Overview

Brief Summary

Biology

European bison have an extremely similar social system to their American relatives, and are believed by some to represent the same species (7). Outside of the mating season the males form bachelor herds, whilst females are found in maternal groups of around 20 individuals and their young (2). These female groups occupy vast home ranges of up to 100 km2 and are led by a dominant cow (5). The 'rutting' season takes place between August and October and during this time males join up with the female herds and compete for access to receptive females (5). Once he has found an appropriate cow the bull will attempt to separate her from the remaining herd and particularly from the advances of other males in the group (3). He will attend to her in this way for around a day before mating (3). Aggressive clashes between rival males may occur at this time. Cows give birth after a gestation period of about 264 days, typically in May and July, usually leaving their herd to do so; young calves are able to run after only a few hours of being born and are fully weaned at around one year old (5). Bison feed predominantly on grasses although they will also browse on shoots and leaves; in summer months, an adult male can consume 32 kilograms of food in a day (5). Bison in the Bialowieza Forest in Poland have traditionally been fed hay in the winter for centuries, and vast herds may gather around this diet supplement (5). Bison need to drink every day and in winter can be seen breaking ice with their heavy hooves (2). Despite their usual slow movements, bison are surprisingly agile and can clear three metre wide streams from a standing start (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The European bison, or 'wisent', is similar in appearance to its North American relative (Bison bison) (3). Although smaller in size (3), they have the characteristic thickset body shape with a short neck and a pronounced shoulder hump (2). There is a longer mane of hair underneath the neck and also on the forehead (2). The dense coat is dark to golden brown in colour (2), but is less shaggy than that of the American bison (3). Both sexes bear short horns that project outwards and then curve up (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

European bison Bison bonasus is the largest herbivore in Europe. Historically it was distributed throughout western, central, and south-eastern Europe and the Caucasus. By the end of the 19th century, there were only two populations of European bison left in the wild: in Bia?owie?a Forest B. b. bonasus and in the western Caucasus mountains B. b. caucasicus. B. b. bonasus was finally driven Extinct in the Wild in 1919, and B. b. caucasicus had been extirpated by 1927. Subsequently, the species survived only in a few European zoological gardens (Sztolcman 1924). As a result of reintroductions and introductions, it now occurs in free-ranging and semi-free herds in Poland, Lithuania, Belarus, Russian Federation, Ukraine, and Slovakia. The introduced Kyrgyzstan subpopulation has recently gone extinct (EBPB 1996, Pucek et al. 2004). Captive populations are well distributed in 30 different countries worldwide (see Pucek et al. 2004 for details). It occurred from sea level to 2,100 m in the Caucasus (Pucek 1986), and in the Carpathians it is presently found at alitutudes of up to 800 m (K. Perzanowski pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bison bonasus, the European bison or wisent, has been restricted to mainland Europe throughout its history. (Anonymous, 1981; Sokolowski, 1983)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The European bison previously roamed throughout western, central and southeastern Europe but by the beginning of the 20th Century persisted only in two protected ancient forests in Poland and the former Soviet Union (4) (5). By 1927, the species had been lost from the wild entirely and only 54 individuals survived in European Zoos (5). Re-introductions to forests in Belarus, Poland, Russia, Lithuania and the Ukraine (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

European bison are smaller than their American counterparts, with adult females ranging from 300-540 kg and adult males from 400-920 kg. They have shorter hair in the neck region as well, which further contributes towards a smaller appearance. However, their pelage appears nearly the same color as their American relatives, and their horns are well-developed. Males and females are dimorphic not only in body size but in skull growth and allometry, as well as in some physiological parameters. Pictures of European bison are available in Sokolowski (1983). (Gill, 1990; Jedrzejewski et al., 1992; Kobrynczuk and Roskosz, 1980; Sokolowski, 1983)

Range mass: 300 to 920 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Optimal habitats for the European bison are deciduous and mixed forests, but the range should include about 20% of grassland habitats (meadows) (Pucek et al. 2004, K. Perzanowski pers. comm. 2006). In Bia?owie?a Forest (Poland) they primarily forage in moist deciduous forests, and then in mixed coniferous forests (Krasi?ska et al. 1987, Krasi?ski and Krasi?ska 1994). Forest complexes with a mosaic-like forest type arrangement (such as Bia?owie?a and Borecka Forests, Poland) are most favourable. In fresh deciduous forest, European bison find food throughout the vegetative season. In the Caucasus region, European bison prefer foothill forests; in summer, they feed on alpine meadows (Kazmin and Smirnov 1992, Kazmin et al. 1992). However, considerable plasticity of European bison with regard to food means they also forage in habitats where coniferous forests predominate (Krasi?ski et al. 1999). All European bison populations inhabit ranges that include open areas, such as, mown meadows, deforested feeding glades covered with grass, clear cuts and young plantations up to 10 years old (Dzi?cio?owski 1991, Krasi?ska and Krasi?ski 1994, Krasi?ski et al. 1999). The attraction of open areas results from the fact that exploited meadows and glades provide ungulates with much more food than the same area of the forest herb layer and food is more easily available there (Korochkina and Bunevich 1980, Kazmin et al. 1992). The species had an important role in the formation of the prehistoric European broad-leaf forest and forested steppe ecosystems (Pucek et al. 2004).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The natural habitat of European bison is temperate coniferous forest like Bialowieza. For feeding, they prefer areas of vegetation at least 20 years old. (Jedrzejewski et al., 1992; Krasinska et al., 1987; Okarma et al., 1995)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits mixed forests, with undergrowth and open spaces (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of B. bonasus varies seasonally. As discussed in sections below, bison aggregate into large groups during the winter, normally around areas where humans regularly place hay for them. Supplementing the diet of the bison this way may not be necessary for their survival, but has been done since the days when Bialowieza and its animals were protected by Polish or Lithuanian royalty, and continues as tradition. During the rest of the year, the bison are primarily grazers (accounting for 95% of feeding time), though they occasionally browse (3%) or eat bark (2%). The latter activity occurs mainly in early spring, when neither graze nor browse is available in large quantities. During the summer, when food is most plentiful, adult males may consume 32 kg of food per day, and adult females 23 kg per day. Borowski et al. (1967) present a list of specific food items utilized by B. bonasus in Bialowieza. Gebczynska et al. (1991) provide both an updated estimate of the number of plant species used by bison (110-140 species) and an analysis of seasonal variation in bison diets, based on rumen contents of culled animals. Their data are as follows: in spring (April-May), bison diet consists of: 8.8% trees; 0.1% bushes; 65.5% grasses and sedges; 1.5% herbaceous plants; and 24.1% mosses, pteridophytes, fungi, and unidentifiable food items. In summer (June-August), bison diet consists of: 9.8% trees; 1.4% bushes; 68.6% grasses and sedges; 1.7% herbaceous plants; and 18.5% mosses, pteridophytes, fungi, and unidentifiable food items. In autumn (September-October), bison diet consists of: 4.3% trees; 0.6% bushes; 69.9% grasses and sedges; 6.7% herbaceous plants; and 18.1% mosses, pteridophytes, fungi, and unidentifiable food items. In winter (November-March), bison diet consists of: 7.4% trees; 0.2% bushes; 72.4% grasses and sedges; 0.9% herbaceous plants; and 19.1% mosses, pteridophytes, fungi, and unidentifiable food items. Unlike certain other large ungulates, bison feeding tends not to greatly alter the habitat, except during winter aggregations of large groups and near popular watering places. (Borowski et al., 1967; Cabon-Raczynska et al., 1983; 1987; Gebczynska et al., 1991; Krasinska et al., 1987; Pucek, 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
27.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.4 years (captivity) Observations: These animals have been estimated to live up to 27 years in the wild (Bernhard Grzimek 1990), which may be overestimated. Record longevity in captivity is 26.4 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Rutting season for free European bison is from August to October. Seasonal variation in herd structure is closely tied to the reproductive cycle (see "Behavior" section below). Bulls move between female groups, looking for cows in estrous. When they find a cow, they will often "attend" her for at least a day before mating. Bulls stay near the cow, prevent her from rejoining her herd, and prevent other males from approaching her. Fights between bulls occur at this and occasionally serious injury results. After the bull mates with the cow, he shows no more interest in her. Both bulls and cows spend less time resting and feeding during the rutting season than during the rest of the year. Pregnancy lasts about nine months. Most calving occurs in May-July. Cows leave the herd to give birth. Calves are able to run only a few hours after being born. Lactation occurs for approximately one year, but may go into the second year if the cow does not have new young. Both males and females reach sexual maturity at 3-4 years of age. Cows usually calve for the first time at about this age; bulls may have to wait until they are somewhat older to mate successfully. Cows give birth every year or at most every other. They remain fertile into their early 20's. Bulls tend to remain fertile for the rest of their lives. Lifespan seems to be around 25 years.

(Cabon-Raczynska et al., 1987; Krasinska et al, 1987; Krasinski and Raczynski, 1967; Pucek, 1984)

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 8.53 to 9.43 months.

Average gestation period: 8.83 months.

Range weaning age: 7 to 12 months.

Average birth mass: 23375 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bison bonasus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2881-10|NC_014044|Bison bonasus| AACCGCTGACTATTCTCAACCAACCATAAAGATATCGGTACCCTTTACCTACTATTTGGTGCCTGGGCCGGTATAGTAGGAACAGCCCTA---AGCCTTCTAATTCGCGCTGAATTAGGTCAACCCGGAACTCTACTCGGAGAC---GACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATCATAATTGGAGGGTTCGGTAATTGACTTGTTCCCCTAATA---ATTGGTGCCCCCGATATGGCGTTTCCCCGAATAAATAATATAAGCTTTTGACTCCTTCCTCCCTCATTTCTATTACTCCTCGCATCCTCTATAGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTATACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTA---ACTATCTTCTCTTTACACTTAGCAGGGGTTTCCTCAATTTTAGGAGCCATCAACTTCATTACAACAATTATCAACATAAAGCCCCCCGCAATGTCACAATACCAAACCCCTCTATTCGTATGATCTGTAATAATTACCGCTGTACTATTACTCCTCTCACTCCCTGTGCTAGCAGCC---GGCATCACGATGTTGCTAACGGACCGGAACCTAAACACAACTTTCTTCGACCCGGCAGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTCTTTGGGCATCCTGAAGTCTATATTTTAATTTTACCTGGATTTGGAATAATCTCCCATATTGTAACCTACTACTCAGGAAAAAAG---GAACCATTCGGATATATAGGAATAGTTTGGGCTATAATGTCAATCGGATTTTTAGGCTTCATCGTATGAGCTCACCATATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bison bonasus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D1

Version
3.1

Year Assessed
2008

Assessor/s
Olech, W. (IUCN SSC Bison Specialist Group)

Reviewer/s
Perzanowski, K., Krasinski, Z.A., Krasinska, M., Pucek, Z. (Bison Red List Authority), Temple, H. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
The global population of free-living animals was ca. 1,800 in 2006. However, because some of these have not reached breeding age, and because polygyny reduces the effective population size, the total number of 'mature individuals' may be less than 1,000. Although the population declined between the early 1990s and 2000, the current population trend is increasing. Consequently the species qualifies as Vulnerable under criterion D1.

Assessments for the two breeding lines are also included here:

Bison bonasus (Lowland line): Vulnerable D1
In 2000, the total population was 931, not all of these are mature individuals. Although the population declined between the early 1990s and 2000, it is currently increasing.

Bison bonasus (Lowland-Caucasian line): Endangered C1+2a(i)
In 2000, the total population was 714, not all of these are mature individuals. The population decreased by >20% between 1990 and 2000, and has continued to decline since 2000. All subpopulations have fewqer than 250 individuals.

"The fate of the European Bison provides an example of the way in which a species may be brought to the brink of extinction in a very short time, and then saved only through great efforts. The saving of the bison has been an undoubted success, but further action to protect what remains a creature of relict distribution will continue to be essential" (Krasi?ski 2005).

History
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Conservation of the European bison, especially in Poland, has a long history. From the 15th to the 18th centuries, Bialowieza was a royal hunting forest and its game were fed in winter and protected. In the 19th century, under Russian control, the animals of the forest were exploited and their numbers were reduced (a few species even went extinct). World War I was extremely unkind to the bison, with many killed by troops and poachers. Early in this century, the last European bison in the wild was killed by a poacher. Almost immediately, a captive breeding program was instituted with zoo animals. These animals surprisingly survived World War II virtually unharmed, and the 1950's the first animals were released. The herd began to grow, and soon individuals were transported to other areas in order to keep any infectious disease from wiping out the entire population. Because natural mortality of these animals is so low, culling has become necessary. Pucek (1984) has pointed out that herd management is now more important than further increasing bison numbers. The most recent estimate available for the world population of B. bonasus was 3200 individuals (as of 1994). All of these animals are descended from 12 individuals. As might be expected, European bison are quite inbred. It has been shown that increasing the amount of inbreeding in these animals decreases their lifespan, increases juvenile mortality, and increases intercalf intervals. However, it does not seem to significantly affect age at first calving or the number of calves a cow is expected to give birth to during her lifetime. Related to the issue of inbreeding is the issue of genetic variability. An earlier study (Gebczynski and Tomaszewska-Guszkiewicz, 1987) demonstrated that variability in Bison bonasus was approximately the same as that in B. bison, even though the latter has not experienced a bottleneck of nearly the severity of that experienced by the former. A more recent study (Hartl and Pucek, 1994), utilizing a larger sample size and somewhat different methods, has concluded that genetic variability in B. bonasus was reduced by the bottleneck and that the "average heterozygosity" measure used by Gebczynski and Tomaszewska-Guszkiewicz (1987) is not sufficient to document genetic variability in populations that have experienced such a severe bottleneck.

European bison populations now exist on the British Isles as well as in North America and Asia. There are currently 200 European bison breeding centers found in 27 countries worldwide. However, as mentioned above, B. bonasus is only found in its native habitat in a few places. Poland in particular has four reserves containing bison, the largest of which is the Bialowieza Forest on the border with Russia. Virtually all of the work on the behavior and ecology of B. bonasus summarized in this species account was done in Bialowieza.

((Anonymous, 1981; Gebczynski and Tomaszewska-Guszkiewicz, 1987; Hartl and Pucek, 1994; Jedrzejewski et al., 1992; Krasinska et al., 1987; Okarma et al., 1995; Olech, 1987; Pucek, 1984; Sokolowski, 1983)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In historical times, the European bison was widespread and presumably abundant in its native range. However, by the end of the 19th century it was close to extinction, with only two wild populations remaining (Pucek et al. 2004). Shortly after World War I the species was Extinct in the Wild, and the captive population consisted of just 54 (29 males; 25 females) European bison with proved pedigrees (Raczy?ski 1978, Pucek 1991), originating from 12 founder animals (Slatis 1960). The captive population subsequently increased slowly until World War II, when the species again suffered a steep decline, with the population dropping from 160 animals in 1943 to 93 in 1946 (Pucek et al. 2004).

As a result of captive breeding, reintroductions, benign introductions, and intensive conservation management, the total population of free-ranging bison now stands at c. 1,800. A further c. 1,400 individuals live in captivity (EBPB 2004). Some captive animals are not recorded in the European Bison Pedigree Book, so this is likely to be an underestimate (Pucek et al. 2004). Population structure is such that approximately 60% of individuals are sexually mature (Krasi?ski 1978, Krasi?ska and Krasi?ski 2004). The effective population size is smaller than the total population size, because European bison are a polygynous species, so not all males have the opportunity to breed (Krasi?ski and Raczy?ski 1967, Krasinska and Krasi?ski 1995, Krasi?ska and Krasi?ski 2004). The free-living population increased more or less steadily from the mid-1960s to a peak of c. 2000 in the early 1990s (Pucek et al. 2004). Following a period of decline in the mid to late 1990s, the population is once again expanding (W. Olech pers. comm. 2006), although the potential for ongoing growth is limited by a number of factors (Pucek et al. 2004). Two genetic lines are distinguished in recent populations: the Lowland line (B. b. bonasus) and the Lowland-Caucasian line (B. b. bonasus and B. b. caucasicus). There are no surviving pure-bred populations of B. b. caucasicus (Pucek et al. 2004).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Habitat degradation and fragmentation due to agricultural activity, forest logging, and unlimited hunting and poaching were the primary reasons for the decrease and extinction of European bison populations. Pucek (1991, 1994) has summarized the history of their extinction. Among the primary reasons for the rapid decrease of the European bison population in Bia?owie?a Primeval Forest at the beginning of 19th century was the over-population of deer species, and the drastic reduction of natural food resources for herbivores which followed (Wróblewski 1927). During the period of World War I and the Russian Revolution of 1917, conflict and heavy poaching exacted a severe toll on remaining populations (Pucek et al. 2004).

Conflict and political instability continues to be a threat to the species in the Caucasus, where reintroduced free-living herds have suffered very severe losses (leading to extinctions) in recent years (Pucek et al. 2004). Other current threats include lack of appropriate habitat, fragmentation of populations (and concomitant loss of genetic diversity), inbreeding depression, disease, hybridisation, and poaching. There is little space for a large herbivore such as the European bison in Europe?s contemporary ecosystems, especially in the west. The most significant limit for the enlargement of European bison populations is human population density; forestry and agricultural activity is not a limiting factor. Fragmentation and isolation of free-ranging (and captive) herds result in little or no exchange of genetic material. Small isolated populations quickly lose their genetic heterogeneity and are more vulnerable to extinction (Franklin 1980). As yet, the opportunity to reconstruct a more compact geographic range to facilitate migration of bison between herds does not exist. As a consequence of passing a dramatic bottleneck (the current population descends from just 12 founder animals), the gene pool is limited and animals are highly inbred. The average inbreeding coefficient is very high compared to other large mammals, and is equal to 44% in the Lowland line and 26% in the Lowland-Caucasian line for individuals with a full pedigree (Olech 1998). The negative effects of inbreeding, manifested in the decline in reproduction rate, are more strongly pronounced in the Lowland-Caucasian line than in the Lowland line (Olech 1987, 1989, 1998). Inbreeding exerts a harmful effect on skeleton growth, particularly in females (Kobry?czuk 1985), and possibly lowers the resistance of bison to disease and pathologies.

Diseases appearing in European bison populations can bring serious threats to the whole species. It is not certain whether the species has always shown a weak resistance to disease or if immunity has declined, due to limited genetic heterogeneity. The most important disease affects the male reproductive organs and is manifested in the inflammation of the penis and prepuce, leading to diphtheroid-necrotic lesions, diagnosed as balanoposthitis. This disease was discovered at the beginning of the 1980s in Bia?owie?a Forest (Kita et al. 1995, Piusi?ski et al. 1997, Jakob et al. 2000); although similar symptoms had been reported earlier (Korochkina and Kochko 1982) in Russia and Ukraine (Krasochko et al. 1997). Despite many years of study, its pathogenesis has not yet been elucidated. Other diseases that are potentially major threats to herds include foot-and-mouth disease Aphte epizooticae (to which the species is known to be sensitive) (Podgurniak 1967), and tuberculosis (?órawski and Lipiec 1997, Welz et al. 2005).

A particular problem concerning the management of extant populations of European bison is the existence of hybrid herds, especially European × American bison hybrids living in the Caucasus. Two free-living hybrid herds have been established in the Caucasus Mountains, in close proximity to reintroduced free-living herds of the pure blood Lowland-Caucasian line. There are fears that all these animals will crossbreed, creating a mixture of various genotypes. According to Russian authors, the distances between herds are not so great, but the configuration of mountain ridges and valleys make it impossible for contact between them. There are also two small semi-free herds of European and American bison hybrids in Toksove Forest Park (St Petersburg) and the Mordovia Wildlife Reserve (Pucek et al. 2004). Finally, poaching as a result of administrative disorders and a failure to enforce nature conservancy law threatens free-living herds of European bison in many countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

With the advance of agriculture, vast tracts of the European bison's habitat were lost and their range became massively restricted (5). These animals were also persecuted by hunting and in 1927 the species finally became Extinct in the Wild (5). Re-introductions of the bison to some of its former range have proved extremely successful and, due to the natural low mortality of the species, it has even been necessary to cull some populations in order to manage them effectively (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix III (protected fauna species) of the Bern Convention, and on Annexes II* and IV of the EU Habitats and Species Directive. The European Bison Pedigree Book has been developed, which registers and publishes lists of European bison, enabling the genetic purity of the species to be maintained. A Conservation Action Plan for the species has been published (Pucek et al. 2004), and most countries in which the species occurs have national management plans. The European Endangered Species Programme (EEP) for zoos was established by the European Association of Zoos and Aquaria (EAZA) in 1996, and now a third of the captive population is participating in this programme.

Conservation measures recommended in the 2004 Action Plan (Pucek et al. 2004) include the following:
1. Continue captive breeding, following a coordinated programme that focuses on maintaining genetic variability. Hybridisation between existing breeding lines (Lowland and Lowland-Caucasian) should be avoided, as should hybridization between European bison and American bison Bison bison.
2. Establish a Gene Resource Bank (semen collection in the first phase) to serve as a safeguard against loss of important genetic diversity.
3. Continue reintroductions and benign introductions, into forests and other ecosystems (including large tracts of land where human activities are abandoned, such as former farmland or military training grounds). A target of 3,000 free ranging animals of each genetic line is recommended as a management goal. It will be necessary to link isolated subpopulations (e.g., by creating habitat corridors) and restore metapopulation function to enable the population to be self-sustaining in the long term.
4. Regulate bison populations by culling, when necessary, to prevent populations exceeding the carrying capacity of remaining habitat.
5. Manage habitat appropriately, for example by creating watering places, and cultivated meadows or feeding glades for use by other ungulates.
6. Implement and enforce stricter regulations to control poaching.
7. Continue producing the European Bison Pedigree Book, and expand its scope.
8. Establish an International Bison Breeding Centre, to coordinate reintroductions, monitoring of captive and free-ranging herds, and genetic management of particular herds.
9. To promote protection of the species, upgrade it to Appendix II (strictly protected fauna species) of the Bern Convention.

Further details, as well as recommended research activities, can be found in Pucek et al. 2004.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The protection of the European bison has a long history; between the 15th and 18th Century those in the Tzar's Royal Hunting Forest of Bialowieza were protected and their diet supplemented (3). Efforts to restore this species to the wild began in 1948 with the establishment of the Bison Breeding Centre within the Prioksko-Terrasny Biosphere Reserve (8). Re-introductions of captive-bred individuals to this area began in the 1950s and the herds have grown successfully (3); re-introductions to date have occurred in Belarus, Poland, Russia and the Ukraine (5). The aim of the Bison Specialist Group of the World Conservation Union (IUCN) is to establish a total free-ranging population of around 6,000 animals from two different lineages (4). The re-introduction of the European bison represents a remarkable conservation success story.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because this species is so restricted in habitat, it does not seem to have any negative economic effects on humans. In addition, European bison are usually not aggressive. They ordinarily flee from humans, and in the winter (perhaps because they associate humans with their food source) they permit observation. However, cows with calves and bulls during the rutting season may be dangerous, and attacks have occurred. (Cabon-Raczynska et al., 1983; 1987)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

European bison may provide an economic benefit in that a portion of Bialowieza Forest is set aside for tourists. In addition, European bison may mate with domestic cows. Male hybrids are sterile, but backcrossing may be used to produce fertile males. These animals may be raised for meat. (Korwin-Kossakowski and Saminski, 1984; Sokolowski, 1983)

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European bison

The European bison (Bison bonasus), also known as wisent (play /ˈvzənt/ or /ˈwzənt/) or the European wood bison, is a Eurasian species of bison. It is the heaviest surviving wild land animal in Europe; a typical European bison is about 2.1 to 3.1 m (7 to 10 ft) long, not counting a tail of 30 to 60 cm (12 to 24 in) long, and 1.6 to 2 m (5 to 7 ft) tall. Weight typically can range from 300 to 920 kg (660 to 2,000 lb), with an occasional big bull to 1,000 kg (2,200 lb) or more.[2][3] It averages slightly lighter in weight than the American Bison (Bison bison), and has shorter hair on the neck, head and forequarters, but longer tail and horns.

European bison were hunted to extinction in the wild, with the last wild animals being shot in the Białowieża Forest in Eastern Poland in 1919 and in the Western Caucasus in 1927, but have since been reintroduced from captivity into several countries in Europe, all descendants of the Białowieża or lowland European bison. They are now forest-dwelling. They have few predators (besides humans), with only scattered reports from the 19th century of wolf and bear predation. European bison were first scientifically described by Carolus Linnaeus in 1758. Some later descriptions treat the European bison as conspecific with the American bison. It is not to be confused with the aurochs, the extinct ancestor of domestic cattle.

In 1996 the IUCN classified the European bison as an endangered species. It has since been downgraded to a vulnerable species. In the past it was commonly killed to produce hides and drinking horns, especially during the Middle Ages.

Contents

Etymology

The modern English word "wisent" is borrowed from modern German Wisent (German pronunciation: [ˈviːzɛnt]), which comes from Germanic *wisund (cf. Old Norse visundr, Old High German wisunt); the Old English word wesend from this root became extinct in premodern times.[4][5]

The English word "bison" is borrowed Latin but derives from the same Germanic word. The name "bison" started to be used in English in the late Middle Ages, and "wisent" in the 19th century. [6].

History

Magdalenian bison in the great hall of policromes of the Cave of Altamira, Cantabria. 18,500–14,000 BC.
Magdalenian bison on plaque, 17,000–9,000 BC, Bédeilhac grottoe, Ariège.
Historic range (green) and relict populations in the early 20th century (red)
European bison's skeleton

Historically, the lowland European bison's range encompassed all lowlands of Europe, extending from the Massif Central to the Volga River and the Caucasus. It may have once lived in the Asiatic part of what is now the Russian Federation. Its range decreased as human populations expanded cutting down forests. The first population to be extirpated was that of Gaul in the 8th century AD. The European bison became extinct in northern Sweden in the 11th century, and southern England in the 12th. The species survived in the Ardennes and the Vosges until the 15th century.[7]

European bison survived in a few natural forests in Europe but its numbers dwindled. The last European bison in Transylvania died in 1790. In Poland, European bison in the Białowieża Forest were legally the property of the Polish kings until the Third partition of Poland. Wild European bison herds also existed in the forest until the mid-17th century. Polish kings took measures to protect the bison. King Sigismund II Augustus instituted the death penalty for poaching a European bison in Bialowieza in the mid-16th century. In the early 19th century, Russian czars retained old Polish laws protecting the European bison herd in Bialowieza. Despite these measures and others, the European bison population continued to decline over the following century, with only Bialowieza and Northern Caucasus populations surviving into the 20th century.

During World War I, occupying German troops killed 600 of the European bison in the Białowieża Forest for sport, meat, hides, and horns. A German scientist informed army officers that the European bison were facing imminent extinction, but at the very end of the war, retreating German soldiers shot all but 9 animals.[8] The last wild European bison in Poland was killed in 1919, and the last wild European bison in the world was killed by poachers in 1927 in the western Caucasus. By that year fewer than 50 remained, all in zoos.

To help manage this captive population, Dr. Heinz Heck commenced the first studbook for a non-domestic species, initially as a card index in 1923 leading to a full publication in 1932.[9]

Differences from American bison

Although superficially similar, there are a number of physical and behavioral differences between the European bison and the American bison. The European bison has 14 pairs of ribs, while the American Bison has 15.[10][dubious ] Adult European bison are taller than American bison, and have longer legs.[11] European bison tend to browse more, and graze less than their American cousins, due to their necks being set differently. Compared to the American bison, the nose of the European bison is set further forward than the forehead when the neck is in a neutral position. The body of the European bison is less hairy, though its tail is hairier than that of the American species. The horns of the European bison point forward through the plane of their faces, making them more adept at fighting through the interlocking of horns in the same manner as domestic cattle, unlike the American bison, which favours charging.[12] European bison are less tameable than their American cousins, and breed with domestic cattle less readily.[13]

Behaviour and biology

Social structure and territorial behaviours

The European bison is a herd animal, which lives in both mixed and solely-male groups. Mixed groups consist of infants, young aged 2–3 years, calves and young adult bulls. The average herd size is dependent on environmental factors, though on average, they number 8-13 animals per herd. Herds consisting solely of bulls are smaller than mixed ones, containing two individuals on average. European bison herds are not family units. Different herds frequently interact, combine and quickly split after exchanging individuals.[7]

Territory held by bulls is correlated by age, with young bulls aged between 5–6 tending to form larger home ranges than older males. The European bison does not defend territory, and herd ranges tend to greatly overlap. Core areas of territory are usually sited near meadows and water sources.[7]

Reproduction

The rutting season occurs from August through to October. Bulls aged 4–6 years, though sexually mature, are prevented from mating by older bulls. Cows usually have a gestation period of 264 days, and typically give birth to one calf at a time.[7]

On average, male calves weigh 27.6 kg (60.8 lb) at birth, and females 24.4 kg (53.8 lb). Body size in males increases proportionately to the age of 6 years. While females have a higher increase in body mass in their first year, their growth rate is comparatively slower than that of males by the age of 3–5. Bulls reach sexual maturity at the age of two, while cows do so in their third year.[7]

Diet

European bison feed predominantly on grasses although they will also browse on shoots and leaves; in summer months, an adult male can consume 32 kilograms of food in a day.[14] European bison in the Bialowieza Forest in Poland have traditionally been fed hay in the winter for centuries, and vast herds may gather around this diet supplement.[14] European bison need to drink every day and in winter can be seen breaking ice with their heavy hooves.[15] Despite their usual slow movements, European bison are surprisingly agile and can clear three metre wide streams or two metre high fences from a standing start.[15][16]

Conservation

A European bison at Skansen, a herd established in the 1890s.

The protection of the European bison has a long history; between the 15th and 18th century those in the Forest of Białowieża were protected and their diet supplemented.[17] Efforts to restore this species to the wild began in 1929, with the establishment of the Bison Restitution Centre at Białowieża, Poland.[18][19] Subsequently, in 1948, the Bison Breeding Centre was established within the Prioksko-Terrasny Biosphere Reserve. On April 24, 2011 five bison were introduced in Pleistocene Park a project of recreating the steppe ecosystem altered 10,000 years ago

Reintroduction

European bison were reintroduced successfully into the wild, beginning in 1951. Białowieża Forest in Poland and Belarus is home to 800 wild individuals.[20] They are also found in forest preserves in the Western Caucasus.

Free-ranging herds are found in Poland, Lithuania, Belarus, Ukraine, Romania, Russia, Slovakia, Latvia, Kyrgyzstan, Moldova (since 2005),[21] and in Spain (since 2010).[22] There are plans to re-introduce two herds in Germany [23] and in Oostvaardersplassen Nature Reserve in Flevoland (Netherlands). Zoos in 30 countries also have quite a few animals. There were 3,000 individuals (as of 2000), all descended from only 12 individuals. Because of their limited genetic pool, they are considered highly vulnerable to illnesses like foot and mouth disease.

Miscellanea

A male European bison in Minsk Zoo.

European bison have lived as long as 30[24] years in captivity, although in the wild their lifespan is shorter. Productive breeding years are between four and 20 years of age in females, and only between six and 12 years of age in males. Wisent occupy home ranges of as much as 100 km2 (40 sq mi) and some herds are found to prefer meadows and open areas in forests.

European bison can cross-breed with American bison. The products of a German interbreeding program were destroyed after World War II. This programme was related to the impulse which created the Heck cattle. The cross-bred individuals created at other zoos were eliminated from breed books by the 1950s. A Russian back-breeding program resulted in a wild herd of hybrid animals, which presently lives in the Caucasian Biosphere Reserve (550 individuals in 1999).

There are also wisent-cattle hybrids, similar to beefalo in North America. Cattle and European bison can hybridise fairly readily, but the calves cannot be born naturally (birth is not triggered correctly by the first-cross hybrid calf, and they must therefore be delivered by Caesarian section). In 1847, a herd of wisent-cattle hybrids named żubroń was created by Leopold Walicki. The animals were intended to become durable and cheap alternatives to cattle. The experiment was continued by researchers from the Polish Academy of Sciences until the late 1980s. Although the program resulted in a quite successful animal that was both hardy and could be bred in marginal grazing lands, it was eventually discontinued. Currently the only surviving żubroń herd consists of just a few animals in Białowieża Forest, Poland.

Fighting European bison on 10 k. postage stamp of USSR 1969. Part of commemorative Nature Reserve Belavezhskaya Pushcha series.
European bison on postage stamp of Belarus 2008. Eleventh Definitive issue.

The modern herds are managed as two separate lines – one consisting of only Bison bonasus bonasus (all descended from only seven animals) and one consisting of all 12 ancestors including the one Bison bonasus caucasicus bull. Only a limited amount of inbreeding depression from the population bottleneck has been found, having a small effect on skeletal growth in cows and a small rise in calf mortality. Genetic variability continues to shrink. From five initial bulls, all current European bison bulls have one of only two remaining Y-chromosomes.

See also

References

This article incorporates text from the ARKive fact-file "European bison" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ Olech, W. (IUCN SSC Bison Specialist Group) (2008). Bison bonasus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
  2. ^ [http://www.torontozoo.com/ExploretheZoo/AnimalDetails.asp?pg=645 (2011).
  3. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  4. ^ "bison, n.". OED Online. June 2011. Oxford University Press.
  5. ^ "wisent, n.". OED Online. June 2011. Oxford University Press.
  6. ^ "bison, n.". OED Online. June 2011. Oxford University Press.
  7. ^ a b c d e European Bison (Bison Bonasus): Current State of the Species and Strategy for Its Conservation By Zdzsław Pucek, Published by Council of Europe, 2004, ISBN 92-871-5549-6, 978-92-871-5549-8
  8. ^ Lake Pape – Bison from the WWF
  9. ^ Tudge, Colin (1992). Last Animals at the Zoo. Washington, D.C.: Island Press. ISBN 1-55963-158-9. 
  10. ^ The Penny Cyclopædia of the Society for the Diffusion of Useful Knowledge by Society for the Diffusion of Useful Knowledge (Great Britain), published by C. Knight, 1835
  11. ^ Trophy Bowhunting: Plan the Hunt of a Lifetime and Bag One for the Record Books, by Rick Sapp, Edition: illustrated, published by Stackpole Books, 2006, ISBN 0-8117-3315-7, 978-0-8117-3315-1
  12. ^ American Bison: A Natural History, By Dale F. Lott, Harry W. Greene, ebrary, Inc, Contributor Harry W. Greene, Edition: illustrated, Published by University of California Press, 2003 ISBN 0-520-24062-6, 978-0-520-24062-9
  13. ^ Zoologist: A Monthly Journal of Natural History, By Edward Newman, James Edmund Harting, Published by J. Van Voorst, 1859
  14. ^ a b European Bison Status Survey and Conservation Action Plan. Gland, Switzerland and Cambridge, UK.: IUCN/SSC Bison Specialist Group. 2004. 
  15. ^ a b Brent Huffman. "Ultimate Ungulate". http://www.ultimateungulate.com/Artiodactyla/Bison_bonasus.html. 
  16. ^ Olech, W. (2011). Pers. comm. 
  17. ^ Trapani, J.. "Bison bonasus". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Bison_bonasus.html. 
  18. ^ Krasińska, M. and Krasiński, Z. (2007). European bison - the nature monograph. Białowieża, Poland.: Mammal Research Institute. 
  19. ^ Macdonald, D. (2001). The New Encyclopedia of Mammals. Oxford: Oxford University Press. 
  20. ^ Baczynska, Gabriela (2008-09-28). "FEATURE-Climate change clouds fate of ancient Polish woods". Reuters. http://www.reuters.com/article/latestCrisis/idUSLN291035. Retrieved 2008-09-28. 
  21. ^ Bison in the Republic of Moldova
  22. ^ "El bisonte europeo se reimplanta en España". Univision.com. 2010-06-05. http://www.univision.com/contentroot/wirefeeds/world/8226775.shtml. Retrieved 2011-01-16. 
  23. ^ European bison reintroduction in the Rothaargebirge
  24. ^ Medeiros, Luísa (2009-09-03). "Female European bison in Brasília Zoo may be the species oldest". Correioweb. http://www.correiobraziliense.com.br/app/noticia182/2009/09/03/cidades,i=139677/EXEMPLAR+DE+BISAO+FEMEA+QUE+VIVE+NO+ZOOLOGICO+DE+BRASILIA+PODE+SER+O+MAIS+VELHO+DA+ESPECIE.shtml. Retrieved 2009-09-03. (in Portuguese)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!