10 hectares in black greasewood (Sarcobatus vermiculatus) communities.[17]

Plant communities

Ord's kangaroo rats occur in communities on sandy soils including semiarid grasslands, mixed-grass prairie, shrub- and scrublands, and pinyon (Pinus spp.)-juniper (Juniperus spp.) woodlands [6]. In Canada, Ord's kangaroo rats are confined to open, sandy areas with a sparse cover of sagebrush (Artemisia spp.), snowberry (Symphoricarpos spp.), rose (Rosa spp.), creeping juniper (J. horizontalis) and buffaloberry (Shepherdia spp.); the distribution of Ord's kangaroo rats appears to be closely associated with that of lanceleaved breadroot (Psoralea lanceolata) [18]. In Oregon, Ord's kangaroo rats occur in big sagebrush (A. tridentata), western juniper (J. occidentalis), and greasewood (Sarcobatus spp.) communities. In Idaho, they are most abundant in juniper woodlands with rabbitbrush (Chrysothamnus spp.) and winterfat (Krascheninnikovia lanata) in the understory [6], but also occur on shadscale (Atriplex confertifolia) range [19]. In Utah, Ord's kangaroo rats have an affinity for sagebrush, pinyon-juniper, and saltbush (Atriplex spp.) communities [6]. In Nevada, Ord's kangaroo rats are associated with big sagebrush communities [20]. In Colorado, Ord's kangaroo rats comprised 19% of small mammal captures in pinyon-juniper forest, scattered pinyon-juniper, and pinyon-juniper in canyon habitats [10]. In New Mexico, Ord's kangaroo rats are found in yucca (Yucca spp.), oak (Quercus spp.), mesquite (Prosopis spp.), saltbush, and creosotebush (Larrea tridentata) communities.[6][21] They are particularly abundant in mesquite sand dunes.[22] In Texas, Ord's kangaroo rats occur in honey mesquite (P. glandulosa), sand sagebrush (Artemisia filifolia), yucca, sand shinnery oak (Q. havardii), and broom snakeweed (Gutierrezia sarothrae) communities [6]. In southwestern Kansas, Ord's kangaroo rats are characteristic residents of sand sagebrush prairie.[23]

Cover requirements

Even in shrub-dominated communities, heteromyids including Ord's kangaroo rat tend to concentrate their activity in open areas between shrubs [24].

Ord's kangaroo rats are poor diggers because of their weak forelegs and slender claws. They dig shallow burrows in loose sand in the sides of natural sand dunes, riverbanks, or road cuts. There is one central burrow surrounded by trails to feeding areas [18]. Ord's kangaroo rat burrows have 3-inch (7.6 cm) diameter openings. Small mounds are usually formed outside the entrance to the burrow.[25] The burrow opening is usually plugged with soil during the day to maintain temperature and humidity within tolerable levels.[6][26] They scoop out small, shallow depressions to be used as dusting spots.[25]

Timing of major life events

Ord's kangaroo rats are nocturnal. They spend the day in deep burrows.[25] Males are usually more abundant and active than females. Ord's kangaroo rat activity increases under cloud cover, particularly in winter.[6] Ord's kangaroo rats are active year-round in Texas, but further north they are seldom seen aboveground in cold weather.[25]

Ord's kangaroo rat breeding season varies with subspecies and area. There are usually one or two peak breeding seasons per year, and in many areas some breeding activity occurs year-round [6][27]. The size of ovaries is significantly positively correlated with temperature [6]. The average length of the breeding period is 6.8 months. In Texas, males are fertile all year, with peak reproductive activity occurring between August and March. Higher reproductive rates are associated with increased precipitation and food supply and decreased population density. In a favorable growing season most females bred at least twice a year; but when population density increased females did not breed until November even though growing conditions and food supplies were favorable [28]. In Arizona the lowest proportion of males in breeding condition (about 60% of the male population) occurred in January and September–October. The lowest number of females in breeding condition occurred in November, but there were at least a few females breeding at that time [29]. In Oklahoma, there are two peaks in breeding activity: August–September and December through March [30]. In many areas the onset of breeding activity follows a period of rainfall the previous month.[6]

Gestation lasts 28 to 32 days. There are usually one to six embryos. In captivity the maximum litter size was six young.[6] The maximum number of litters produced per year by a captive female was five, the maximum number of litters per lifetime was nine, and the maximum number of young per female's lifetime was 38. The longest-lived Ord's kangaroo rat in captivity was 7 years 5 months.[6] Brown and Zeng calculated an annual death rate of 0.35 for all age classes.[15]

Food habits

Ord's kangaroo rats are primarily granivorous and herbivorous. They consume a variety of foods but most commonly the seeds of grasses and forbs, green vegetation, and dry vegetation. They occasionally consume animal material, mostly arthropods. In Colorado seeds comprised 74% of Ord's kangaroo rat diets, forbs 13%, grasses and sedges 5%, arthropods 4%, and fungi and mosses 2% [6].

In southeastern Idaho big sagebrush/crested wheatgrass range, Ord's kangaroo rats consumed (in order of proportion) pollen, arthropods, plant parts (Asteraceae) and crested wheatgrass seeds [8]. A study of Ord's kangaroo rat foods in Texas found that the primary foods consumed included seeds of sand paspalum (Paspalum stramineum), honey mesquite, sand bluestem (Andropogon gerardii var. paucipilus), common ragweed (Ambrosia artemisiifolia), and rose-ring gaillardia (Gaillardia pulchella) [31]. In Texas seeds of creosotebush, gramas (Bouteloua spp.) and dropseeds (Sporobolus spp.) form the major portion of Ord's kangaroo rat diets [11]. Seeds of mesquite, Russian-thistle, sunflowers (Helianthus spp.), and sandbur (Cenchrus spp.) are also major dietary items.[25]

Harvested seeds are transported in cheek pouches to burrows and consumed or cached there. Ord's kangaroo rats also cache seed in scattered shallow holes; this activity sometimes results in seedling emergence. Ord's kangaroo rats are easily able to retrieve shallowly buried seeds. A single Ord's kangaroo rat may make tens to hundreds of caches, each with tens to hundreds of seeds [32].

Kangaroo rats are physiologically adapted to arid environments. Most water is obtained from seeds and succulent plants. They drink water when it is available but apparently do not require free water [18][33].

Predators

In the Great Basin sagebrush, intermountain sagebrush steppe, and intermountain salt desert shrublands potential predators of Ord's kangaroo rats include coyotes (Canis latrans), Kit Fox (Vulpes velox), bobcats (Lynx rufus), badgers (Taxidea taxus), long-eared owls (Asio otus), short-eared owls (Asio flammeus), great horned owls (Bubo virginianus), burrowing owls (Athene cunicularia), hawks (Buteonidae and Falconidae spp.), rattlesnakes (Crotalus spp.), and gopher snakes (Pituophis melanoleucus) .[16][17][34] In Idaho, the remains of Ord's kangaroo rats were found in up to 25% of prairie falcon (Falco mexicanus) nests. The 3-year average frequency of Ord's kangaroo rat remains in prairie falcon nests was 4%.[35]

References

 This article incorporates public domain material from the United States Department of Agriculture document "Dipodomys ordii".

  1. ^ Linzey, A.V. & Timm, R. (2008). Dipodomys ordii. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
  2. ^ Teh, Poh-lin (2001). "ADW : Dipodomys ordii : Information". Animal Diversity Web (University of Michigan). http://www.speciesatrisk.gc.ca/search/speciesDetails_e.cfm?SpeciesID=164. Retrieved 2007-08-15. 
  3. ^ "Species at Risk - Ord's Kangaroo Rat". Environment Canada. 2006-05-08. http://www.speciesatrisk.gc.ca/search/speciesDetails_e.cfm?SpeciesID=164. Retrieved 2007-08-15. 
  4. ^ Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons
  5. ^ Kennedy, Michael L.; Schnell, Gary D. 1978. Geographic variation and sexual dimorphism in Ord's kangaroo rat, Dipodomys ordii. Journal of Mammalogy. 59(1): 45-59
  6. ^ a b c d e f g h i j k l m n o p q Garrison, Tom E.; Best, Troy L. 1990. Dipodomys ordii. Mammalian Species. 353: 1–10
  7. ^ a b Eisenberg, John Frederick. 1963. The behavior of heteromyid rodents. University of California Publ. in Zoology: Vol. 69. Berkeley, CA: University of California Press
  8. ^ a b Koehler, David K.; Anderson, Stanley H. 1991. Habitat use & food selection of small mammals near a sagebrush/crested wheatgrass interface in southeastern Idaho. Great Basin Naturalist. 51(3): 249–255
  9. ^ Sharps, Jon C.; Uresk, Daniel W. 1990. Ecological review of black-tailed prairie dogs and associated species in western South Dakota. Great Basin Naturalist. 50(4): 339–344
  10. ^ a b Ribble, David O.; Samson, Fred B. 1987. Microhabitat associations of small mammals in southeastern Colorado, with special emphasis on Peromyscus (Rodentia). Southwestern Naturalist. 32(3): 291–303
  11. ^ a b Schmidly, David J. 1977. The mammals of Trans-Pecos Texas: including Big Bend National Park and Guadalupe Mountains National Park. College Station, TX: Texas A&M University
  12. ^ a b c Schroder, Gene D.; Rosenzweig, Michael L. 1975. Perturbation analysis of competition and overlap in habitat utilization between Dipodomys ordii and Dipodomys merriami. Oecologia. 19: 9–28
  13. ^ Whitford, Walter G.; Dick-Peddie, Scott; Walters, David; Ludwig, John A. 1978. Effects of shrub defoliation on grass cover and rodent species in a Chihuahuan desert ecosystem. Journal of Arid Environments. 1: 237–242
  14. ^ O'Farrell, Michael J. 1978. Home range dynamics of rodents in a sagebrush community. Journal of Mammalogy. 59(4): 657–668
  15. ^ a b Brown, James H.; Zeng, Zongyong. 1989. Comparative population ecology of eleven species of rodents in the Chihuahuan Desert. Ecology. 70(5): 1507-1525
  16. ^ a b West, N. E. 1983. Great Basin-Colorado plateau sagebrush semi-desert. In: Temperate deserts and semi-deserts. Amsterdam; Oxford; New York: Elsevier Scientific Publishing Company: 331–349. (Goodall, David W., ed. in chief; Ecosystems of the world; vol. 5)
  17. ^ a b West, Neil E. 1983. Intermountain salt-desert shrubland. In: West, Neil E., ed. Temperate deserts and semi-deserts. Amsterdam; Oxford; New York: Elsevier Scientific Publishing Company; 1983: 375–397. (Goodall, David W., ed. in chief.; Ecosystems of the world; vol. 5)
  18. ^ a b c Banfield, A. W. F. 1974. The mammals of Canada. Toronto: University of Toronto Press
  19. ^ Groves, Craig R.; Steenhof, Karen. 1988. Responses of small mammals and vegetation to wildfire in shadscale communities of southwestern Idaho. Northwest Science. 62(5): 205–210
  20. ^ Welch, Bruce L.; McArthur, E. Durant. 1985. Big sagebrush--its taxonomy, origin, distribution and utility. In: Fisser, Herbert G., ed. Wyoming shrublands: Proceedings, 14th Wyoming shrub ecology workshop; 1985 May 29–30; Rock Springs, WY. Laramie, WY: University of Wyoming, Department of Range Management, Wyoming Shrub Ecology Workshop: 3–19
  21. ^ Mares, M. A.; Hulse, A. C. 1977. Patterns of some vertebrate communities in creosote bush deserts. In: Mabry, T. J.; Hunziker, J. H.; DiFeo, D. R., Jr., eds. Creosote bush: Biology and chemistry of Larrea in New World deserts. U.S./IBP Synthesis Series 6. Stroudsburg, PA: Dowden, Hutchinson & Ross, Inc: 209–226
  22. ^ Campbell, R. S. 1929. Vegetative succession in the Prosopis sand dunes of southern New Mexico. Ecology. 10(4): 392–398
  23. ^ Sexson, Mark L. 1983. Destruction of sandsage prairie in southwest Kansas. In: Proceedings, 7th North American prairie conference; 1980 August 4–6; Springfield, MO. Columbia, MO: University of Missouri: 113–115.
  24. ^ Price, M. V.; Brown, J. H. 1983. Patterns of morphology and resource use in North American desert rodent communities. Great Basin Naturalist Memoirs. 7: 117–134
  25. ^ a b c d e Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc.
  26. ^ Lechleitner, R. R. 1969. Wild mammals of Colorado. Boulder, CO: Pruett Publishing Company.
  27. ^ Smith, H. Duane; Jorgensen, Clive D. 1975. Reproductive biology of North American desert rodents. In: Prakash, I.; Ghosh, P. K., eds. Rodents in desert environments. Monographiae Biologicae Vol. 28. The Hague, Netherlands: Dr. W. Junk: 305-330
  28. ^ McCulloch, C. Y.; Inglis, J. M. 1961. Breeding periods of the ord kangaroo rat. Journal of Mammalogy. 42(3): 337–344
  29. ^ Brown, J. H.; Heske, E. J. (1990). "Control of a Desert-Grassland Transition by a Keystone Rodent Guild". Science 250 (4988): 1705. doi:10.1126/science.250.4988.1705. PMID 17734708. 
  30. ^ Hoditschek, Barbara; Best, Troy L. 1983. Reproductive biology of Ord's kangaroo rat (Dipodomys ordii) in Oklahoma. Journal of Mammalogy. 64(1): 121–127.
  31. ^ Alcoze, Thomas M.; Zimmerman, Earl G. 1973. Food habits and dietary overlap of two heteromyid rodents from the mesquite plains of Texas. Journal of Mammalogy. 54: 900–908
  32. ^ Longland, William S. 1995. Desert rodents in disturbed shrub communities and their effects on plant recruitment. In: Roundy, Bruce A.; McArthur, E. Durant; Halllley, Jennifer S.; Mann, David K., compilers. Proceedings: wildland shrub and arid land restoration symposium; 1993 October 19–21; Las Vegas, NV. Gen. Tech. Rep. INT-GTR-315. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 209–215
  33. ^ Mares, Michael A. 1983. Desert rodent adaptation and community structure. Great Basin Naturalist Memoirs. 7: 30–43
  34. ^ West, N. E. 1983. Western Intermountain sagebrush steppe. In: Temperate deserts and semi-deserts. Amsterdam; Oxford; New York: Elsevier Scientific Publishing Company. 352–374. (Goodall, David W., ed. in chief; Ecosystems of the world; vol. 5)
  35. ^ Ogden, Verland T.; Hornocker, Maurice G. 1977. Nesting density and success of prairie falcons in southwestern Idaho. Journal of Wildlife Management. 41(1): 1–11
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Does not include compactus, now recognized as a distinct species. See Robertson et al. (1992) for information on geographic variation on the Llano Estacado and adjacent areas of Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!