Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Like all members of the family Heteromyidae, Merriam's Kangaroo Rat is found only in the New World. Many kangaroo rats have rather specific habitat preferences, but Merriam's Kangaroo Rat is not one of these. It can inhabit arid regions where the ground is predominantly rocks, gravel, sand, or clay. Like other kangaroo rats (and kangaroo mice), it specializes in bipedal locomotion, which means that it usually moves around by hopping on two feet, like a chubby little kangaroo. The hindquarters of kangaroo rats and mice are strong and well developed to support this method of locomotion. Some kangaroo rats can leap 2 m (more than 6 feet) at a single bound."

Links:
Mammal Species of the World
  • Original description: Mearns, E.A., 1890.  Bulletin of the American Museum of Natural History, 2:290.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Geographic Range

Dipodomys merriami, Merriam's kangaroo rat, is a rodent found in the arid regions of the southwest United States and Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range Description

Upper and Lower Sonoran Life Zones of southwestern United States and northern Mexico, including parts of California, Arizona, Utah, Nevada, New Mexico, Texas, Baja California, Baja California Sur, Chihuahua, Durango, Coahuila, Nuevo Leon, Aguascalientes, San Luis Potosi, Tamaulipas, Sonora, Sinaloa, and the islands of Margarita and San Jose. Populations on these two islands were previously considered to be distinct species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Southwestern North America, from northwestern Nevada and northeastern California south through western Texas, southern Baja California, northern Sinaloa, and the Mexican Plateau to San Luis Potosi (Patton, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Merriam's kangaroo rats have an average total length of 247 mm. The tail is rather long, about 144 mm in length, with an end tassle. It is usually more than 130% of the the length of the head and body. (   http://www.nsrl.ttu.edu/tmot/dipomerr.htm ). The body is covered with dusky stripes which run the length of the head and body. The skull is sciuromorphous with dramatically inflated auditory bullae. The face is covered with dark facial markings. D. merriami also has fur lined external cheek pouches which it carries seeds in. The belly of Merriam's kangaroo rat bears white, silky pelage. The hind feet, bearing four toes, are very large, (39 mm), with hairy soles. These hairy soles aid the kangaroo rat in jumping through loose sand. The forelegs are retrogressed. The ears are small and hairless, and the eyes are large and luminous, similar to the eyes of other nocturnal mammals. The dental formula is 1/1, 0/0, 1/1, 3/3 = 20. ( Vaughn, 1999 ).

Range mass: 40 to 50 g.

Average basal metabolic rate: 0.246 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Size

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 247 mm
Range: 195-282 mm

Weight:
Range: 33.2-53.1 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Length: 26 cm

Weight: 47 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Dipodomys merriami are sand-dwelling mammals that inhabit arid regions of the southwestern United States and Mexico. Habitat requirements of Merriam's kangaroo rats are less strict than most other species of kangaroo rats. They can live equally well in sandy soils, clays, gravels, and among rocks. (www.nsrl.ttu.edu/tmot/dipomerr.htm ). Compared to other kangaroo rats, Dipodomys merriami inhabits harder, stonier soils.

Terrestrial Biomes: desert or dune

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Occurs in a broad range of habitats with a substrate of sandy soils, clays, gravel, or rocks. Vegetation is characterized by desert scrub, sagebrush, pinyon-juniper, and Joshua tree.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Low deserts, sparsely vegetated with sandy-rocky soils, grasslands and open chaparral, alkali sink, creosote bush scrub, and sagebrush scrub. Sleeps and gives birth in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the Merriam's kangaroo rat is almost entirely seeds. They feed primarily on the seeds of mesquite, creosote bush, ocotillo, purslane, and grama grass. One study of D. merriami showed that seeds make up 64% of the diet, with seeds of shrubs consituting 23%, forbs 24%, those of grasses 4.5%, and those of scculent plants 12%. (   http://www.nsrl.ttu.edu/tmot/dipoerr.htm ). The diet is diverse and varies seasonally. Insects are eaten occasionally. They are eaten in the greatest abundance in the winter months, while green vegetation is eaten most during the mid-summer months

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Feeds primarily on seeds but also eats some green vegetation and insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary, dispersed social system. Adults defend small core territories near burrow, overlap with neighbors in outlying areas of home range; female-female overlap slight (Jones 1989). Few survive more than 2 years. In one county in Texas, population density was estimated at 1 male/1.63 acres and 1 female/1.91 acres; average home range for males 6.89 acres, 4.26 acres for females (Schmidly 1977). Home range in Arizona was 1/3-1/2 acres; less than 1/2 acre in California. In southeastern Arizona, lifetime dispersal distance ranged from 0-265 m; nightly movements were up to about 150 m from home range center (Jones 1989).

With other kangaroo rats, affects vegetation structure and plant species diversity in the Chihuahuan Desert (Heske et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout the year. Nocturnal activity peaks at 9 p.m. and 4 a.m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.7 years (captivity) Observations: One wild born specimen was about 9.7 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Lifespan/Longevity

Range lifespan

Status: captivity:
9.7 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Dipodomys merriami has a high reproductive rate. Breeding for the Merriam's kangaroo rat begins in early February and continues into the spring, at least through May. The gestation period is approximately 28 to 32 days. Between one and six young are born in each litter, with an average of three. When young are born they weigh between 3 and 8 grams. The young are weaned after 15-25 days, and sexual maturity is reached between 60-84 days. They can live up to 9.8 years. Average territory size for males is 67,300 square feet, less than one acre. Average female territories are 4000 square feet. (Grzimek, 1990, www.desert.usa.com/aug96/du_krat.html )

Average birth mass: 2.92 g.

Average gestation period: 28 days.

Average number of offspring: 2.3.

Average age at sexual or reproductive maturity (female)

Sex: female:
102 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Breeds August-March. Pregnancy rate peaks in spring and fall, often coinciding with growth of new vegetation. Gestation lasts 17-23 days. Most births occur January-July in southeastern Arizona. Usually produces 2 young/litter. Weaned in just less than 3 weeks. Sexually mature in season of birth (Kenagy and Bartholomew 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dipodomys merriami

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2147-09|EU107495|Dipodomys merriami| AACCGTTGACTATTCTCAACAAACCACAAAGATATCGGAACTCTTTATATAATTTTTGGCGCTTGAGCTGGAATAGTAGGCACAGGACTA---AGCATCCTTATTCGAGCAGAACTCGGCCAGCCTGGCTCACTATTAGGAGAC---GATCAAATTTACAATGTGATTGTAACTGCCCATGCATTTGTAATAATTTTTTTTATAGTCATACCTATCATAATTGGCGGATTTGGAAACTGACTAGTTCCACTAATA---ATTGGTGCTCCCGATATAGCTTTCCCACGAATGAACAACATAAGCTTCTGACTCCTCCCACCCTCTTTTCTTCTCCTTCTCGCATCTTCTATAGTTGAATCTGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTAGCTGGAAATCTAGCCCACGCTGGAGCTTCTGTTGACCTA---ACAATCTTCTCCCTACACCTAGCAGGAGTTTCATCAATTCTTGGAGCAATCAACTTTATTACAACCATTATTAATATAAAACCCCCTGCAATATCTCAATACCAAACACCTCTATTCGTATGATCAGTTCTCATCACAGCCGTCCTCCTCCTTCTATCCTTACCAGTACTAGCTGCA---GGAATCACAATACTCTTAACAGATCGAAACCTAAATACAACTTTCTTTGATCCAGCAGGAGGAGGAGATCCAGTACTTTACCAACATCTATTTTGATTCTTCGGCCATCCAGAAGTTTACATCCTAATTCTCCCTGGATTTGGAATAATCTCACACATCGTAACATATTATTCTGGAAAAAAA---GAACCCTTTGGATATATAGGCATAGTTTGAGCCATAATATCTATCGGATTTCTTGGATTCATTGTATGAGCCCACCATATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dipodomys merriami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Species: 81
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

The subspecies Dipodomys merriami parvus (San Bernardino Merriam's kangaroo rat) is considered endangered under the U.S. Endangered Species Act. Several factors contribute to this, including predation and habitat reduction resulting from agricultural development, urbanization, and road-building. Flooding has also been a contributing factor. The only known method for conserving the kangaroo rat is through habitat preservation. The U.S. Fish and Wildlife Agency, together with the State of California and other wildlife agencies have purchased thousands of acres of habitat to try and protect these animals. This is a slow project because recovery plans are expensive (  http://www.hillsborough.k12.nj.us/hhs/endspeci/KANGARAT.HTM ).

San Bernardino Merriam's kangaroo rats (Dipodomys merriami parvus and Earthquake Valley kangaroo rats (Dipodomys merriami collinus), which both occur near the Los Angeles and San Diego urban areas, are considered data deficient by the IUCN.

Other subspecies of D. merriami are not considered threatened currently.

US Federal List: endangered; no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats known.

Habitat loss due to rapid expansion of coastal metropolitan areas in California threatens two subspecies (D. m. collinus and D. m. parvus) (Hafner et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.

Two subspecies do have conservation measures. D. m. parvis is a federal candidate taxon in the United States and a California Species of Special Concern, and D. m. collinus is also a federal candidate in the United States (Hafner et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

As seed predators they may affect plant populations, but they are rare in agricultural areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Economic Importance for Humans: Positive

Dipodomys merriami are important in dispersing seeds of plants in arid regions. Their burrowing and digging is thought to aerate and fertilize soil. (www.desert.usa.com/aug96/du_krat.html )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Wikipedia

Merriam's Kangaroo Rat

Merriam's Kangaroo Rat, Dipodomys merriami, is a species of rodent in the Heteromyidae family. The species name commemorates Clinton Hart Merriam.

Contents

Range

Dipodomys merriami is found in the Upper and Lower Sonoran life zones of the southwestern United States, Baja California, and northern Mexico. In San Diego County they are found in the low desert and the washes east of Laguna, Volcan, and Palomar Mountains.

Physical Description

Merriam's kangaroo rats, like other kangaroo rats and pocket mice, are members of the family Heteromyidae. Each species within this family has fur-lined food storage pouches. The cheek pouch is utilized as a portable cache for food while foraging. Kangaroo rats are named for their extremely long, kangaroo-like hind feet and they are almost completely bipedal. They hop or jump rather than scurry or run. Because of this, most heteromyid rodents also have a relatively long tail that acts to counterbalance the hopping/jumping form of locomotion.

Fur color varies between populations within the species' range, but the back color is generally light brown or tan. The merriami species is smaller than most of the other kangaroo rats in the southwest. Adults average about 14 inches in length. The tail is relatively long with a large tuft of hair at the tip. The tuft is thought to act like fletching on an arrow, providing drag to keep the animal stable during locomotion. merriami have four toes on each hind foot in contrast to the pacific kangaroo rat, Dipodomys simulans and the Stephens' kangaroo rat, Dipodomys stephensi (both kangaroo rat species also found in San Diego County), which have five toes.

Habitat

Merriam's kangaroo rat can be found in desert scrub, alkali scrub, sagebrush steppe, pinyon-juniper woodland, and Joshua tree habitat throughout the southwestern United States and Mexico.[2]

Behavior

Merriam's kangaroo rats live individually within a maze of underground burrows. Males and females each establish individual territories. They defend their territories against other male and female merriami, primarily to protect often scarce food resources. It is typical that they locate multiple entrances to their burrow complex at the base of shrubs near the middle of their territory. This allows more opportunities for them to escape from predators.

Most Kangaroo rats are exclusively nocturnal. Even so, they tend to avoid being outside their burrows when the moon is full. The greater the amounts of moonlight the less time they spend collecting food, defending their territory, or searching for mates. When the amount of moonlight is great they retreat underground in order to avoid predation. In some areas, above ground activity is limited to two hours or less[3]. During the day, they remain in their cool burrows. They often seal entranceways to their burrows with soil to prevent exposure to heat. When they are active above ground they move about within their territory and attempt to fill their cheek pouches with seeds and plant material. When their cheek pouches are full they retreat to their burrows where they disgorge the seeds they have collected. Some of the food is eaten immediately while the remainder is stored (often building a seed cache of considerable size) in several chambers within the burrow system.

Kangaroo rats lose water mainly by evaporation during gas exchange, and so have developed a behavioural adaptation to prevent this loss. As they spend a lot of time within their burrows to escape the heat of the day, the burrows become much more humid than the air outside (due to evaporative loss). When collecting seeds, they store them in the burrows rather than eating them straight away. This causes the moisture in the air to be absorbed by the seeds, and the kangaroo rat regains the water it has previously lost when it then consumes them.

Reproduction

Merriam's Kangaroo rats produce up to three litters per year, with an average of four pups in each litter. Weaning of young occurs 24-33 days after birth [4].

Diet

The diet of Merriam's Kangaroo rat is almost exclusively plant seeds (they are granivorous). The bulk of their diet consists of the seeds of desert and grassland plants. They rarely drink water. Rather, they obtain water through metabolic processes augmented by the moisture content of their food. (See Kangaroo Rat)

Predators

Kangaroo rats are a common prey items for many other desert animals. Typical predators of the Merriam's Kangaroo rat include barn owls, great horned owls, coyotes, foxes, badgers, bobcats, and several snake species including sidewinders and glossy snakes.

Conservation Status

In general humans have not caused adverse impact to the Merriam's kangaroo rat through most of its range. However, in southern California one subspecies, the San Bernardino Kangaroo Rat, Dipodomys merriami parvus, is at risk due primarily to urban development including construction of dams and alteration of hydrologic regimes throughout its range. Once common on alluvial plains in the washes of San Bernardino and Riverside counties, the United States Fish and Wildlife Service listed the San Bernardino kangaroo rat as endangered in 1998.

References

  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T. (2008). Dipodomys merriami. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 13 January 2009.
  2. ^ Zeiner, D. et al, 1990. California's Wildlife. Volume 3 (Mammals)
  3. ^ Zeiner, D. et al, 1990. California's Wildlife. Volume 3 (Mammals)
  4. ^ Chew, R.M., Butterworth. "1964 Ecology of rodents in Indian Cove (Mojave Desert), Joshua Tree National Monument, California." Journal of Mammalogy. 45: 203-235


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Includes insularis and margaritae, which, however, with other populations of merriami in the southern half of the Baja California Peninsula, may eventually be recognized as a distinct species (Patton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!