Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"The American Bison's recovery from near extinction parallels what happened to the European Bison, Bison bonasus. Once abundant and widespread in northern latitudes, their decline in several countries since the 6th century has been documented. The last wild populations in Poland and the Caucasus Mountains became extinct early in the 20th century. They now exist as managed, reintroduced populations in Poland, Russia, and the Caucasus. In North America, the wild population once numbered in the tens of millions. The herds were gradually being reduced by hunting pressures before the Civil War, and after the war, with westward expansion, American Bison were pushed almost to extinction. In the 1880s, when only 541 animals were counted, conservation efforts began in earnest. Now there are more than 150,000 animals, 90 percent of which live on private lands. Bison graze on prairie grasses, roaming in herds of thousands of individuals. They, Brown Bears, and Moose are the largest land mammals in North America."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition,  Laurentii Salvii, Stockholm, 1:72, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Bison are large, vegetarian mammals. Bulls can weigh near 1,800 pounds and females average about 1,000 pounds.

Bison breed from mid-July to mid-August. Calves are born singly in the spring. They are strict vegetarians, grazing on grasses and sedges as they move between meadows, foothills, and high-elevation plateaus.

Once distributed across the Great Plains, wild bison are now limited to pockets. There has been a wild population in Yellowstone National Park in the United States since prehistoric times.

Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bison are large, vegetarian mammals. Bulls can weigh near 1,800 pounds and females average about 1,000 pounds.

Bison breed from mid-July to mid-August. Calves are born singly in the spring. They are strict vegetarians, grazing on grasses and sedges as they move between meadows, foothills, and high-elevation plateaus.

Once distributed across the Great Plains, wild bison are now limited to pockets. There has been a wild population in Yellowstone National Park in the United States since prehistoric times.

Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

At one time, bison were widespread from Alaska to northern Mexico (Meagher, 1986). Wholesale slaughter of bison herds caused the extermination of wild bison from the major part of their former range until recently. Bison are now found on private and protected lands in areas of the western United States and Canada (National Bison Association, 2002). Most prominent of those herds are those of Yellowstone National Park in Wyoming and Wood Buffalo Park, Northwest Territory, Canada (Honacki, 1982).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Original North American range extended from northern Mexico to Alaska. Plains bison occurred from Northern Mexico to central Alberta. Wood bison occurred from central Alberta to Alaska. Current range is restricted by land use and wildlife management policies in the southern area and by wildlife and reportable disease management policies in the north. Bison in conservation herds currently occupy less than 1% of their original range (Sanderson et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Formerly widespread in North America from Alaska and western Canada across U.S. into northern Mexico. Currently found in isolated units throughout and external to historical range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historically, American bison were widespread in North America from Alaska and
western California across the United States and into northern New Mexico
[11,53,66].  Today, American bison occur in geographically isolated populations
in parks and preserves (See ADMINISTRATIVE UNITS), other public lands,
and on private ranches.  The only large herds of American bison in North America
are in Yellowstone National Park, Montana and Wyoming, Wood Buffalo
National Park, Alberta, and Mackenzie Bison Sanctuary and the Slave
River Lowlands, Northwest Territories [11,27,53].  Smaller herds occur
in Alaska; northeastern British Columbia; near Nahanni Butte, Northwest
Territories; northwestern Saskatchewan; Elk Island National Park,
Alberta; Grand Teton National Park, Wyoming; National Bison Range and
Crow Reservation, Montana; Wind Caves National Park, South Dakota;
Wichita Mountains Wildlife Refuge and the Tallgrass Prairie Preserve,
Oklahoma; Theodore Roosevelt National Park, North Dakota; Henry
Mountains, southern Utah; northeastern Colorado; Nebraska; and Kansas
[11,35,51,53,83,84,91,93,96].
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 27.  Finch, Deborah M. 1992. Threatened, endangered, and vulnerable species        of terrestrial vertebrates in the Rocky Mountain Region. Gen. Tech. Rep.        RM-215. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station. 38 p.        [18440]
  • 35.  Halloran, Arthur F.; Glass, Bryan P. 1959. The carnivores and ungulates        of the Wichita Mountains Wildlife Refuge, Oklahoma. Journal of        Mammalogy. 40(3): 360-370.  [24597]
  • 51.  McHugh, Tom. 1958. Social behavior of the American buffalo (Bison        bison). Zoologica. 43(1): 1-40.  [3981]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 66.  Reynolds, H. W.; Gates, C. C. 1991. Managing wood bison: a once        endangered species. In: Renecker, Lyle A.; Hudson, Robert J., eds.        Wildlife production: conservation and sustainable development. Misc.        Publ. 91-6. Fairbanks, AK: Alaska University, Agricultural and Forestry        Experiment Station: 363-371.  [24522]
  • 83.  Van Gelden, Richard George. 1982. Mammals of the National Parks.        Baltimore, MD: Johns Hopkins University Press. 310 p.  [20893]
  • 84.  Van Vuren, Dirk. 1984. Summer diets of bison and cattle in southern        Utah. Journal of Range Management. 37(3): 260-261.  [24531]
  • 91.  Zarn, Mark. 1977. Ecological characteristics of pinyon-juniper woodlands        on the Colorado Plateau: A literature survey. Tech. Note T/N 310.        Denver, CO: U.S. Department of the Interior, Bureau of Land Management,        Denver Service Center. 183 p.  [2689]
  • 93.  Pfeiffer, Kent E.; Hartnett, David C. 1995. Bison selectivity and        grazing response of little bluestem in tallgrass prairie. Journal of        Range Management. 48(1): 26-31.  [24533]
  • 96.  Pfeiffer, Kent E.; Steuter, Allen A. 1994. Preliminary response of        Sandhills prairie to fire and bison grazing. Journal of Range        Management. 47(5): 395-397.  [23954]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AK CO KS MT NE ND OK SD UT WY AB BC NT SK YT

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bison are huge animals, ranging in length from 3.6 m to 3.8 m in males to 2.13 m to 3.18 m in females. They are also tall animals, with the height at the shoulder ranging from 1.67 m to 1.86 m for males and 1.52 m to 1.57 m in females. Two distinctive features of bison are the shoulder hump and their huge head. Fur color is brown, varying slightly from the front and back of the animal. The hair is longer in the front than in the rear. The distinction between hair length is most noticeable in males. The horns are black, curving upward and inward and ending in a sharp tip. The hooves are black and circular in shape (Meagher, 1986).

Range mass: 318 to 900 kg.

Range length: 2.1 to 3.8 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 380 cm

Weight: 907000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 3.1-3.8 m males; 2.1-3.2 m females

Weight:
Range: 460-907 kg males; 360-544 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Bison bison
Catalog Number: USNM 250145
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull; Skeleton
Collector(s): G. Benson
Year Collected: 1931
Locality: Malheur Lake, Harney County, Oregon, United States, North America
  • Type: Bailey, V. 1932 Apr 02. Proc. Biol. Soc. Washington. 45: 48.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chihuahuan Desert Habitat

This taxon is found in the Chihuahuan Desert, which is one of the most biologically diverse arid regions on Earth. This ecoregion extends from within the United States south into Mexico. This desert is sheltered from the influence of other arid regions such as the Sonoran Desert by the large mountain ranges of the Sierra Madres. This isolation has allowed the evolution of many endemic species; most notable is the high number of endemic plants; in fact, there are a total of 653 vertebrate taxa recorded in the Chihuahuan Desert.  Moreover, this ecoregion also sustains some of the last extant populations of Mexican Prairie Dog, wild American Bison and Pronghorn Antelope.

The dominant plant species throughout the Chihuahuan Desert is Creosote Bush (Larrea tridentata). Depending on diverse factors such as type of soil, altitude, and degree of slope, L. tridentata can occur in association with other species. More generally, an association between L. tridentata, American Tarbush (Flourensia cernua) and Viscid Acacia (Acacia neovernicosa) dominates the northernmost portion of the Chihuahuan Desert. The meridional portion is abundant in Yucca and Opuntia, and the southernmost portion is inhabited by Mexican Fire-barrel Cactus (Ferocactus pilosus) and Mojave Mound Cactus (Echinocereus polyacanthus). Herbaceous elements such as Gypsum Grama (Chondrosum ramosa), Blue Grama (Bouteloua gracilis) and Hairy Grama (Chondrosum hirsuta), among others, become dominant near the Sierra Madre Occidental. In western Coahuila State, Lecheguilla Agave (Agave lechuguilla), Honey Mesquite (Prosopis glandulosa), Purple Prickly-pear (Opuntia macrocentra) and Rainbow Cactus (Echinocereus pectinatus) are the dominant vascular plants.

Because of its recent origin, few warm-blooded vertebrates are restricted to the Chihuahuan Desert scrub. However, the Chihuahuan Desert supports a large number of wide-ranging mammals, such as the Pronghorn Antelope (Antilocapra americana), Robust Cottontail (Sylvilagus robustus EN); Mule Deer (Odocoileus hemionus), Grey Fox (Unocyon cineroargentinus), Jaguar (Panthera onca), Collared Peccary or Javelina (Pecari tajacu), Desert Cottontail (Sylvilagus auduboni), Black-tailed Jackrabbit (Lepus californicus), Kangaroo Rats (Dipodomys sp.), pocket mice (Perognathus spp.), Woodrats (Neotoma spp.) and Deer Mice (Peromyscus spp). With only 24 individuals recorded in the state of Chihuahua Antilocapra americana is one of the most highly endangered taxa that inhabits this desert. The ecoregion also contains a small wild population of the highly endangered American Bison (Bison bison) and scattered populations of the highly endangered Mexican Prairie Dog (Cynomys mexicanus), as well as the Black-tailed Prairie Dog (Cynomys ludovicianus).

The Chihuahuan Desert herpetofauna typifies this ecoregion.Several lizard species are centered in the Chihuahuan Desert, and include the Texas Horned Lizard (Phrynosoma cornutum); Texas Banded Gecko (Coleonyx brevis), often found under rocks in limestone foothills; Reticulate Gecko (C. reticulatus); Greater Earless Lizard (Cophosaurus texanus); several species of spiny lizards (Scelopoprus spp.); and the Western Marbled Whiptail (Cnemidophorus tigris marmoratus). Two other whiptails, the New Mexico Whiptail (C. neomexicanus) and the Common Checkered Whiptail (C. tesselatus) occur as all-female parthenogenic clone populations in select disturbed habitats.

Representative snakes include the Trans-Pecos Rat Snake (Bogertophis subocularis), Texas Blackhead Snake (Tantilla atriceps), and Sr (Masticophis taeniatus) and Neotropical Whipsnake (M. flagellum lineatus). Endemic turtles include the Bolsón Tortoise (Gopherus flavomarginatus), Coahuilan Box Turtle (Terrapene coahuila) and several species of softshell turtles. Some reptiles and amphibians restricted to the Madrean sky island habitats include the Ridgenose Rattlesnake (Crotalus willardi), Twin-spotted Rattlesnake (C. pricei), Northern Cat-eyed Snake (Leptodeira septentrionalis), Yarrow’s Spiny Lizard (Sceloporus jarrovii), and Canyon Spotted Whiptail (Cnemidophorus burti).

There are thirty anuran species occurring in the Chihuahuan Desert: Chiricahua Leopard Frog (Rana chircahuaensis); Red Spotted Toad (Anaxyrus punctatus); American Bullfrog (Lithobates catesbeianus); Canyon Treefrog (Hyla arenicolor); Northern Cricket Frog (Acris crepitans); Rio Grande Chirping Frog (Eleutherodactylus cystignathoides); Cliff Chirping Frog (Eleutherodactylus marnockii); Spotted Chirping Frog (Eleutherodactylus guttilatus); Tarahumara Barking Frog (Craugastor tarahumaraensis); Mexican Treefrog (Smilisca baudinii); Madrean Treefrog (Hyla eximia); Montezuma Leopard Frog (Lithobates montezumae); Brown's Leopard Frog (Lithobates brownorum); Yavapai Leopard Frog (Lithobates yavapaiensis); Western Barking Frog (Craugastor augusti); Mexican Cascade Frog (Lithobates pustulosus); Lowland Burrowing Frog (Smilisca fodiens); New Mexico Spadefoot (Spea multiplicata); Plains Spadefoot (Spea bombifrons); Pine Toad (Incilius occidentalis); Woodhouse's Toad (Anaxyrus woodhousii); Couch's Spadefoot Toad (Scaphiopus couchii); Plateau Toad (Anaxyrus compactilis); Texas Toad (Anaxyrus speciosus); Dwarf Toad (Incilius canaliferus); Great Plains Narrowmouth Toad (Gastrophryne olivacea); Great Plains Toad (Anaxyrus cognatus); Eastern Green Toad (Anaxyrus debilis); Gulf Coast Toad (Incilius valliceps); and Longfoot Chirping Toad (Eleutherodactylus longipes VU). The sole salamander occurring in the Chihuahuan Desert is the Tiger Salamander (Ambystoma tigrinum).

Common bird species include the Greater Roadrunner (Geococcyx californianus), Burrowing Owl (Athene cunicularia), Merlin (Falco columbarius), Red-tailed Hawk (Buteo jamaicensis), and the rare Zone-tailed Hawk (Buteo albonotatus). Geococcyx californianus), Curve-billed Thrasher (Toxostoma curvirostra), Scaled Quail (Callipepla squamata), Scott’s Oriole (Icterus parisorum), Black-throated Sparrow (Amphispiza bilineata), Phainopepla (Phainopepla nitens), Worthen’s Sparrow (Spizella wortheni), and Cactus Wren (Campylorhynchus brunneicapillus). In addition, numerous raptors inhabit the Chihuahuan Desert and include the Great Horned Owl (Bubo virginianus) and the Elf Owl (Micrathene whitneyi).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Bison historically occurred throughout the grasslands and open savannas of North America. However, they were also found from boreal habitats to semi-desert habitats if grazing was suitable. Bison are now more limited in distribution and, therefore, the habitats they occupy. They are currently found in disjunct populations in protected areas throughout western North America. They occupy a large elevational range, being found at all elevations in the protected areas they occupy (Meagher, 1986).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
North American bison are primarily grazers and forage primarily in grassland and meadow communities. They had the widest natural range of any North American herbivore, from the arid grasslands of Chihuahua State in northern Mexico, through the grasslands of the Great Plains, to the riparian meadows of interior Alaska. They can persist in arid regions (Mexico and New Mexico) and in areas experiencing deep snow cover (Yellowstone National Park). Grasses and sedges form the mainstay of the annual diet in all regions. However, summer and fall diets may be broader, including flowering plants, woody plant leaves, and lichens, in addition to grasses and sedges, depending on local availability. Bison excavate snow at foraging sites by sweeping it away using side to side motions of their muzzle. The plains bison undertook seasonal migrations when it was abundant prior to European settlement of the continent. It no longer migrates owing to land use change and depopulation. The wood bison was not migratory and remains so. Both subspecies exhibit strong seasonal aggregation during the calving through breeding seasons (May through August).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South Central Rockies Forests Habitat

This species occurs in the South Central Rockies forests, a set of seven disjunctive geographic units, forming an ecoregion centered primarily on the Yellowstone Plateau and the mountain ranges radiating outward from the plateau. The largest unit lies mainly in western Wyoming, extending into eastern Idaho and central Montana; a portion of this ecoregion lies in northwestern Wyoming, and comprises the headwaters of the Yellowstone River and  Green River.  A second large unit comprises the mountains of central and eastern Idaho south of the Clearwater River. The ecoregion also occurs in five additional isolated geographic units, the two largest being the Bighorn Mountains of north-central Wyoming/ south-central Montana, and the Black Hills of western South Dakota/ northeastern Wyoming.

The dominant vegetation type in the ecoregion is coniferous forest. Küchler classifies the potential vegetation type as Douglas-fir / spruce-fir forest, dominated by Engleman spruce (Picea englemannii), subalpine fir (Abies lasiocarpa), and Douglas-fir (Psuedotsuga menziesii). Large areas of the ecoregion are dominated by Lodgepole pine. In some regard, the preponderance of Lodgepole pine reflects the greatly altered (via fire suppression) disturbance regime in the ecoregion. Whitebark pine (Pinus albicaulis) is an important species at the upper treeline / Krummholz zone.

The American bison (Bison bison NT) is the premier example of charismatic megafauna within the South Central Rockies forests and is an ecoregion endemic. The Yellow-bellied marmot (Marmota flaviventris) is also found here in its colonial burrows, especially at mountain meadow and talus habitats. American black bear (Ursus americanus) and Grizzly bear (Ursus arctos horribilis) also occur within the ecoregion. In addition to these ursine species, two other apex predators in these forests are the Bobcat (Lynx rufus) and Canadian lynx (Lynx canadensis). Other mammals found here are the American mink (Neovison vison) and the Black-tailed prairie dog (Cynomys ludovicianus); and the Western harvest mouse (Reithrodontomys megalotis).

There are only six amphibian taxa known to the South Central Rockies forests.  Anuran species found in the ecoregion are: Northern leopard frog (Lithobates pipiens); Boreal chorus frog (Pseudacris maculata); Columbia spotted frog (Rana luteiventris); Woodhouse's toad (Anaxyrus woodhousii); and Western toad (Anaxyrus boreas). Salamanders found here in the South Central Rockies forests are merely the Tiger salamander (Ambystoma tigrinum).

Notable reptiles that can be observed in the South Central Rockies forests include: Painted turtle (Chrysemys picta); Ornate tree lizard (Urosaurus ornatus); Western rattlesnake (Crotalis viridis); Western terrestrial garter snake (Thamnopsis elegans); Red-bellied snake (Storeria occipitomaculata); Western gopher snake (Pituophis catenifer); and the Smooth green snake (Liochlorophis vernalis).

Avifauna found in the ecoregion include the Golden eagle (Aquila chrysaetos); Pinyon jay (Gymnorhinus cyanocephalus VU); Lapland longspur (Calcarius lapponicus); Blue-grey gnatcatcher (Polioptila caerulea); Black-backed woodpecker (Picoides arcticus); and the Golden-crowned kinglet (Regulus satropa).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Comments: Open plains and grasslands in south; woodland and openings in boreal forest, meadows, and river valleys in north. Like other large grazers, attracted to burned areas the next growing season (Shaw and Carter 1990). During the growing season at the Konza Prairie in northeastern Kansas, preferred areas that had been burned in spring; summer grazing was concentrated in large watershed area (79-119 ha) dominated by warm-season, perennial C4 grasses; in fall and winter, grazed both burned and unburned watersheds more uniformly but grazed most intensively in areas with large stands of cool-season, C3 grasses (Vinton et al. 1993). Cows usually give birth in isolation where vegetation provides cover; isolation during birth is infrequent where cover is lacking (Meagher 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, shrub

American bison thrive in open areas.  When available, shrub or forest cover may
be used for shade, escape from insects, or shelter from severe weather [8].
  • 8.  Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James        A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart,        Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver,        CO: U.S. Department of the Interior, Bureau of Land Management, Service        Center: 519-564.  [10856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, shrub

The primary habitat requirements for American bison are adequate forage, water,
and space [8].  American bison thrive in open grasslands, meadows, and parklands.
When available, American bison use forested areas for shade and to escape
insects.  These areas also furnish forage when open areas are covered by
"deep" snow [8].  However, American bison can survive in open valleys covered
with several feet of snow [94].  During severe weather, forested areas
and some topographical features furnish cover [8].  Scattered thermal
sites (particularly warm ground with less snow than the surrounding
area) provide favorable sites for wintering American bison in Yellowstone
National Park [94].  In northern Canada forested and shrub covered
areas are often used as daily and seasonal travel corridors [11].

Most American bison are seasonally migratory; movements are both directional and
altitudinal in some regions [11,52,70].  During historical times, large
herds of American bison commonly moved southward 200 miles (322 km) or more to
winter range [2].  Directional and altitudinal movements between summer
and winter ranges still occur annually at Wood Buffalo National Park and
Yellowstone National Park [2,11,52,94].  During November and May, American bison
at Wood Buffalo National Park migrate from wooded hills to the Peace
River Valley, a distance of as much as 150 miles (241 km) [2].  Factors
that may influence seasonal migrations include tradition, supply and
accessibility of forage, open water, shelter, insect harassment, spring
weather conditions and temperatures, and fall snowstorms at higher
elevations [53,58].

In mountainous areas, altitudinal movements to lowland winter range in
fall and to higher summer range in spring are quite common.  Snipe flies
(Symphoromyia spp.) may be responsible for some altitudinal movements by
Yellowstone National Park American bison herds during the summer [52].  Large,
windswept prairies may also be chosen in summer for relief from
insects.  American bison, particularly cows, show strong affinity to traditional
winter range [52,70].  Shaw and Carter [70] found that older females
appear to be more prone than younger ones to seek new winter range and
return to the new range in subsequent winters.
  • 2.  Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University        of Toronto Press. 438 p.  [21084]
  • 8.  Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James        A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart,        Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver,        CO: U.S. Department of the Interior, Bureau of Land Management, Service        Center: 519-564.  [10856]
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 52.  Meagher, Mary M. 1973. The bison of Yellowstone National Park.        Scientific Monograph Series 1. [Denver, CO]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 58.  Morgan, R. Grace. 1980. Bison movement patterns on the Canadian plains:        an ecological analysis. Plains Anthropology. 25: 142-160.  [1694]
  • 70.  Shaw, James H.; Carter, Tracy S. 1990. Bison movements in relation to        fire and seasonality. Wildlife Society Bulletin. 18(4): 426-430.        [14777]
  • 94.  Meagher, Mary M. 1978. Bison. In: Schmidt, J. L.; Gilbert, D. L., eds.        Big game of North America: ecology and management. Harrisburg, PA:        Stackpole Books: 123-133.  [24556]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Before European settlement American bison occurred primarily on the central
grasslands and northern parklands of North America, but habitats ranging
from semidesert to boreal forest were also used [53]. In Montana the
Lewis and Clark expedition observed vast numbers of American bison in areas
floristically dominated by shortgrass species [11].

Today, American bison occupy shortgrass and tallgrass prairies, boreal parklands,
montane meadows, desert grasslands, and shrub-grass habitats.  In
Canada, coniferous forest and quaking aspen (Populus tremuloides)
parklands with interspersed meadows and prairies form the main habitat
for wood bison [11].  In the Northwest Territories, bison habitat along
the Slave River Lowlands is within the boreal forest region of Canada,
where white spruce (Picea glauca) forests separate vast open meadows
supporting sedge (Carex spp.) and grass communities [11].  On the Beaver
Hills near Edmonton, Alberta, Hudson and Frank [40] found that American bison
foraged most often on grassy upland meadows dominated by Kentucky
bluegrass (Poa pratense) and smooth brome (Bromus inermis) and least in
forests dominated by balsam poplar (Populus balsamifera) and quaking
aspen [40].

American bison in Wind Caves National Park commonly occur on grasslands dominated
by little bluestem (Schizachyrium scoparium), big bluestem (Andropogon
gerardii var. gerardii), Kentucky bluegrass, and western wheatgrass
(Pascopyrum smithii) [18].

In Yellowstone National Park, American bison inhabit meadows with sedge and grass
interspersed with lodgepole pine (Pinus contorta) forests [11].  In
southern Utah, American bison occupy pinyon-juniper (Pinus spp.-Juniperus spp.)
habitat [29,72,91].

  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 18.  Coppock, D. Layne; Detling, James K. 1986. Alteration of bison and        black-tailed prairie dog grazing interaction by prescribed burning.        Journal of Wildlife Management. 50(3): 452-455.  [689]
  • 29.  Frischknecht, Neil C. 1975. Native faunal relationships within the        pinyon-juniper ecosystem. In: The pinyon-juniper ecosystem: a symposium:        Proceedings; 1975 May; Logan, UT. Logan, UT: Utah State University,        College of Natural Resources, Utah Agricultural Experiment Station:        55-56.  [974]
  • 40.  Hudson, R. J.; Frank, S. 1987. Foraging ecology of bison in aspen boreal        habitats. Journal of Range Management. 40(1): 71-75.  [1201]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 72.  Short, Henry L.; McCulloch, Clay Y. 1977. Managing pinyon-juniper ranges        for wildlife. Gen. Tech. Rep. RM-47. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station. 10 p.  [2137]
  • 91.  Zarn, Mark. 1977. Ecological characteristics of pinyon-juniper woodlands        on the Colorado Plateau: A literature survey. Tech. Note T/N 310.        Denver, CO: U.S. Department of the Interior, Bureau of Land Management,        Denver Service Center. 183 p.  [2689]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

   101  Bluebunch wheatgrass
   102  Idaho fescue
   104  Antelope bitterbrush-bluebunch wheatgrass
   105  Antelope bitterbrush-Idaho fescue
   107  Western juniper/big sagebrush/bluebunch wheatgrass
   110  Ponderosa pine-grassland
   301  Bluebunch wheatgrass-blue grama
   302  Bluebunch wheatgrass-Sandberg bluegrass
   303  Bluebunch wheatgrass-western wheatgrass
   304  Idaho fescue-bluebunch wheatgrass
   305  Idaho fescue-Richardson needlegrass
   306  Idaho fescue-slender wheatgrass
   307  Idaho fescue-threadleaf sedge
   309  Idaho fescue-western wheatgrass
   310  Needle-and-thread-blue grama
   311  Rough fescue-bluebunch wheatgrass
   313  Tufted hairgrass-sedge
   314  Big sagebrush-bluebunch wheatgrass
   317  Bitterbrush-bluebunch wheatgrass
   321  Black sagebrush-Idaho fescue
   401  Basin big sagebrush
   402  Mountain big sagebrush
   403  Wyoming big sagebrush
   409  Tall forb
   410  Alpine rangeland
   411  Aspen woodland
   412  Juniper-pinyon woodland
   422  Riparian
   601  Bluestem prairie
   602  Bluestem-prairie sandreed
   603  Prairie sandreed-needlegrass
   604  Bluestem-grama prairie
   605  Sandsage prairie
   606  Wheatgrass-bluestem-needlegrass
   607  Wheatgrass-needlegrass
   608  Wheatgrass-grama-needlegrass
   609  Wheatgrass-grama
   610  Wheatgrass
   611  Blue grama-buffalograss
   612  Sagebrush-grass
   614  Crested wheatgrass
   615  Wheatgrass-saltgrass-grama
   704  Blue grama-western wheatgrass
   708  Bluestem-dropseed
   709  Bluestem-grama
   710  Bluestem prairie
   715  Grama-buffalograss
   717  Little bluestem-Indiangrass-Texas wintergrass
   718  Mesquite-grama
   722  Sand sagebrush-mixed prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K011  Western ponderosa forest
   K016  Eastern ponderosa forest
   K017  Black Hills pine forest
   K018  Pine-Douglas-fir forest
   K023  Juniper-pinyon woodland
   K024  Juniper steppe woodland
   K038  Great Basin sagebrush
   K051  Wheatgrass-bluegrass
   K052  Alpine meadows and barren
   K055  Sagebrush steppe
   K056  Wheatgrass-needlegrass shrubsteppe
   K057  Galleta-three-awn shrubsteppe
   K063  Foothills prairie
   K064  Grama-needlegrass-wheatgrass
   K065  Grama-buffalograss
   K066  Wheatgrass-needlegrass
   K067  Wheatgrass-bluestem-needlegrass
   K068  Wheatgrass-grama-buffalograss
   K069  Bluestem-grama prairie
   K070  Sandsage-bluestem prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K081  Oak savanna
   K085  Mesquite-buffalograss
   K098  Northern floodplain forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES11 Spruce-fir
FRES19 Aspen-birch
FRES21 Ponderosa pine
FRES23 Fir-spruce
FRES26 Lodgepole pine
FRES29 Sagebrush
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

    12  Black spruce
    13  Black spruce-tamarack
    16  Aspen
   204  Black spruce
   217  Aspen
   218  Lodgepole pine
   220  Rocky Mountain juniper
   235  Cottonwood-willow
   237  Interior ponderosa pine
   239  Pinyon-juniper
   253  Black spruce-white spruce
   254  Black spruce-paper birch

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Previously made mass migrations across prairie in spring and fall. Probably moved southward a few hundred miles to winter pastures. Mountain popualtions moved to lower elevations in valleys. Movements of U.S. populations now are restricted to parks and vicinity.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bison are year round grazers. They feed primarly on grasses, but when food is scarce, they will eat vegetation such as sagebrush. On average, bison ingest 1.6% of their body mass per day of dry vegetation. Bison require water every day as well (Meagher, 1986).

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Primarily a grazer. Feeds on grasses, forbs, and sedges. See GHABCOM.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: forbs, lichen, phenology, selection

Adult American bison require approximately 30 pounds of forage every day [25].
Where grasses and sedges are available in the habitat, they are
selectively grazed by American bison, and where they are sparse, browse may be
substituted [8,11,20,53,88].

Dietary shifts from grasses to sedges and back again within a habitat
type are usually associated with plant phenology [11].  In Yellowstone
National Park, sedges comprised the highest proportion of American bison diets in
all seasons, while grasses were second in importance.  Minor quantities
of forbs (6%) and browse (2%) were consumed, mainly in summer [52].  In
northeastern Colorado, sedges were important to American bison only during
spring.  American bison herds located at Wood Buffalo National Park and Elk
Island National Park were observed feeding on grasses in summer and
sedges in winter [11].

In the Slave River Lowlands, American bison diets contained 29 different plant
species.  Slough sedge (Carex atherodes) was the most abundant plant in
the diet, varying from 42 percent in winter to 77 percent in spring.
The second most common food was reedgrass (Calamagrostis spp.), which
varied from 15 percent of the diet in spring to 35 percent in winter.
Together, these two forages comprised more than 70 percent of the American bison
diet at all seasons [64].

Diet and habitat selection of wood bison were studied in the Mackenzie
Bison Sanctuary between February 1986 and April 1988.  Wood bison showed
pronounced seasonal changes in their diet.  Sedges constituted 96.1 to
98.8 percent of the winter diet.  During the summer, the diet became a
more diverse mix of sedge (Carex spp.), grasses (Poaceae), and willow
(Salix spp.).  Reindeer lichen (Cladonia spp.) became a major dietary
component in fall.  Summer browsing on willows increased when sedge
standing crops were reduced [45].

In some areas forbs are seasonally important to foraging American bison [11,89].
In semidesert range in southwestern Colorado, forbs were common food
items during all seasons but never exceeded 17 percent in any one season
[89].  In Yellowstone National Park and in northern Canada, forbs
appeared to be important to American bison only during summer; in northeastern
Colorado, forbs were important during fall and winter [11].

On the shortgrass plains in Colorado, where blue grama (Bouteloua
gracilis) is the dominant species, American bison consumed 36 different plant
species.  However, only 11 contributed significantly to the total.  Blue
grama and buffalo grass (Buchloe dactyloides) were the most abundant
plants in the habitat and also in the diet.  Where available, western
wheatgrass was preferred over blue grama.  Other commonly consumed
species were red threeawn (Aristida purpurea), sun sedge (Carex
heliophila), scarlet globemallow (Sphaeralcea coccinea), sand dropseed
(Sporobolus cryptandrus), needle-and-thread grass (Stipa comata),
fringed sagebrush (Artemisia frigida), buckwheat (Eriogonum spp.), and
sixweeks fescue (Vulpia octoflora) [61].

On semidesert range at Colorado National Monument, the most common plant
species in the American bison diet during most seasons was fourwing saltbush
(Atriplex canescens), followed by needle-and-thread grass, which was
important during cooler months.  Sand dropseed and galleta (Hilaria
jamesii) were prominent in the diet in warmer seasons.  The only forbs
significantly utilized during all seasons except winter were mallows
(Sphaeralcea spp.).  Prickly pear (Opuntia spp.) was among the ten top
forage species during all seasons except summer.  Some of the most
common plants in the habitat, cheatgrass (Bromus tectorum), Utah juniper
(Juniperus osteosperma), and big sagebrush (Artemisia tridentata), were
the least preferred forages [89].
  • 8.  Boyd, Raymond J.; Cooperrider, Allen Y.; Lent, Peter C.; Bailey, James        A. 1986. Ungulates. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart,        Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver,        CO: U.S. Department of the Interior, Bureau of Land Management, Service        Center: 519-564.  [10856]
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 20.  Detling, J. K.; Dyer, M. I.; Procter-Gregg, C.; Winn, D. T. 1980.        Plant-herbivore interactions: examination of potential effects of bison        saliva on regrowth of Bouteloua gracilis (H.B.K.) Lag. Oecologia. 45:        26-31.  [5000]
  • 25.  Evans, Keith E.; Probasco, George E. 1977. Wildlife of the prairies and        plains. Gen. Tech. Rep. NC-29. St. Paul, MN: U.S. Department of        Agriculture, Forest Service, North Central Forest Experiment Station. 18        p.  [14118]
  • 45.  Larter, Nicholas C.; Gates, Cormack C. 1991. Diet and habitat selection        of wood bison in relation to seasonal changes in forage quantity and        quality. Canadian Journal of Zoology. 69: 2677-2685.  [24528]
  • 52.  Meagher, Mary M. 1973. The bison of Yellowstone National Park.        Scientific Monograph Series 1. [Denver, CO]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 61.  Peden, Donald G. 1976. Botanical composition of bison diets on        shortgrass plains. American Midland Naturalist. 96(1): 225-229.  [24596]
  • 64.  Reynolds, H. W.; Hansen, R. M.; Peden, D. G. 1978. Diets of the Slave        River lowland bison herd, Northwest Territories, Canada. Journal of        Wildlife Management. 42(3): 581-590.  [25134]
  • 88.  Waggoner, Van; Hinkes, Mike. 1986. Summer and fall browse utilization by        an Alaskan bison herd. Journal of Wildlife Management. 50(2): 322-324.        [24530]
  • 89.  Wasser, C. H. 1977. Bison induced stresses in Colorado National        Monument. In: Final Report. National Park Service Contract PX 120060617.        120 p.  [24555]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Huge herds of bison once roamed the grasslands of North America. Their grazing and dust-bathing strongly influenced the composition of plant communities and the communities of other animals. Bison can reasonably be called a keystone member of North American prairie communities, along with prairie dogs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Their large size and formidable defenses make healthy, adult bison relatively safe from predators. Elderly and ill bison and calves are preyed on by large predators such as mountain lions, wolves, and humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

More info for the term: cover

The main predators of American bison are gray wolf (Canis lupus), [10,11,38,65]
grizzly bear (Ursus arctos horribilis), and coyote (Canis latrans) [11].
On the Slave River Lowlands, American bison were the most important of six major
prey types eaten by gray wolves and represented 88 percent of prey
weight during the period of snow cover (Nov. 8, 1976-April 15, 1977).
Gray wolf predation in 1976 and 1977 accounted for about 31 percent of
adult and subadult American bison mortality and approximately 27 percent of calf
mortality [65].  Winter-killed American bison may be important food sources to
grizzly bear in early spring after they emerge from their dens [11].
  • 10.  Carbyn, L. N. 1987. Responses of bison on their calving grounds to        predation by wolves in Wood Buffalo National Park. Canadian Journal of        Zoology. 65: 2072-2078.  [24527]
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 38.  Herman, Margaret, Willard, E. Earl. 1978. Rocky Mountain wolf and its        habitat. Missoula, MT: U.S. Department of Agriculture, Forest Service,        National Forest System Cooperative Forestry, Forestry Research, Region        1. 17 p.  [16522]
  • 65.  Reynolds, H. W.; Hawley, A. W. L. 1987. Bison ecology in relation to        agricultural development in the Slave River lowlands, Northwest        Territories. Occassional Paper No. 63. Ottawa, ON: Canadian Wildlife        Service. 74 p.  [24553]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: A few wild remnant populations occur in U.S. and Canadian national parks. Now occurs mainly as reintroduced, confined populations in many public and private parks and preserves in the U.S. and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: North American population may have been about 30-60 million about the time modern man arrived. Reduced to about 1650 by 1903. Population in 1983 was estimated at 75,000 (Meagher 1986). In Yellowstone NP, the herd was estimated at 3000-3500 in 1996 (Keiter 1997); however, over 1000 were killed during the winter of 1996-97 by agency personnel.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Often forms herds of 11 - 12 animals. Cows and young remain in herds throughout the year. Bulls solitary or in small groups until summer when they begin to mix with cow-calf herds. Home range in Northwest Territories averaged several hundred sq km (Larter and Gates 1990). May live up to about 20 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Management Implications

This study showed that prescribed fires can be used in ponderosa
pine-grassland ecotones of the Black Hills to temporarily improve forage
for American bison.
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Effects on Animal Species and Habitat

More info for the term: shrubs

Effect on vegetation - Vegetation was measured 1 year before the fire
and for 2 years after (May-June of 1980 and 1981) the fire.  Plants that
increased as a result of the fire included sedges, needlegrasses, and
beautiful shootingstar; bare ground also increased.  Plants reduced by
the fire included bluegrasses (Poa spp.), little bluestem (1980 only),
ponderosa pine (both canopy and immature trees), and shrubs (1980 only).
The fire caused only a modest decline in overall similarity between
experimental and control vegetation plots, and this decline persisted
through two postfire growing seasons.

Effect on American bison - American bison preferred feeding on burned
sites during the first postfire growing season.  Before the fire, American
bison cow-calf herds preferred the control areas.  After burning, they were
attracted to the recently burned area for feeding.  However, this grazing
preference disappeared in the second postfire year.  Before the fire, bulls
preferred the control site.  During the first postfire year the bulls
used both sites, while in the following year, they showed a preference
for the unburned site.  Small bull groups tended to defer in habitat use
to cow-calf herds.
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Description

More info for the term: prescribed fire

Conditions for the prescribed fire (the "Cone Burn") were met at midday
17 October 1979, when the wind was about 10 miles per hour (16 km/h),
temperature was 58 degrees Fahrenheit (14.4 deg C), and relative humidity
was 45 percent.  The fire passed over a 156-acre (63 ha) area in about 4
hours.  A few standing dead snags on the north and west faces of the
area were still burning at midmorning the following day, when they were
extinguished by a rain shower.  Fire varied from discontinuous,
low-severity (leaving some patches unburned) to crowning behavior.
Combustion of surface fuels was nearly complete, except in unburned
patches.
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: avoidance, codominant, cover, fire regime, fire severity, forbs, frequency, fuel, mesic, natural, prescribed fire, severity, shrubs

Fire is important in creating and maintaining American bison habitat.  Fire
regenerates grasslands and enhances production, availability, and
palatability of many American bison forage species [9,11,67,68].  Fire frequency
has been estimated to occur once every 3 to 5 years on some prairies
[97].  During presettlement times American bison habitats were to a large extent
created and maintained by lightning-caused fires or fires set by Native
Americans [44,47,49,50].  The results of intense grazing by large American bison
herds on recently burned areas may have reduced fuel loads, making the
grazed areas less likely to burn and even allowing them to function as
firebreaks [49,75].  In contrast, unburned areas would have been little
grazed, thereby increasing fuel loads and the probability of burning.
The slaughter of American bison in the late 1800's may have shortened fire return
intervals and increased fire severity during the early settlement
period.  Steuter [75] suggested that integrating a regional fire
behavior model with estimates of presettlement American bison patterns could
provide a valuable tool for natural area management in the northern
mixed-grass prairie.

Several studies have shown that American bison prefer to forage on recently
burned areas [5,7,22,28,70,87].  In tallgrass prairie on the Konza
Prairie Research Natural Area, northeastern Kansas, 45 American bison range over
an array of watersheds with different FIRE REGIMES [87].  The watersheds
are burned in April annually or at 2-, 4-, or 20-year intervals.  In the
spring of 1988 and 1989, Vinton and others [87] studied American bison grazing
and use patterns among these watersheds as influenced by fire regime.
American bison used some watersheds preferentially and the pattern of watershed
use changed seasonally.  During the spring of both years (April-June
30), American bison selected only watersheds that had been recently burned
(annually or biennially), and were observed up to three times more
frequently than expected on these watersheds. In 1988, preferential
grazing of recently burned watersheds persisted through the summer
months.  During autumn and winter of both years, American bison preferred the
annual and 20-year burn watersheds to watersheds that were burned every
2 or 4 years.
  
On the same study site as above, little bluestem was sampled to
determine how fire influences its use by American bison and its responses to
grazing.  Plants were marked at the beginning of the 1992 growing
season.  Little bluestem was sampled in an annually burned watershed and
a watershed burned at 4-year intervals (referred to as "unburned") that
had been grazed by American bison since 1987, and nearby annually burned and
4-year burn interval watershed that were ungrazed.  The 4-year burn
interval watersheds had last burned 2 years before sampling.  On
unburned prairie, American bison grazed only 5 percent of the available little
bluestem, selecting it only 30 percent as frequently as big bluestem,
the codominant species.  On burned prairie, grazing frequency of little
bluestem was more than 3 times as great as on unburned sites and equal
to that of big bluestem.  The increased grazing frequency on little
bluestem in recently burned prairie is most likely the result of the
removal of its persistent standing dead tillers by burning.  Burning did
not affect grazing on big bluestem, a plant lacking persistent standing
dead tillers.  With longer intervals between fires, American bison might display
even greater avoidance of little bluestem in favor of other grasses
[93].

A combination of fire and American bison grazing may increase the standing crop
of rhizomatous grasses at the expense of bunchgrasses.  Pfeiffer and
Steuter [96] conducted a study on Nebraska sandhills during the 1991 and
1992 growing seasons to determine the response of sandhills prairie
vegetation to spring and summer prescribed burns and subsequent American bison
grazing.  Approximately 1,235 acres (500 ha) were burned in early May,
and another 247 acres (100 ha) were burned in late July, 1991.  During
the 1992 growing season, American bison grazing on burned areas reduced
bunchgrass standing crop by 56 percent, while reducing rhizomatous grass
standing crop by only 18 percent.  Forbs generally appeared unaffected
by American bison grazing.  The increased grazing pressure by American bison lasted only
one season.  Rhizomatous grasses of the Great Plains are better adapted
to large herbivore grazing than are bunchgrasses.  Burning and grazing
would increase the amount of forage available since, in unburned
prairie, standing dead tillers deter use of bunchgrasses.

Several studies concerning American bison response to prescribed fire have been
conducted at Wind Cave National Park [5,28,32].  Two prescribed fires in
ponderosa pine (Pinus ponderosa)-grassland habitat were conducted on
October 16, 1974 and May 9, 1975.  The spring fire was conducted on a
site adjacent to the fall fire.  American bison were noted in the area of the
burns during the course of burning.  They utilized regrowth vegetation
on the burned areas throughout the summer of 1975 [32].  A prescribed
fire conducted on April 1, 1981, burned 110 acres (44.5 ha) of
mixed-grass prairie and 134 (54.4 ha) of forest land.  American bison fed within
the burn in 1981 and 1982, moving in 1983 to an area burned by wildfire
[28].

On the Wichita Mountains Wildlife Refuge, Shaw and Carter [70] studied
seasonal range use by American bison before and after spring prescribed fires on
a mixed-grass prairie interspersed with post oak (Quercus
stellata)-blackjack oak (Q. marilandica) woodlands.  American bison increased use
of the burned portion of their summer range.  They showed no apparent
response to prescribed burning of an area of new winter range, but they
delayed their spring departure to traditional summer range.

Some studies have shown that cow-calf herds graze burned areas more
often than bulls [5,18].  The first postfire years following a fall
prescribed fire in grassland habitat at Wind Cave National Park, bulls
were found less than cow-calf herds on burned sites.  Both cow-calf
herds and bull groups tended to use the burn more in June of the first
postfire season than at any other time.  However, only cow-calf herds
consistently grazed the burn during the rest of the summer [18].

Wallows enhance species diversity in American bison habitat.  In Wichita
Mountains National Wildlife Refuge, ruderal species (e.g., Japanese
brome and false pennyroyal) and mesic species (e.g., purple ammania,
pepperwort [Marsilea mucronata], and seacoast sumpweed) had higher cover
values within wallow than outside them.  Wallows may be especially
abundant and heavily used on burned sites because American bison are attracted to
graze in such areas [16].  Collins and Uno [16] examined the effects of
February, 1982, prescribed fire on wallow vegetation in Wichita
Mountains Wildlife Refuge.  Vegetation samples taken during June and
early July, 1982, from the edge and interior of unburned wallows were
more similar to each other than were edge and interior samples from
burned wallows.  Species diversity and richness were significantly lower
in burned than in unburned wallows.  Winter annuals were more abundant
in unburned wallows, perhaps because they were burned during their
growing season.  The authors suggested that spring fires may reduce
cover of winter annuals in wallows, but summer and fall fires could
increase their importance [16].

Sedge-grasslands, which are important winter habitat for American bison, often
increase in area after fire removes surrounding shrubs or trees [9].
Fires in open black spruce (Picea mariana) forests and shrublands may
result in expansion of sedge-grasslands.  In 1977, the Bear Creek
wildfire near Farewell, Alaska, moderately to severely burned a closed
spruce-hardwood forest and an open black spruce forest with an
understory of willow, shrubs, and sedges.  The fire converted 100 square
miles (260 km sq.) of predominantly open black spruce forest to
sedge-grassland.  Most of the American bison in this area winter on sites with
extensive sedge cover.  By postfire year 4 the sedge-grassland habitat
had more than doubled in area.  Fire-related snowpack changes also may
have stimulated American bison winter range expansion.  Before the fire, the
disjunct and widely scattered sedge-grasslands were separated by
extensive open black spruce forest and shrublands.  This habitat
generally has a greater snowpack than sedge-grasslands and, therefore,
is likely to discourage American bison movements.  After the 1977 fire,
sedge-grasslands showed less snow cover than adjacent unburned open
black spruce forests and shrublands [9].
  • 5.  Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation        and wildlife in ponderosa pine forests of the southern Black Hills.        Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022;        Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department        of Agriculture, Forest Service, Intermountain Research Station, Fire        Sciences Lab, Missoula, MT. 58 p.  [479]
  • 7.  Boyce, Mark S.; Merrill, Evelyn H. 1991. Effects of the 1988 fires on        ungulates in Yellowstone National Park. In: Proceedings, 17th Tall        Timbers fire ecology conference; 1989 May 18-21; Tallahassee, FL.        Tallahassee, FL: Tall Timbers Research Station: 121-132.  [17604]
  • 9.  Campbell, Bruce H.; Hinkes, Mike. 1983. Winter diets and habitat use of        Alaska bison after wildfire. Wildlife Society Bulletin. 11(1): 16-21.        [8389]
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 16.  Collins, Scott L.; Uno, Gordon E. 1983. The effect of early spring        burning on vegetation in buffalo wallows. Bulletin of the Torrey        Botanical Club. 110(4): 474-481.  [4352]
  • 18.  Coppock, D. Layne; Detling, James K. 1986. Alteration of bison and        black-tailed prairie dog grazing interaction by prescribed burning.        Journal of Wildlife Management. 50(3): 452-455.  [689]
  • 22.  Easterly, Thomas G.; Jenkins, Kurt J. 1991. Forage production and use on        bighorn sheep winter range following spring burning in grassland and        ponderosa pine habitats. Prairie Naturalist. 23(4): 193-200.  [19277]
  • 32.  Gartner, F. Robert. 1977. Ecological changes on pine grassland burned in        fall and spring. Final Report Contract No. PX 120051027, U.S. Department        of the Interior National Park Service, Rocky Mountain Regional Office.        Rapid City, SD: South Dakota State University, Agricultural Research and        Extension Center. 35 p.  [1001]
  • 44.  Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of        fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD:        South Dakota State University, Cooperative Extension Service, South        Dakota Cooperative Fish and Wildlife Research Unit. 47 p.  [14749]
  • 47.  Little, Silas. 1974. Effects of fire on temperate forests: northeastern        United States. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and        ecosystems. New York: Academic Press: 225-250.  [9859]
  • 49.  Madson, John. 1990. On the Osage. Nature Conservancy Magazine. 40(3):        7-15.  [11799]
  • 50.  McCormack, Patricia A. 1992. The political economy of bison management        in Wood Buffalo National Park. Arctic. 45(4): 367-380.  [21080]
  • 67.  Risser, Paul G. 1990. Landscape processes and the vegetation of the        North American grassland. In: Collins, Scott L.; Wallace, Linda L., eds.        Fire in North American tallgrass prairies. Norman, OK: University of        Oklahoma Press: 133-146.  [14199]
  • 68.  Samoil, J. 1992. Fire on the range: burning for bison habitat.        Timberlines. 1: 4.  [18185]
  • 70.  Shaw, James H.; Carter, Tracy S. 1990. Bison movements in relation to        fire and seasonality. Wildlife Society Bulletin. 18(4): 426-430.        [14777]
  • 75.  Steuter, Allen A. 1986. Fire behavior and standing crop characteristics        on repeated seasonal burns--northern mixed prairie. In: Koonce, Andrea        L., ed. Prescribed burning in the Midwest: state-of-the-art: Proceedings        of a symposium; 1986 March 3-6; Stevens Point, WI. Stevens Point, WI:        University of Wisconsin, College of Natural Resources, Fire Science        Center: 54-59.  [16269]
  • 87.  Vinton, Mary Ann; Harnett, David C.; Finck, Elmer J.; Briggs, John M.        1993. Interactive effects of fire, bison (Bison bison) grazing and plant        community composition in tallgrass prairie. American Midland Naturalist.        129: 10-18.  [20182]
  • 93.  Pfeiffer, Kent E.; Hartnett, David C. 1995. Bison selectivity and        grazing response of little bluestem in tallgrass prairie. Journal of        Range Management. 48(1): 26-31.  [24533]
  • 96.  Pfeiffer, Kent E.; Steuter, Allen A. 1994. Preliminary response of        Sandhills prairie to fire and bison grazing. Journal of Range        Management. 47(5): 395-397.  [23954]
  • 97.  Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States        and southern Canada. New York: John Wiley & Sons. 501 p.  [2620]
  • 28.  Forde, Jon D.; Sloan, Norman F.; Shown, Douglas A. 1984. Grassland        Habitat management using prescribed burning in Wind Cave National Park,        South Dakota. Prairie Naturalist. 16(3): 97-110.  [938]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: parturition, polyestrous

Breeding season - Female American bison are seasonally polyestrous, with a cycle
of approximately 3 weeks' duration [2,11].  However, unseasonal estrus
and mating sometimes occur [2,11,51].  The breeding season for American bison
generally occurs between July and October [2,11,52].  However, it varies
in length depending on herd location.  The breeding season has been
observed to last from June 15 to September 30 at Hayden Valley,
Yellowstone National Park [51]; from mid-July to mid-August in other
areas of Yellowstone National Park [52]; and from June 1 to July 30 at
the Wichita Mountains Wildlife Refuge [35].

Age at sexual maturity - Sexual maturity most commonly occurs at 2 to 4
years of age.  However, some females breed as yearlings [11,53].  In
Wood Buffalo National Park, a small proportion of the yearling bulls,
approximately one-third of the 2-year-olds, and virtually all American bison 3
years of age and older were sexually mature [11].  Bulls attain sexual
maturity well in advance of becoming part of the active breeding
population [52].  In the Hayden Valley American bison herd, Yellowstone National
Park, bulls 8 years old and older were the most active sexually [51].

Gestation and calving season - The gestation period for American bison is 9 to
9.5 months [11,51,53].  In most regions, the calving season is generally
from mid-April to May with births concentrated from the end of April
through the first 2 weeks of May [53].  However, conception and,
therefore, parturition can occur at any time of year [11].  McHugh [51]
noted that a few calves were born from June through October in herds at
Yellowstone National Park, the Crow Reservation, Montana, the National
Bison Range, and Wind Caves National Park.

Number of young - Females generally give birth to one calf; twins are
rare [11,53].  American bison generally produce two calves every 3 years [11].

Development of young - Calves are able to stand and nurse within 30
minutes of birth.  They may try to graze by 5 days of age and will drink
water after the first week.  The cow nurses her calf for at least 7 to 8
months; most calves are weaned by the end of the first year [53].

Longevity - In the wild few American bison survive more than 20 years, although
there are records of cows surviving at least 40 years [53].  In wild
populations, by the time a American bison has reached age 15 it can be considered
old.  In captivity, lifespan increases [11].
  • 2.  Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University        of Toronto Press. 438 p.  [21084]
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 35.  Halloran, Arthur F.; Glass, Bryan P. 1959. The carnivores and ungulates        of the Wichita Mountains Wildlife Refuge, Oklahoma. Journal of        Mammalogy. 40(3): 360-370.  [24597]
  • 51.  McHugh, Tom. 1958. Social behavior of the American buffalo (Bison        bison). Zoologica. 43(1): 1-40.  [3981]
  • 52.  Meagher, Mary M. 1973. The bison of Yellowstone National Park.        Scientific Monograph Series 1. [Denver, CO]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Prefire Habitat

This study was located in a ponderosa pine (Pinus ponderosa) forest and
ponderosa pine-grassland ecotone.  The dominant species in the canopy
was ponderosa pine.  Common understory species included sedges (Carex
spp.), big bluestem (Andropogon gerardii var. gerardii), little bluestem
(Schizachyrium scoparium), Sandberg bluegrass (Poa secunda), sideoats
grama (Bouteloua curtipendula), blue grama (B. gracilis), hairy grama
(B. hirsuta), needlegrass (Stipa spp.), wheatgrass, leadplant (Amorpha
canescens), pulsatilla (Pulsatilla patens), Louisiana sagewort
(Artemisia ludoviciana), beautiful shootingstar (Dodecatheon
pulchellum), and western snowberry (Symphoricarpos occidentalis).
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Study Location

The study was located on a small knob in the northwest corner of Wind
Cave National Park, Custer County, South Dakota.
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Site Description

A detailed description of the site was not given.
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Season/Severity Classification

Fall/low-moderate
  • Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022; Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Lab, Missoula, MT. 58 p. [5].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The olfactory sense of bison is excellent and is essential in detecting danger. Bison can hear very well as well. Bison are able to distinguish large objects from a distance of 1 km and moving objects 2 km away. Bison can communicate vocally through grunts and snorts. It is likely that chemical cues are used in communicating reproductive states.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Primarily diurnal (especially early morning and late afternoon), with several grazing periods interspersed with loafing and ruminating (Meagher 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Bison live 15 to 20 years in the wild, although average lifespan depends on local predation and hunting pressures. Bison have been known to live up to 40 years in captivity.

Range lifespan

Status: captivity:
40 (high) years.

Typical lifespan

Status: wild:
15-20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.5 years (captivity) Observations: These animals have been estimated to live up to 25 years in the wild (Bernhard Grzimek 1990). Their maximum potential longevity has been estimated at 40 years (Ronald Nowak 1999), though this has not been verified. Record longevity in captivity belongs to one male that was still alive at 33.5 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Dominant bulls attempt to restrict access to a small group of females for mating. Individual bulls "tend" females until allowed to mate, following them around and chasing away rival males.

Mating System: polygynous

Females are sexually mature in two to three years and males reach maturity around age three. Bulls, however, do not usually breed until six years of age, when they have reached a size that makes them able to compete with other bulls for access to females. The breeding season begins in late June and lasts through September. Gestation is around 285 days, so the calving season is from mid-April through May. Any out of season births occur in the late summer.

Bison are born away from the herd in a location that has a lot of cover. Mothers protect the young from danger; males do not participate in this activity. One calf is born per season, weighing from 15 to 25 kg. Male calves are born slightly more frequently than females. Young calves are red in color. They begin turning brown in two and a half months and are entirely brown in four months. Calves are nursed for seven to eight months and are fully weaned by the end of the first year. Females are seasonally polyestrous with a cycle of approximately three weeks. Estrus may last anywhere from 9 to 28 hours (Meagher, 1986).

Breeding interval: Bison breed once yearly.

Breeding season: Breeding occurs from late June through September.

Average number of offspring: 1.

Average gestation period: 285 days.

Range weaning age: 7 to 12 months.

Average time to independence: 1 years.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 20000 g.

Average gestation period: 274 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Female bison nurse, protect, and care for their young for up to one year. Males do not participate in caring for their young. Calves are capable of walking and running within a few hours of being born.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most cows breed at 2-4 years; males usually mature at 3 years, but most breeding done by older (6+ years) males. Most mating July-August. Gestation lasts about 9.5 months. Normally 1 calf, is born mainly mid-April to early June (as early as March in Oklahoma, sometimes as late as summer or early fall in South Dakota). Most calves are weaned by late fall or end of first year, remain with mother until spring or later if she does not conceive. Life span 18-22 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bison bison

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGACTATTCTCAACCAACCATAAAGACATCGGTACCCTTTATCTACTATTTGGAGCCTGGGCCGGTATAGTAGGAACAGCTCTAAGCCTTCTAATTCGCGCTGAATTAGGCCAACCCGGAACCCTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGAGGATTCGGTAACTGACTTGTTCCTCTAATAATTGGCGCTCCCGACATGGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCATTTCTACTACTCCTCGCATCCTCTATAGTTGAAGCTGGAGCAGGAACAGGCTGAACCGTGTACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTAACCATCTTCTCCTTACACTTGGCAGGAGTTTCCTCTATTTTAGGAGCCATCAACTTCATCACAACAATTATCAACATAAAGCCCCCCGCAATGTCACAGTACCAAACCCCTCTCTTCGTATGATCCGTAATAATTACCGCCGTACTATTACTCCTCTCACTTCCTGTGCTAGCAGCCGGTATTACAATGCTGCTAACAGATCGGAACCTAAATACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCCATCTTATACCAACACTTATTCTGATTCTTTGGGCACCCCGAAGTCTACATTTTAATTTTACCTGGATTTGGAATAATCTCCCATATTGTAACCTACTACTCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTCTGAGCTATAATGTCAATCGGATTTTTAGGTTTCATCGTATGAGCTCACCATATATTCACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATTCCAACAGGAGTAAAAGTTTTCAGCTGACTGGCGACACTTCATGGAGGTAATATCAAATGGTCTCCTGCTATAATGTGAGCCCTAGGCTTTATTTTCTTATTTACAGTAGGGGGTTTAACTGGAATTGTCCTAGCTAACTCTTCTCTCGATATTGTTCTTCACGACACATACTACGTTGTCGCACACTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTTCATTGATTCCCACTATTCTCAGGTTATACTCTCAACGATACATGAGCCAAAATCCACTTCGCAATTATGTTTGTAGGCGTCAATATGACCTTCTTCCCACAACACTTTCTAGGACTATCTGGCATGCCTCGACGATACTCCGACTACCCAGATGCATATACAATATGAAATACTGTCTCATCTATGGGCTCATTCATTTCTCTAACAGCAGTCATGCTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTAACTGTAGACCTAACCACGACAAATCTAGAATGATTAAACGGATGCCCTCCACCATATCACACATTTGAAGAACCCACCTATGTCAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bison bison

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Bison are listed under CITES - Appendix I, and the sub species B. b. athabascae is listed as endangered by the U.S. Endangered Species Act (Honacki, 1982).

The pre-Columbian population of bison in North America was estimated to be around 60 million. By 1890 the number was reduced to less than 1000. The destruction of the herds was in part a result of a political and economic act. The United States government had the bison killed en masse to destroy the livelihood of Plains Indians (VanGelder, 1982).

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gates, C. & Aune, K.

Reviewer/s
Gates, C. (Bison Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Near Threatened in light of its dependence on an ongoing conservation programme, a very limited number of viable populations (five), and small populations. The North America bison population underwent a drastic decline in 19th century caused by over hunting but has since partially recovered. There has been a modest increases in the number of conservation herds and individuals in populations managed for species conservation and ecological restoration, however, all mature individuals occur within active management programs which is ceased would result in the species qualifying for a threatened status. About 97% of the continental population is managed for private captive commercial propagation; very few of these herds are managed primarily for species conservation and none is managed in the public interest for conservation. Herds managed for conservation purposes in the public interest are typically small (< 400), and populations are widely dispersed with few geographic situations that provide conditions for natural movements between subpopulations. The total number of mature individuals in wild free-ranging and semi-free-ranging populations is estimated to be approximately 11,250 and only 5 subpopulations have more than 1,000 individuals, thus making this species nearly qualify for Vulnerable C2a(i). The species is not currently in decline but wild mature individuals could be greatly reduced if current management regimes are changed. This is a conservation dependant species.

The species is most limited in Mexico, where only one herd occurs in the wild; it is subject to adverse policies when individuals move across the international border into the United States where they are classified as livestock. The current number of ecologically restored large populations managed primarily for conservation (populations exceeding 1,000 and managed in the presence of most natural limiting factors) is small. Creation of opportunities for a few additional, large-scale ecological restoration projects is dependent on cooperation between government agencies and non-government organizations. Future progress in conservation and recovery of the North American bison will depend on significant changes in its legal status and management as wildlife by federal and state/provincial agencies, harmonization of policies and activities among agencies at multiple levels, and cooperation with environmental organizations. Cooperation and coordination are particularly important where different agencies or organizations have separate management jurisdiction for adjacent land areas within an ecosystem unit in which ecological restoration of bison is possible.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Occurs as wild, free-ranging populations in only small fragments of the once vast range in North America, but the species is secure globally due to the many managed populations on public and private lands.

Other Considerations: There are many privately owned non-free-ranging bison herds. Bovine (BOS TAURUS) genes have apparently entered the Custer State Park herd, probably in the last century; however, that herd also possesses a unique bison haplotype not found elsewhere (Polziehn et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: natural

In Canada, wood bison are federally listed as endangered in Alberta,
British Columbia, Northwest Territories, and Yukon Territory [98]. The
Nature Conservancy lists them as critically imperiled in British
Columbia [77]. They are also listed in the Red Data Book by the
International Union for the Conservation of Nature and Natural Resources
(IUCN) and are thereby recognized world-wide as endangered. Wood bison
are classified as an Appendix I animal in the Conservation on
International Trade in Endangered Species of Wild Flora and Fauna
(CITES), which provides regulated protection from international trade
[63]. American bison are protected in Idaho [59].
  • 59.  Moseley, Robert; Groves, Craig, compilers. 1990. Rare, threatened and        endangered plants and animals of Idaho. Boise, ID: Idaho Department of        Fish and Game, Nongame and Endangered Wildlife Program, Natural Heritage        Section. 33 p.  [19328]
  • 63.  Reynolds, Hal W. 1986. The Canadian Wildlife Service program to restore        wood bison. In: Workshop on endangered species in the Prairie Provinces;        [Date unknown]
  • 77.  The Network of Natural Heritage Programs and Conservation Data Centers        and The Nature Conservancy. 1994. Element distribution - North America,        vertebrates. Arlington, VA: The Nature Conservancy, Central Conservation        Databases. 31 p.  [23374]
  • 98.  Committee on the Status of Endangered Wildlife in Canada. 1992. Canadian        species at risk. Ottawa, ON. 10 p.  [26183]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Wood bison are listed as Endangered [80].
  • 80.  U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are approximately 19,000 total plains bison in 54 conservation herds (herds managed in the public interest by governments and environmental organizations), and 11,000 total wood bison in 11 conservation herds. The proportion of mature individuals is difficult to calculate as even wild herd are often intentionally managed with skewed sex ratios. An optimistic estimate of the total number mature individuals for both subspecies (breeding adults including subadult males) is 23,000 (75% of total), while a more realistic estimate (breeding females and mature males only) is 21,000 (70% of total). Populations are considered viable in the long term if they exceed 1000 individuals. There are 5 plains bison conservation herds and 3 wood bison conservation herds each exceeding 1000 - therefore the total number of viable populations is only 8.

Six wild (free-ranging, not confined primarily by fencing) herds of plains bison occur in the natural range of this subspecies: two in Canada, three in the United States and one in Mexico. There are ten wild populations of wood bison within the natural range of the sub-species; all are in Canada. Wood bison are extirpated in the wild in Alaska, a natural range state. There are approximately 500,000 bison in captive commercial populations (mostly plains bison) on about 4000 privately owned ranches.

Under the IUCN Red List Guidelines, commercial herds are not eligible for consideration in determining a Red List designation therefore we have calculated the total population of bison in conservation herds to be approximately 30,000 individuals and the mature population to be approximately 20,000 individuals. Of the total number presented only 15,000 total individuals are considered wild bison in the natural range within North America (free-ranging, not confined primarily by fencing). Of the wild populations, only 11,250 (75% see above) are mature individuals using the most conservative estimate.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In the 19th Century, market, subsistence and recreational hunting nearly eliminated the bison throughout its range in North America. Conservation measures have brought about limited recovery in the wild and in captive conservation herds. Private commercial production of bison has resulted in significant numerical recovery, but does not provide for conservation of the bison as wildlife in the sense used for Red List designation. Existing threats include: habitat loss; genetic manipulation of commercial bison for market traits; small population effects in most conservation herds; few herds are exposed to a full range of natural limiting factors; cattle gene introgression; loss of genetic non-exchangeability through hybridization between bison subspecies; and the threat of depopulation as a management response to infection of some wild populations hosting reportable cattle diseases. Canada, the United States and Mexico list bison nationally as both wildlife and domestic livestock. Legal status varies among State and Provincial jurisdictions. In Canada, four provinces and two territories list bison as both wildlife and livestock. Bison are listed by 20 states in the United Sates; 10 states list bison as wildlife and all 20 list them as livestock. An additional threat to populations of this species is culling to prevent the spread of bovine tuberculosis and brucellosis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Susceptible to livestock diseases, though these do not pose a major threat to bison populations. "Control" by agencies may be detrimental to relatively free-ranging herds, such as in Yellowstone National Park.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
A recovery program for wood bison has existed in Canada since the early 1960s where the subspecies was designated as 'Threatened' by the Committee on Endangered Species of Wildlife in Canada (COSEWIC). In May 2004 COSEWIC assessed the status of plains bison and recommended listing them as 'Threatened' in Canada. National Refuges and Parks and State parks play an important role in maintaining conservation herds in Canada and the United States. Wild free-ranging herds are managed by government agencies. The Nature Conservancy manages 8 captive herds and the American Prairie Foundation (World Wildlife Fund) manages one herd primarily for conservation objectives. Restoration of large populations of plains bison are being planned in southern Colorado and northern Montana. The State of Alaska is at an advanced stage in planning to reintroduce wood bison to the wild. There are no coordinated federal initiatives for plains bison conservation in any nation in North American, although there is some discussion of a coordinated strategy by the US Department of the Interior at the time of writing (January 2007).

The Bison Specialist Group (North America) is developing a bison conservation assessment and action plan that will provide support and guidance for policy development and conservation planning and management for public and private sector projects, including: numeric, geographic and genetic status of North American bison, including public and private herds; a review of legislation and policies of individual range states regarding bison conservation; geographic assessment of priority conservation areas in North America (Wildlife Conservation Society lead); enhancing the capacity of members of the Bison Specialist Group and organizations they represent to provide timely, innovative and practical solutions to conservation challenges; guidelines for management in support of species’ conservation and ecological restoration.

There are potential opportunities for ecological restoration of herds managed primarily for conservation on federal, state, provincial lands in some jurisdictions (Sanderson et al. 2008). There may be opportunities for establishing herds on Native-owned lands that are managed for combined conservation and socio-economic purposes. However, there are significant challenges in integrating western science-based conservation into such community-based initiatives.

Bison bison athabascae is listed in CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: See Meagher (1989) for information on management of Yellowstone bison that leave the park (public hunting outside the park regarded as most feasible management option); management there remains controversial; ranchers fear spread of brucellosis from bison to cattle. (Brucellosis is a coccobacillus that causes a high rate of abortion during the first pregnancy following infection.) See Peterson et al. (1991) for a simulation of alternative bison-brucellosis management strategies for Grand Teton National Park; simulations predict that, after 20 years under any of the proposed management schemes, the proportion of the herd seropositive for BRUCELLA could be reduced from 69% (current level) to, at best, 20%.

See Geist (1990) for vigorous criticism of plan by Agriculture Canada to kill some 3200 so-called "hybrid" bison in Wood Buffalo National Park and replace them with "wood bison," the latter regarded as genetically impoverished and taxonomically insignificant.

Biological Research Needs: Genetics of populations, taxonomic studies of 2 subspecies, comparisons between populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Occurs in several parks and preserves in Canada and the U.S.

Needs: Maintain existing EOs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: prescribed fire, shrubs

Prescribed fire has been used to manage free-roaming American bison herds
[6,18,46,70].  Strategic placement of burns should integrate knowledge
of American bison Foraging behavior and preferences, American bison travel routes, and
distributions of mineral licks and water [6,18].  Using prescribed fire
to improve grasses and sedges may reduce the need for expensive
supplemental feeding of American bison in some areas [68].
 
Prescribed fire is effective in mitigating American bison impacts on black-tailed
prairie dog colonies.  American bison use of a black-tailed prairie dog colony
was compared before and after a prescribed fire on adjacent, uncolonized
grassland at Wind Cave National Park, in 1979 and 1980.  Cow-calf herds
increased their use (measured as hours of feeding time) of the burned
grassland by a factor of 12 and decreased their use of the colony by 30
to 63 percent following the burn.  Bulls were less attracted to the
burned site than cow-calf herds.  To decrease American bison impacts on
black-tailed prairie dog colonies, burns should be located a
"considerable" distance from colonies [18].

FIRE CASE STUDIES
SPECIES: Bos bison
FIRE CASE STUDY CITATION :
Tesky, Julie L., compiler. 1995. Bos bison. Improving bison forage with fall
prescribed fire in Wind Cave National Park, South Dakota

FIRE CASE STUDY REFERENCE:
Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation
and wildlife in ponderosa pine forests of the southern Black Hills.
Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022;
Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department
of Agriculture, Forest Service, Intermountain Research Station, Fire
Sciences Lab, Missoula, MT. 58 p. [5].

SEASON/SEVERITY CLASSIFICATION :
Fall/low-moderate

STUDY LOCATION :
The study was located on a small knob in the northwest corner of Wind
Cave National Park, Custer County, South Dakota.

PREFIRE HABITAT :
This study was located in a ponderosa pine (Pinus ponderosa) forest and
ponderosa pine-grassland ecotone.  The dominant species in the canopy
was ponderosa pine.  Common understory species included sedges (Carex
spp.), big bluestem (Andropogon gerardii var. gerardii), little bluestem
(Schizachyrium scoparium), Sandberg bluegrass (Poa secunda), sideoats
grama (Bouteloua curtipendula), blue grama (B. gracilis), hairy grama
(B. hirsuta), needlegrass (Stipa spp.), wheatgrass, leadplant (Amorpha
canescens), pulsatilla (Pulsatilla patens), Louisiana sagewort
(Artemisia ludoviciana), beautiful shootingstar (Dodecatheon
pulchellum), and western snowberry (Symphoricarpos occidentalis).

SITE DESCRIPTION :
A detailed description of the site was not given.

FIRE DESCRIPTION :
Conditions for the prescribed fire (the "Cone Burn") were met at midday
17 October 1979, when the wind was about 10 miles per hour (16 km/h),
temperature was 58 degrees Fahrenheit (14.4 deg C), and relative humidity
was 45 percent.  The fire passed over a 156-acre (63 ha) area in about 4
hours.  A few standing dead snags on the north and west faces of the
area were still burning at midmorning the following day, when they were
extinguished by a rain shower.  Fire varied from discontinuous,
low-severity (leaving some patches unburned) to crowning behavior.
Combustion of surface fuels was nearly complete, except in unburned
patches.

FIRE EFFECTS ON ANIMAL SPECIES AND HABITAT :
Effect on vegetation - Vegetation was measured 1 year before the fire
and for 2 years after (May-June of 1980 and 1981) the fire.  Plants that
increased as a result of the fire included sedges, needlegrasses, and
beautiful shootingstar; bare ground also increased.  Plants reduced by
the fire included bluegrasses (Poa spp.), little bluestem (1980 only),
ponderosa pine (both canopy and immature trees), and shrubs (1980 only).
The fire caused only a modest decline in overall similarity between
experimental and control vegetation plots, and this decline persisted
through two postfire growing seasons.

Effect on American bison - American bison preferred feeding on burned
sites during the first postfire growing season.  Before the fire, American
bison cow-calf herds preferred the control areas.  After burning, they were
attracted to the recently burned area for feeding.  However, this grazing
preference disappeared in the second postfire year.  Before the fire, bulls
preferred the control site.  During the first postfire year the bulls
used both sites, while in the following year, they showed a preference
for the unburned site.  Small bull groups tended to defer in habitat use
to cow-calf herds.

FIRE MANAGEMENT IMPLICATIONS :
This study showed that prescribed fires can be used in ponderosa
pine-grassland ecotones of the Black Hills to temporarily improve forage
for American bison.
  • 5.  Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation        and wildlife in ponderosa pine forests of the southern Black Hills.        Final Report. Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022;        Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department        of Agriculture, Forest Service, Intermountain Research Station, Fire        Sciences Lab, Missoula, MT. 58 p.  [479]
  • 6.  Bone, Steven D.; Klukas, Richard W. 1990. Prescribed fire in Wind Cave        National Park. In: Alexander, M. E.; Bisgrove, G. F., technical        coordinators. The art and science of fire management: Proceedings, 1st        Interior West Fire Council annual meeting and workshop; 1988 October        24-27; Kananaskis Village, AB. Inf. Rep. NOR-X-309. Edmonton, AB:        Forestry Canada, Northwest Region, Northern Forestry Centre: 297-302.        [14145]
  • 18.  Coppock, D. Layne; Detling, James K. 1986. Alteration of bison and        black-tailed prairie dog grazing interaction by prescribed burning.        Journal of Wildlife Management. 50(3): 452-455.  [689]
  • 46.  Larson, Lorence; Murdock, G. K. 1989. Small bison herd utilization of        tallgrass prairie. In: Bragg, Thomas B.; Stubbendieck, James, eds.        Prairie pioneers: ecology, history and culture: Proceedings, 11th North        American prairie conference; 1988 August 7-11; Lincoln, NE. Lincoln, NE:        University of Nebraska: 243-245.  [14055]
  • 68.  Samoil, J. 1992. Fire on the range: burning for bison habitat.        Timberlines. 1: 4.  [18185]
  • 70.  Shaw, James H.; Carter, Tracy S. 1990. Bison movements in relation to        fire and seasonality. Wildlife Society Bulletin. 18(4): 426-430.        [14777]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, succession

American bison are attracted to grassland sites altered by black-tailed prairie
dog (Cynomys ludovicianus).  American bison often feed selectively near the
perimeters of colonies.  These areas are constantly clipped by
black-tailed prairie dog and, therefore, have more readily digestible
perennial grasses, with higher nitrogen concentration and greater
accessibility of green tissues, than vegetation from uncolonized areas.
Consequently, black-tailed prairie dog colonies may receive a
disproportionately high amount of American bison use.  Prolonged grazing pressure
on colonies may result in changes in plant composition [18,19,12,87].
On a mixed-grass prairie, selective use of black-tailed prairie dog
colonies by American bison resulted in considerably more biomass removed than by
prairie dog activity alone.  Additionally, selective use of plant
species (i.e., grasses) by American bison may contribute to an increase in
forb:graminoid ratios [95].

The thick hair on the head and forequarters of American bison is ideally suited
for dispersal of awned, barbed, or sticky seed-bearing structures.  For
example, the seeds of buffalo grass, cocklebur (Xanthium perforatum), and
St. Johnswort (Hypericum perforatum) readily adhere to American bison
hair.  The dissemination of the latter throughout the National Bison
Range is thought to have been accomplished by American bison [51].  American bison also
aid in dispersal by ingesting seeds.  Samples from four buffalo chips at
Wichita Mountains Wildlife Refuge contained 219 seeds that germinated.
Of these, 195 (89%) were monocots, mostly Japanese brome (Bromus
japonicus).  American bison may accelerate seed dispersal to burned sites because
American bison are attracted to recently burned areas [17].

Localized stands of timber may be considerably affected by American bison horning
and thrashing during the rut and at other times.  McHugh [51] estimated
that 51 percent of lodgepole pine in some areas of Yellowstone National
Park has been horned by American bison.  Such activity may inhibit succession of
grassland to forest [11].

Where American bison trails or wallows (concave disturbances formed as American bison paw
the ground and roll in the exposed soil) are cut into steep hillsides,
considerable water and wind erosion can occur.  Hillside trails can
serve as drainage channels, effectively lowering the water table in
upland areas and causing a change in the vegetation.  Where trails cut
near the top of steep, sandy hills, erosion and slippage may produce
barren areas.  However, by creating trails through different habitats,
American bison help provide access corridors for many species of mammals,
including humans [11].

American bison wallows can serve as water catchments on flat terrain.  In
Oklahoma American bison wallows have been observed to hold water for prolonged
periods during the spring rainy season.  Such small ponds become
available to both vertebrates and invertebrates.  These water-holding
wallows may also enhance growth of specific vegetation such as ruderal
species and species adapted to wet habitats [11,81].  On the Wichita
Mountains Wildlife Refuge, ruderal species such as Japanese brome and
false-pennyroyal (Hedeoma hispida) had highest cover values within American bison
wallows.  Other common taxa within the wallows were Torrey rush (Juncus
torreyi), purple ammania (Ammannia coccinea), lythrum (Lythrum spp.),
and taperleaf flatsedge (Cyperus acuminatus), all of which are species
adapted to wet habitats [17].

Diseases - Anthrax (an infectious disease caused by the bacteria
Bacillus anthracis) outbreaks cause sporadic mortality in northern American bison
herds.  In Wood Buffalo National Park, 50 percent of American bison may be
infected by tuberculosis, a chronic infectious disease [53].
Tuberculosis in a herd of American bison for more than 26 years did not appear to
interfere with herd productivity.  However, the importance of
tuberculosis as a mortality factor is difficult to determine for large
American bison herds [11].  Brucellosis is an infectious disease caused by the
bacteria Brucella abortus.  Abortion caused by brucellosis has been
reported in American bison.  It is assumed that infected American bison shed brucella
organisms, thereby contaminating feed and water.  Dissemination of the
disease is enhanced due to the gregarious nature of American bison [11].  The
role of brucellosis and its affect on reproductive activity in American bison is
difficult to determine due to the lack of data on the incidence of
abortion in American bison [11,52].
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 12.  Cid, M. Silvia; Detling, James K.; Whicker, April D.; Brizuela, Miguel        A. 1991. Vegetation responses of a mixed-grass prairie site following        exclusion of prairie dogs and bison. Journal of Range Management. 44(2):        100-104.  [14133]
  • 17.  Collins, Scott L.; Uno, Gordon E. 1985. Seed predation, seed dispersal,        and disturbance in grasslands: a comment. American Naturalist. 125(6):        866-872.  [665]
  • 18.  Coppock, D. Layne; Detling, James K. 1986. Alteration of bison and        black-tailed prairie dog grazing interaction by prescribed burning.        Journal of Wildlife Management. 50(3): 452-455.  [689]
  • 19.  Coppock, D. L.; Ellis, J. E.; Detling, J. K.; Dyer, M. I. 1983.        Plant-herbivore interactions in a North American mixed-grass prairie.        II. Responses of bison to modification of vegetation by prairie dogs.        Oecologia. 56: 10-15.  [688]
  • 51.  McHugh, Tom. 1958. Social behavior of the American buffalo (Bison        bison). Zoologica. 43(1): 1-40.  [3981]
  • 52.  Meagher, Mary M. 1973. The bison of Yellowstone National Park.        Scientific Monograph Series 1. [Denver, CO]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 81.  Uno, Gordon E. 1987. Buffalo wallows: ephemeral pools in the Great        Plains. In: American Journal of Botany. 74(5): 663. [Abstract]
  • 87.  Vinton, Mary Ann; Harnett, David C.; Finck, Elmer J.; Briggs, John M.        1993. Interactive effects of fire, bison (Bison bison) grazing and plant        community composition in tallgrass prairie. American Midland Naturalist.        129: 10-18.  [20182]
  • 95.  Koehler, John T. 1992. Prescribed burning: a wildfire prevention tool?.        Fire Management Notes. 53-54(4): 9-13.  [24598]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bison can carry and transmit diseases that also infect domestic cattle, such as Brucellosis. However, authorities argue whether transmission of such diseases between bison and cattle is likely in field settings.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bison were once a major source of meat and hides in the United States. They formed the basis of the economy of a number of groups of Native Americans. Paths made by the bison through the mountains were used by highway crews when they mapped routes for highways in the west (VanGelder, 1982). Today, bison are found in many zoos throughout the world (Meagher, 1986). Bison and hybrid cattle/bison are raised as a source of meat. Bison also attract many people to national parks in the west.

Bison are important members of functioning prairie ecosystems.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Has been crossbred with domestic cattle to produce animal ("beefalo") that yields meat at lower cost (Mason 1975). Of medical interest because of apparent nonsusceptibility to cancer (Myers 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American bison

The American bison (Bison bison), also commonly known as the American buffalo, is a North American species of bison that once roamed the grasslands of North America in massive herds, became nearly extinct by a combination of commercial hunting and slaughter in the 19th century and introduction of bovine diseases from domestic cattle, and has made a recent resurgence largely restricted to a few national parks and reserves. Their historical range roughly comprised a triangle between the Great Bear Lake in Canada's far northwest, south to the Mexican states of Durango and Nuevo León, and east to the Atlantic Seaboard of the United States (nearly to the Atlantic tidewater in some areas) from New York to Georgia and per some sources down to Florida, also in North Carolina where bison were seen near Buffalo Ford on the Catawba River as late as 1750.[2][3][4]

Two subspecies or ecotypes have been described: the plains bison (Bison bison bison), smaller in size and with a more rounded hump, and the wood bison (Bison bison athabascae)—the larger of the two and having a taller, square hump.[5][6][7][8][9][10] Furthermore, it has been suggested that the plains bison consists of a northern (Bison bison montanae) and a southern subspecies, bringing the total to three.[8] However, this is generally not supported. The wood bison is one of the largest wild species of bovid in the world, surpassed by only the Asian gaur and wild water buffalo. It is the largest extant land animal in the Americas.

Description[edit]

Adult male (farthest) and adult female (closest) with a background of rich autumn colours, in Yellowstone National Park

A bison has a shaggy, long, dark brown winter coat, and a lighter weight, lighter brown summer coat. As is typical in ungulates, the male bison are slightly larger than the female and, in some cases, can be considerably heavier. Plains bison are often in the smaller range of sizes, and Wood bison in the larger range. Head-and-body length ranges from 2 to 3.5 m (6.6 to 11.5 ft) long, the tail adding 30 to 91 cm (12 to 36 in). Shoulder height in the species can range from 152 to 186 cm (60 to 73 in). Weight can range from 318 to 907 kg (701 to 2,000 lb)[11] The heaviest wild bull ever recorded weighed 1,270 kg (2,800 lb).[12] When raised in captivity and farmed for meat, the bison can grow unnaturally heavy and the largest semi-domestic bison weighed 1,724 kg (3,801 lb).[11] The heads and forequarters are massive, and both sexes have short, curved horns that can grow up to 2 feet (61 cm) long, which they use in fighting for status within the herd and for defense.

Calf

Bison are herbivores, grazing on the grasses and sedges of the North American prairies. Their daily schedule involves two-hour periods of grazing, resting and cud chewing, then moving to a new location to graze again. Bison mate in August and September; gestation is 285 days. A single reddish-brown calf nurses until the next calf is born. If the cow is not pregnant, a calf will nurse for 18 months. At three years of age, bison cows are mature enough to produce a calf. Bison bulls of that age may try to mate with cows, but if more mature bulls are present, they may not be able to compete until they reach five years of age. Bison have a life expectancy of approximately 15 years in the wild and up to 25 years in captivity.

For the first two months of life, calves are lighter in color than mature bison. One very rare condition is the white buffalo, in which the calf turns entirely white. White bison are considered sacred by many Native Americans.

Name[edit]

The term "buffalo" is sometimes considered to be a misnomer for this animal, and could be confused with two "true buffalo", the Asian water buffalo and the African buffalo. However, "bison" is a Greek word meaning ox-like animal, while "buffalo" originated with the French fur trappers who called these massive beasts bœufs, meaning ox or bullock—so both names, "bison" and "buffalo", have a similar meaning. The name "buffalo" is listed in many dictionaries as an acceptable name for American buffalo or bison. In reference to this animal, the term "buffalo", dates to 1625 in North American usage when the term was first recorded for the American mammal.[13] It thus has a much longer history than the term "bison", which was first recorded in 1774.[citation needed] The American bison is very closely related to the wisent or European bison.

Skulls of European bison (left) and American bison (right)

Differences from European bison[edit]

Although they are superficially similar, the American and European bison exhibit a number of physical and behavioral differences. Adult American bison are slightly heavier on average due to their less rangy build, and have shorter legs, which render them slightly shorter at the shoulder.[14] American bison tend to graze more, and browse less than their European cousins, due to their necks being set differently. Compared to the nose of the American bison, that of the European species is set farther forward than the forehead when the neck is in a neutral position. The body of the American bison is hairier, though its tail has less hair than that of the European bison. The horns of the European bison point forward through the plane of its face, making it more adept at fighting through the interlocking of horns in the same manner as domestic cattle, unlike the American bison which favors charging.[15] American bison are more easily tamed than their European cousins, and breed more readily with domestic cattle.[16]

Evolution[edit]

The bovine family (taurids and bisonids) diverged from the common ancestral line with water buffalo and African buffalo about 5 to 10 million years ago.[17] Thereafter, the family lineage of bison and taurine cattle does not appear to be a straight forward "tree" structure as is often depicted in much evolution, because there is evidence of interbreeding and crossbreeding between different species and members within this family, even many millions of years after their ancestors separated into different species. This cross breeding was not sufficient to conflate the different species back together, but it has resulted in unexpected relationships between many members of this group, such as Yak being related to American bison, when such relationships would otherwise not be apparent.

A 2003 study of mitochondrial DNA indicated four distinct maternal lineages in tribe Bovini:

  1. Taurine cattle and zebu,
  2. Wisent (European bison),
  3. American bison and yak,[18] and
  4. Banteng, gaur, and gayal.

However, Y chromosome analysis associated wisent and American bison.[19] An earlier study using amplified fragment length polymorphism (AFLP) fingerprinting showed a close association of wisent and American bison and probably with yak, but noted that the interbreeding of Bovini species made determining relationships problematic.[20] It is shown, however, the wisent may have emerged by species divergence initiated by the introgression of bison bulls in a separate ancestral species.[21]

"Last of the Canadian Bisons", 1902, photograph: Steele and Company

The steppe bison (Bison priscus) diverged from the lineage that led to cattle (Bos taurus) approximately 2 to 5 million years ago. The bison genus is clearly in the fossil record by 2 million years ago.[22] The steppe bison spread across Eurasia and was the bison that was pictured in the ancient cave paintings of Spain and Southern France

The European bison or wisent arose from the steppe bison, without fossil evidence of other ancestral species between the steppe bison and the European bison, though the European bison might have arisen from the lineage that led to American bison if that lineage backcrossed with the steppe bison. Again, the web of relationships is confusing, but there is some evidence that the European bison is descended from bison that had migrated from Asia to North America, and then back to Europe, where they crossbred with existing steppe bison.[22]

At one point, some steppe bison cross bred with the ancestors of the modern yak. After that cross breeding, a population of steppe bison (Bison priscus) crossed the Bering Land Bridge to North America. There is evidence of multiple crossings of bison to and from Asia starting before 500,000 years ago and continuing until at least 220,000 years ago. The steppe bison spread through the northern parts of North America and steppe bison lived in Eurasia until approximately 11,000 years ago[23] and North America until 4,000 to 8,000 years ago.[22]

Bison latifrons (giant bison or longhorn bison) is thought to have evolved in midcontinent North America from Bison priscus, after the steppe bison crossed into North America.[24][25][26] Giant bison (Bison latifrons) appeared in the fossil record approximately 500,000 years ago.[22] B. latifrons was one of many species of North American megafauna which became extinct during the Quaternary extinction event. It is thought to have disappeared some 21,000–30,000 years ago, during the late Wisconsin glaciation.[27]

The Bison latifrons (giant bison or longhorn bison) species was replaced by the smaller Bison antiquus. Bison antiquus appeared in the North American fossil record approximately 250,000 years ago.[28] Bison antiquus in turn evolved into the Bison occidentalis, then into the yet smaller Bison bison—the modern American bison—some 5,000 to 10,000 years ago.[29][30] Some researchers consider Bison occidentalis to be a sub-species of Bison antiquus.[31]

Pile of American bison skulls to be used for fertilizer in the mid-1870s

During the population bottleneck, after the great slaughter of American bison during the 1800s, the number of bison remaining alive in North America declined to as low as 541. During that period, a handful of ranchers gathered remnants of the existing herds to save the species from extinction. These ranchers bred some of the bison with cattle in an effort to produce "cattleo".[32] Accidental crossings were also known to occur. Generally, male domestic bulls were crossed with buffalo cows, producing offspring of which only the females were fertile. The crossbred animals did not demonstrate any form of hybrid vigor, so the practice was abandoned. The proportion of cattle DNA that has been measured in introgressed individuals and bison herds today is typically quite low, ranging from 0.56 to 1.8%.[32][33] In the United States, many ranchers are now utilizing DNA testing to cull the residual cattle genetics from their bison herds. The U.S. National Bison Association has adopted a code of ethics which prohibits its members from deliberately crossbreeding bison with any other species.

Range and population[edit]

Despite being the closest relatives of domestic cattle native to North America, bison were never domesticated by native Americans. Later attempts of domestication by Europeans prior to the 20th century met with limited success. Bison were described as having a "wild and ungovernable temper";[34] they can jump 6 feet (1.8 m) vertically,[35] and run 35-40 mph (56–64 km/h) when agitated. This agility and speed, combined with their great size and weight, makes bison herds difficult to confine as they can easily escape or destroy most fencing systems, including most razor wire.

Approximately 500,000 bison currently exist on non-public lands and approximately 30,000 on public lands which includes environmental and government preserves.[36] According to the IUCN, approximately 15,000 bison are considered wild, free-range bison not primarily confined by fencing.[37]

Habitat[edit]

Bison herd grazing at the National Bison Range in Montana

American bison live in river valleys, and on prairies and plains. Typical habitat is open or semi-open grasslands, as well as sagebrush, semi-arid lands and scrublands. Some lightly wooded areas are also known historically to have supported bison. Bison will also graze in hilly or mountainous areas where the slopes are not steep. Though not particularly known as high altitude animals, bison in the Yellowstone Park bison herd are frequently found at elevations above 8,000 feet and the Henry Mountains bison herd is found on the plains around the Henry Mountains, Utah, as well as in mountain valleys of the Henry Mountains to an altitude of 10,000 feet.

As livestock[edit]

Bison are increasingly raised for meat and hides; the majority of American bison in the world are raised for human consumption. Bison meat is generally considered to taste very similar to good beef, but is lower in fat and cholesterol, yet higher in protein than beef,[38] a fact which has led to the development of beefalo, a fertile hybrid of bison and domestic cattle. In 2005, about 35,000 bison were processed for meat in the U.S., with the National Bison Association and USDA providing a "Certified American Buffalo" program with birth-to-consumer tracking of bison via RFID ear tags. There is even a market for kosher bison meat; these bison are slaughtered at one of the few kosher mammal slaughterhouses in the U.S., and the meat is then distributed nationwide.

Bison meat for sale

Bison are found in publicly and privately held herds. Custer State Park in South Dakota is home to 1,500 bison, one of the largest publicly held herds in the world, but there are questions[vague] about the genetic purity of the animals. Wildlife officials[who?] believe that free roaming and genetically pure herds on public lands in North America can be found only in Yellowstone National Park and the Yellowstone Park bison herd,[39] the Henry Mountains bison herd at the Book Cliffs and Henry Mountains in Utah, at Wind Cave National Park in South Dakota, Fort Peck Indian Reservation in Montana, Mackenzie Bison Sanctuary in the Northwest Territories, Elk Island National Park and Wood Buffalo National Park in Alberta, and Prince Albert National Park in Saskatchewan. Another population, the Antelope Island bison herd on Antelope Island in Utah, consisting of 550 to 700 bison, is also one of the largest and oldest public herds in the United States, but the bison in that herd are considered to be only semi-free roaming, since they are confined to the Antelope Island. In addition, recent genetic studies indicate that, like most bison herds, the Antelope Island bison herd has a small number of hybrid genes from domestic cattle. In 2002 the United States government donated some buffalo calves from South Dakota and Colorado to the Mexican government. Their descendants live in the Mexican nature reserves El Uno Ranch at Janos and Santa Elena Canyon, Chihuahua, and Boquillas del Carmen, Coahuila, located near the southern banks of the Rio Grande and the grassland borderline with Texas and New Mexico.

Recent genetic studies of privately owned herds of bison show that many of them include animals with genes from domestic cattle.[39] For example, the herd on Santa Catalina Island, California, isolated since 1924 after being brought there for a movie shoot, were found to have cattle introgression.[40] It is estimated that there are as few as 12,000 to 15,000 pure bison in the world. The numbers are uncertain because the tests used to date—mitochondrial DNA analysis—indicate only if the maternal line (back from mother to mother) ever included domesticated bovines and thus say nothing about possible male input in the process. It was found that most hybrids look exactly like purebred bison; therefore, appearance is not a good indicator of genetics.

The size of the Canadian domesticated herd (genetic questions aside) grew dramatically through the 1990s and 2000s. The 2006 Census of Agriculture reported the Canadian herd at 2006 195,728 head, 34.9% increase since 2001.[41] Of this total, over 95% was located in Western Canada, and less than 5% in Eastern Canada. Specifically Alberta was the province with the largest herd, accounting for 49.7% of the herd and 45.8% of the farms. The next largest herds were in Saskatchewan (23.9%), Manitoba (10%), and British Columbia (6%). The main producing regions were in the northern parts of the Canadian prairies, specifically in the parkland belt, with the Peace River region (shared between Alberta and British Columbia) begin the most inmportant cluster, accounting for 14.4% of the national herd.[41] Canada also exports bison meat, totaling 2,075,253 kilograms (4,575,150 lb) in 2006.[42]

A proposal known as Buffalo Commons has been suggested by a handful of academics and policymakers to restore large parts of the drier portion of the Great Plains to native prairie grazed by bison.[39] Proponents argue that current agricultural use of the shortgrass prairie is not sustainable, pointing to periodic disasters, including the Dust Bowl, and continuing significant human population loss over the last 60 years. However, this plan is opposed by some who live in the areas in question.[citation needed]

Behavior and ecology[edit]

Herd of Bison in Yellowstone National Park
Grazing in winter, Yellowstone National Park. They use their heads to clear out snow for the grass.
American bison galloping. Photos by Eadweard Muybridge, first published in 1887 in Animal Locomotion.

Bison are migratory and herd migrations can be directional as well as altitudinal in some areas.[43][44][45] Bison have usual daily movements between foraging sites during the summer. In a montane valley, bison have been recorded traveling, on average, 3.2 km a day.[45] The summer ranges of bison appear to be influenced by seasonal vegetation changes, interspersion and size of foraging sites, the rut and the number of biting insects.[43] The size of preserve and availability of water may also be a factor.[45] Bison are largely grazers, eating primarily grasses and sedges. On shortgrass pasture, bison predominately consume warm season grasses.[46] On mixed prairie, it appears that cool season grasses, including some sedges, compose 79–96% of their diet.[47] In montane and northern areas, sedges are selected throughout the year.[43] Bison also drink water or consume snow on a daily basis.[45]

Social behavior and reproduction[edit]

Female bison live in maternal herds which include other females and their offspring. Male offspring leave their maternal herd when around three years old and will either live alone or join other males in bachelor herds. Male and female herds usually do not mingle until the breeding season, which can occur from July through September.[48] However female herds may also contain a few older males. During the breeding season, dominant bulls maintain a small harem of females for mating. Individual bulls "tend" cows until allowed to mate, by following them around and chasing away rival males. The tending bull will shield the female's vision with his body so she will not see any other challenging males. A challenging bull may bellow or roar to get a female's attention and the tending bull has to bellow/roar back.[49] The most dominant bulls mate in the first 2–3 weeks of the season.[49] More subordinate bulls will mate with any remaining estrous cow that has not mated yet. Male bison play no part in raising the young.

Bison herds have dominance hierarchies that exist for both males and females. A bison's dominance is related to its birth date.[50] Bison born earlier in the breeding season are more likely to be larger and more dominant as adults.[50] Thus bison are able to pass on their dominance to their offspring as dominant bison breed earlier in the season. In addition to dominance, the older bison of a generation also have a higher fertility rate than the younger ones.[50] Cows nurse their calves for at least 7 or 8 months but most calves seem to be weaned before the end of their first year.[45]

Bison have been observed to display homosexual behaviors, males much more so than females. In the case of males, it is unlikely to be related to dominance but rather to social bonding or gaining sexual experience.[51]

Horning[edit]

Bison mate in late spring and summer in more open plain areas. During fall and winter, bison tend to gather in more wooded areas. During this time, bison partake in horning behaviors. They will rub their horns against trees, young saplings and even utility poles. Aromatic trees like cedars and pine seem to be preferred. Horning appears to be associated with insect defense as it occurs most often in the fall when the insect population is at its highest.[52] Cedar and pines emit an aroma after bison horn them and this seems to be used as a deterrent for insects.[52]

Wallowing behavior[edit]

A bison wallow is a shallow depression in the soil, which is used either wet or dry. Bison roll in these depressions, covering themselves with dust or mud. Past explanations and current hypotheses suggested for wallowing behavior include grooming behavior associated with shedding, male-male interaction (typically rutting behavior), social behavior for group cohesion, play behavior, relief from skin irritation due to biting insects; reduction of ectoparasite (tick and lice) load; and thermoregulation.[53]

Predation[edit]

American bison standing its ground against a wolf pack

While often secure from predation due to their size and strength, in some areas, bison are regularly preyed upon by wolves. Wolf predation typically peaks in late spring and early summer, with attacks usually being concentrated on cows and calves. Observations have shown that wolves more actively target herds with calves than those without. The length of a predation episode varies, ranging from a few minutes to over nine hours.[54][55] Bison display five apparent defense strategies in protecting calves from wolves: running to a cow, running to a herd, running to the nearest bull, running in the front or center of a stampeding herd, and entering water bodies such as lakes or rivers. When fleeing wolves in open areas, cows with young calves take the lead, while bulls take to the rear of the herds, to guard the cows' escape. Bison typically ignore wolves not displaying hunting behavior.[56] Wolf packs specializing in bison tend to have a greater number of males, as their larger size compared to the females allows them to wrestle their prey to the ground more effectively.[57] Healthy, mature bulls in herds rarely fall victim to predators. The grizzly bear can also pose a threat to calves and sometimes old, injured or sick adult bison.

Dangers to humans[edit]

Bison are among the most dangerous animals encountered by visitors to the various U.S. and Canadian national parks and will attack humans if provoked. They appear slow because of their lethargic movements but can easily outrun humans—bison have been observed running as fast as 40 miles per hour (64 km/h).

Between 1980 and 1999, more than three times as many people in Yellowstone National Park were injured by bison than by bears. During this period, bison charged and injured 79 people, with injuries ranging from goring puncture wounds and broken bones to bruises and abrasions. Bears injured 24 people during the same time frame. Three people died from the injuries inflicted—one person by bison in 1983, and two people by bears in 1984 and 1986.[58]

Hunting[edit]

Main article: Bison hunting
Bison hunt under the wolf-skin mask, 1832–33
Bison being chased off a cliff as seen and painted by Alfred Jacob Miller.

Buffalo hunting (hunting of the American bison) was an activity fundamental to the Midwestern Native Americans, which was later adopted by American professional hunters, leading to the near-extinction of the species around the year 1890. It has since begun to recover.

YearAmerican
bison (est)
Before 149260,000,000
1890750
2000360,000
Range history of bison in North America
Original distribution of plains bison and wood bison in North America. Holocene bison (Bison occidentalis) is an earlier form at the origin of plains bison and wood bison.
  Holocene bison
  Wood bison
  Plains bison
Map of the extermination of the bison to 1889. This map based on William Temple Hornaday's late-19th century research.
  Original range
  Range as of 1870
  Range as of 1889
Distribution of public herds of plains bison and of free-ranging or captive breeding wood bison in North America as of 2003.
  Wood bison
  Plains bison

Genetics[edit]

Two of the major problems that bison face today are the genetic bottleneck and lack of genetic diversity that has been caused by the very small number of bison that survived their near extinction event. A second genetic problem is the entry of genes from domestic cattle into the bison population, through hybridization.[39]

Officially, the "American buffalo" is classified by the United States government as a type of cattle, and the government allows private herds to be managed as such. This is a reflection of the characteristics that bison share with cattle. Though the American bison (Bison bison) is not only a separate species, but is usually regarded as being in a separate genus from domestic cattle (Bos taurus), they clearly have a lot of genetic compatibility and American bison can interbreed with cattle, although only the female offspring are fertile in the first generation. These female hybrids can be bred back to either bison or domestic bulls, resulting in either 1/4 or 3/4 bison young. Female offspring from this cross are also fertile, but males are not reliably fertile unless they are either 78 bison or 78 domestic.[59] Moreover, when they do interbreed, crossbreed animals in the first generation tend to look very much like purebred bison, so appearance is completely unreliable as a means of determining what is a purebred bison and what is a crossbred cow. Many ranchers have deliberately cross bred their cattle with bison, and it would also be expected that there could be some natural hybridization in areas where cattle and bison occur in the same range. Since cattle and bison eat similar food and tolerate similar conditions, they have often been in the same range together in the past, and opportunity for cross breeding may sometimes have been common.

In recent decades tests were developed to determine the source of mitochondrial DNA in cattle and bison, and it was found that most private "buffalo" herds were actually cross bred with cattle, and even most state and federal buffalo herds had some cattle DNA. With the advent of nuclear microsatellite DNA testing, the number of herds known to contain cattle genes has increased. Though approximately 500,000 bison exist on private ranches and in public herds, some people estimate that perhaps only 15,000 to 25,000 of these bison are pure and are not actually bison-cattle hybrids. "DNA from domestic cattle (Bos taurus) has been detected in nearly all bison herds examined to date."[60] Significant public bison herds that do not appear to have hybridized domestic cattle genes are the Yellowstone Park bison herd, the Henry Mountains bison herd which was started with bison taken from Yellowstone Park, the Wind Cave bison herd and the Wood Buffalo National Park bison herd and subsidiary herds started from it, in Canada.

A landmark study of bison genetics that was performed by James Derr of the Texas A&M University corroborated this.[61] The Derr study was undertaken in an attempt to determine what genetic problems bison might face as they repopulate former areas, and it noted that bison seem to be doing quite well, despite their apparent genetic bottleneck. One possible explanation for this might be the small amount of domestic cattle genes that are now in most bison populations, though this is not the only possible explanation for bison success.

A wood bison around Coal River in Canada

In the study cattle genes were also found in small amounts throughout most national, state and private herds. "The hybridization experiments conducted by some of the owners of the five foundation herds of the late 1800s, have left a legacy of a small amount of cattle genetics in many of our existing bison herds." He also said, "All of the state owned bison herds tested (except for possibly one) contain animals with domestic cattle mtDNA."[61] It appears that the one state herd that had no cattle genes was the Henry Mountains bison herd in the Henry Mountains of Utah. It is also notable that the Henry Mountain herd was started initially with transplanted animals from Yellowstone Park. However, the extension of this herd into the Book Cliffs of central Utah involved mixing the founders with additional bison from another source, so it is not known if the Book Cliffs extension of the herd is also free of cattle hybridization.

A separate study by Wilson and Strobeck, published in Genome, was done to define the relationships between different herds of bison in the United States and Canada, and to determine whether the bison at Wood Buffalo National Park in Canada and the Yellowstone Park bison herd were possibly separate subspecies, and not plains bison. It was determined that the Wood Buffalo Park bison were actually cross breeds between plains bison and wood bison, but that their predominant genetic makeup was truly that of the expected "wood buffalo".[9] However, the Yellowstone Park bison herd were pure plains bison, and not any of the other previously suggested subspecies. Another interesting finding was that the bison in the Antelope Island bison herd in Utah appeared to be more distantly related to other plains bison in general than any other plains bison group that was tested, though this might be due to genetic drift caused by the small size of only 12 individuals in the founder population. A side finding of this was that the Antelope Island bison herd appears to be most closely related to the Wood Buffalo National Park bison herd, though the Antelope Island bison are actually plains bison.

Bison trails[edit]

The first thoroughfares of North America, except for the time-obliterated paths of mastodon or muskox and the routes of the Mound Builders, were the traces made by bison and deer in seasonal migration and between feeding grounds and salt licks. Many of these routes, hammered by countless hoofs instinctively following watersheds and the crests of ridges in avoidance of lower places' summer muck and winter snowdrifts, were followed by the Indians as courses to hunting grounds and as warriors' paths. They were invaluable to explorers and were adopted by pioneers.

Bison traces were characteristically north and south, but several key east-west trails were used later as railways. Some of these include the Cumberland Gap through the Blue Ridge Mountains to upper Kentucky. A heavily used trace crossed the Ohio River at the Falls of the Ohio and ran west, crossing the Wabash River near Vincennes, Indiana. In Senator Thomas Hart Benton's phrase saluting these sagacious path-makers, the bison paved the way for the railroads to the Pacific.[62]

Bison as a symbol[edit]

Native Americans[edit]

Among Native American tribes, especially the Plains Indians, the Bison is considered a sacred animal and religious symbol. According to University of Montana anthropology and Native American studies professor S. Neyooxet Greymorning, "The creation stories of where buffalo came from put them in a very spiritual place among many tribes. The buffalo crossed many different areas and functions, and it was utilized in many ways. It was used in ceremonies, as well as to make tipi covers that provided homes for people, utensils, shields, weapons and parts were used for sewing with the sinew."[63] The Sioux consider the birth of a White Buffalo to be the returning of White Buffalo Calf Woman, their primary cultural prophet and the bringer of their "Seven Sacred Rites". Among the Mandan and Hidatsa, the White Buffalo Cow Society was the most sacred of societies for women.

United States[edit]

Wyoming uses a bison in its state flag.
The 1935 Buffalo nickel—this style of coin featuring an American bison was produced from 1913 to 1938.
Series 1901 $10 Legal Tender depicting military explorers Meriwether Lewis, William Clark, and an American bison.
First postage stamp with image of bison was issued US in 1898—4¢ "Indian Hunting Buffalo". Part of the Trans-Mississippi Exposition commemorative series.

The American bison is often used in North America in official seals, flags, and logos. In the United States, the American bison is a popular symbol in the Great Plains states. Kansas, Oklahoma, and Wyoming have adopted the animal as their official state mammal, and many sports teams have chosen the bison as their mascot. In Canada, the bison is the official animal of the province of Manitoba and appears on the Manitoba flag. It is also used in the official coat of arms of the Royal Canadian Mounted Police.

Several American coins feature the bison, most famously on the reverse side of the "buffalo nickel" from 1913 to 1938. In 2005, the United States Mint coined a nickel with a new depiction of the bison as part of its "Westward Journey" series. The Kansas and North Dakota state quarters, part of the "50 State Quarter" series, each feature bison. The Kansas state quarter has only the bison and does not feature any writing, while the North Dakota state quarter has two bison. The Montana state quarter prominently features a bison skull over a landscape. The Yellowstone National Park Quarter also features a bison standing next to a geyser.

Other institutions which have adopted the bison as a symbol or mascot include:

See also[edit]

References[edit]

  1. ^ Gates, C. & Aune, K (2008). Bison bison. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved November 10, 2008. Database entry includes a brief justification of why this species is "Near Threatened".
  2. ^ Project Gutenburg E Book - The Extermination of the American Bison
  3. ^ "American Buffalo (Bison bison) species page". U.S. Fish and Wildlife Service. Retrieved February 24, 2013. 
  4. ^ William T. Hornaday, Superintendent of the National Zoological Park (February 10, 2006) [1889]. The Extermination of the American Bison. Smithsonian Institution.  Retrieved on February 24, 2013.
  5. ^ Geist V. (1991). "Phantom subspecies: the wood bison, Bison bison "athabascae" Rhoads 1897, is not a valid taxon, but an ecotype". Arctic 44 (4): 283–300. doi:10.14430/arctic1552. 
  6. ^ Kay, Charles E.; Clifford A. White (2001). "Reintroduction of bison into the Rocky Mountain parks of Canada: historical and archaeological evidence". "Crossing Boundaries in Park Management: Proceedings of the 11th Conference on Research and Resource Management in Parks and on Public Lands". Hancock, Michigan: George Wright Soc. pp. 143–51. Retrieved December 2, 2009. 
  7. ^ Bork, A. M., C. M. Strobeck, F. C. Yeh, R. J. Hudson, & R. K. Salmon; Strobeck; Yeh; Hudson; Salmon (1991). "Genetic relationship of wood and plains bison based on restriction fragment length polymorphisms". Can J Zool 69 (1): 43–48. doi:10.1139/z91-007. 
  8. ^ a b Halbert, Natalie D., Terje Raudsepp, Bhanu P. Chowdhary, & James N. Derr; Raudsepp; Chowdhary; Derr (2004). "Conservation Genetic Analysis of the Texas State Bison Herd". Journal of Mammalogy 85 (5): 924–931. doi:10.1644/BER-029. 
  9. ^ a b Wilson, G. A., & C. Strobeck; Strobeck (1999). "Genetic variation within and relatedness among wood and plains bison populations". Genome 42 (3): 483–96. doi:10.1139/gen-42-3-483. PMID 10382295. 
  10. ^ Boyd, Delaney P. (April 2003). Conservation of North American Bison: Status and Recommendations (MS thesis). University of Calgary. OCLC 232117310. Archived from the original on 2010-01-17. Retrieved February 23, 2010. 
  11. ^ a b Meagher, M. (1986). "Bison bison". Mammalian Species (266). 
  12. ^ Joel Berger; Carol Cunningham (June 1994). Bison: mating and conservation in small populations. Columbia University Press. p. 162. ISBN 978-0-231-08456-7. 
  13. ^ The American Heritage Dictionary of the English Language, Fifth Edition:
  14. ^ Trophy Bowhunting: Plan the Hunt of a Lifetime and Bag One for the Record Books, by Rick Sapp, Edition: illustrated, published by Stackpole Books, 2006, ISBN 0-8117-3315-7, ISBN 978-0-8117-3315-1
  15. ^ American Bison: A Natural History, By Dale F. Lott, Harry W. Greene, ebrary, Inc, Contributor Harry W. Greene, Edition: illustrated, Published by University of California Press, 2003 ISBN 0-520-24062-6, ISBN 978-0-520-24062-9
  16. ^ Newman, Edward and James Edmund Harting (1859). Zoologist: A Monthly Journal of Natural History Published by J. Van Voorst.
  17. ^ "Maternal and Paternal Lineages in Cross-Breeding Bovine Species. Has Wisent a Hybrid Origin?". Mbe.oxfordjournals.org. 2004-01-22. Retrieved May 29, 2013. 
  18. ^ Guo, S. et al. (2006). "Taxonomic placement and origin of yaks: implications from analyses of mtDNA D-loop fragment sequences". Acta Theriologica Sinica 26 (4): 325–330. 
  19. ^ Verkaar, EL; Nijman, IJ; Beeke, M; Hanekamp, E; Lenstra, JA (2004). "Maternal and Paternal Lineages in Cross-Breeding Bovine Species. Has Wisent a Hybrid Origin?". Molecular Biology and Evolution 21 (7): 1165–70. doi:10.1093/molbev/msh064. PMID 14739241. 
  20. ^ Buntjer, J B; Otsen, M; Nijman, I J; Kuiper, M T R; Lenstra, J A (2002). "Phylogeny of bovine species based on AFLP fingerprinting". Heredity 88 (1): 46–51. doi:10.1038/sj.hdy.6800007. PMID 11813106. 
  21. ^ Verkaar, EL; Nijman, IJ; Beeke, M; Hanekamp, E; Lenstra, JA (2004). "Maternal and Paternal Lineages in Cross-Breeding Bovine Species. Has Wisent a Hybrid Origin?". Molecular biology and evolution 21 (7): 1165–70. doi:10.1093/molbev/msh064. PMID 14739241. 
  22. ^ a b c d McDonald, J., 1981. North American Bison: Their classification and Evolution. University of California Press, Berkeley, Los Angeles, London. 316 pp.
  23. ^ Guthrie, R. D. (1990). Frozen Fauna of the Mammoth Steppe: The Story of Blue Babe. University of Chicago Press: Chicago.
  24. ^ Bell, C.J. et al. (2004). "The Blancan, Irvingtonian, and Rancholabrean mammal ages". In Woodburne, M.O. Late Cretaceous and Cenozoic Mammals of North America: Biostratigraphy and Geochronology. New York: Columbia Univ. Press. pp. 232–314. ISBN 0-231-13040-6. 
  25. ^ Scott, E., Cox, S.M. (2008). "Late Pleistocene distribution of Bison (Mammalia; Artiodactyla) in the Mojave Desert of Southern California and Nevada". In Wang, X., Barnes, L.G. Geology and Vertebrate Paleontology of Western and Southern North America. Los Angeles: Natural History Museum of Los Angeles County. pp. 359–382. 
  26. ^ Sanders, A.E., R.E. Weems, and L.B. Albright III (2009). "Formalization of the mid-Pleistocene "Ten Mile Hill beds" in South Carolina with evidence for placement of the Irvingtonian–Rancholabrean boundary". In Albright III, L.B. Papers on Geology, Vertebrate Paleontology, and Biostratigraphy in Honor of Michael O. Woodburne. Flagstaff: Museum of Northern Arizona. pp. 369–375. 
  27. ^ Kurten, B; Anderson, E (1980). "Order Artiodactyla". Pleistocene mammals of North America (1st ed.). New York: Columbia University Press. pp. 295–339. ISBN 0-231-03733-3. 
  28. ^ Jefferson, G. (2001). Rancho la Brea Bison. In: J. Harris (ed), Rancho La Brea: Death Trap and Treasure Trove. Terra 30(2): 33. Los Angeles Natural History Museum Foundation. p. 33.
  29. ^ Wilson, M.C., L.V. Hills, and B. Shapiro (2008). "Late Pleistocene northward-dispersing Bison antiquus from the Bighill Creek Formation, Gallelli Gravel Pit, Alberta, Canada, and the fate of Bison occidentalis". Canadian Journal of Earth Sciences 45 (7): 827–59. doi:10.1139/E08-027. 
  30. ^ Lott, Dale F. (2002). American Bison: A Natural History. Berkeley: University of California Press. ISBN 0-520-23338-7. 
  31. ^ "Ohio Archaeology Blog: Better Than a Pointed Stick in the Eye - Not Really". Ohio-archaeology.blogspot.com. 2011-05-26. Retrieved May 29, 2013. 
  32. ^ a b Halbert, N; Gogan, P, Hiebert, R; and Derr, J (2007). "Where the buffalo roam: The role of history and genetics in the conservation of bison on U.S. federal lands". Park Science 24 (2): 22–29. 
  33. ^ Polziehn, R; Strobeck, C; Sheraton, J & Beech, R (1995). "Bovine mtDNA Discovered in North American Bison Populations". Conservation Biology 9 (6): 1638–1643 (1642). doi:10.1046/j.1523-1739.1995.09061638.x. 
  34. ^ Illinois State Museum page. Museum.state.il.us (2011-09-01). Retrieved on January 29, 2012.
  35. ^ "Summary of Bison Facts". 
  36. ^ staff (March 3, 2010). "Restoring North America's Wild Bison to Their Home on the Range". Ens-newswire.com. Retrieved February 19, 2011. 
  37. ^ The IUCN Red List of Threatened Species (version 2009.1) – Bison bison
  38. ^ "| National Bison Association". Bisoncentral.com. Archived from the original on January 20, 2011. Retrieved February 19, 2011. 
  39. ^ a b c d Staff (November 15, 2011). "Restoring a Prairie Icon". National Wildlife (National Wildlife Federation) 50 (1): 20–25. 
  40. ^ Chang, Alicia (September 21, 2007). "Study: Catalina bison aren't purebred". USA Today. Associated Press. Retrieved March 14, 2008. 
  41. ^ a b "Canadian Agriculture at a Glance: Bison on the comeback trail". Statcan.gc.ca. 2009-04-09. Retrieved 2013-05-29. 
  42. ^ "Table 1 Bison meat exports continue to climb, 2001 to 2006". Statcan.gc.ca. 2009-04-03. Retrieved May 29, 2013. 
  43. ^ a b c Meagher M (1973). "The bison of Yellowstone National Park". National Park Service Science Monographs 1: 1–161. 
  44. ^ Van Vuren, D. (1983). "Group dynamics and summer home range of bison in southern Utah". Journal of Mammalogy 64 (2): 329–332. doi:10.2307/1380570. JSTOR 1380570. 
  45. ^ a b c d e McHugh, T. (1958). "Social behavior of the American buffalo (Bison bison bison)". Zoologica 43: 1–40. 
  46. ^ Peden, D. G. Van Dyne, R. Rice, R. Hansen (1974). "The trophic ecology of Bison bison L. on shortgrasss plains". Journal of Applied Ecology 11 (2): 489–497. doi:10.2307/2402203. JSTOR 2402203. 
  47. ^ Popp, Jewel Kay. (1981). "Range Ecology of Bison on Mixed Grass Prairie at Wind Cave National Park". Unpubl. M.S. Thesis. Iowa State University, Ames, Iowa. 59 p.
  48. ^ "American Bison - Bison bison - NatureWorks". NatureWorks. Retrieved February 5, 2014. 
  49. ^ a b Wolff, J. O. (1998). "Breeding strategies, mate choice, and reproductive success in American bison". Okios 83 (2): 529–544. doi:10.2307/3546680. JSTOR 3546680. 
  50. ^ a b c Green W. C. H. R., Aron (1993). "Persistent influences of birth date on dominance, growth and reproductive success in bison". Journal of Zoology 230 (2): 177–185. doi:10.1111/j.1469-7998.1993.tb02680.x. 
  51. ^ Vervaecke H, Roden C. (2006). "Going with the herd: same-sex interaction and competition in American bison". In: Sommer V, Vasey PL, (editors). Homosexual behaviour in animals. Cambridge University Press. pp. 131–53 ISBN 0-521-86446-1.
  52. ^ a b Coppedge, B. R. C., T.S.; Shaw, J.H.; Hamilton, R.G. (1997). "Agonistic behavior associated with orphan bison (Bison bison) claves released into a mixed resident population". Applied Animal Behavior Science 55: 1. doi:10.1016/S0168-1591(97)00035-X. 
  53. ^ McMillan, Brock R.; Cottam, Michael R.; Kaufman, Donald W. (2000). "Wallowing Behavior of American Bison (Bos Bison) in Tallgrass Prairie: An Examination of Alternate Explanations". American Midland Naturalist 144 (1): 159–67. doi:10.1674/0003-0031(2000)144[0159:WBOABB]2.0.CO;2. ISSN 0003-0031. JSTOR 3083019. 
  54. ^ Mary Ann Franke (2005). To save the wild bison: life on the edge in Yellowstone. University of Oklahoma Press. p. 199. ISBN 978-0-8061-3683-7. 
  55. ^ Douglas W. Smith; Gary Ferguson (November 1, 2006). Decade of the Wolf: Returning the Wild to Yellowstone. Globe Pequot. p. 68. ISBN 978-1-59228-886-1. 
  56. ^ Carbyn LN, Trottier T (1988). "Descriptions of Wolf Attacks on Bison Calves in Wood Buffalo National Park" (pdf). Arctic 41 (4): 297–302. doi:10.14430/arctic1736. 
  57. ^ Smith, Doug (March 1, 2009). "Bigger is better if you're a hungry wolf". Billings Gazette. Retrieved September 7, 2014. 
  58. ^ Tom Olliff; Jim Caslick (2003). "Wildlife-Human Conflicts in Yellowstone: When Animals and People Get Too Close". Yellowstone Science (Artcraft Inc.) 11 (1): 18–22. Archived from the original on 2011-10-28. 
  59. ^ Liberty Hyde Bailey (1908). Cyclopedia of American Agriculture, Volume III: Animals. The MacMillan Company. p. 291. 
  60. ^ Remove Threats to Irreplaceable Bison Herd at Wind Cave National Park. PDF. FY 2006 Challenge Cost Share Program. Final Project Report. September 30, 2007. Retrieved on September 16, 2011.
  61. ^ a b Derr, James (October 24, 2006). "American Bison: The Ultimate Genetic Survivor". The Ecological Future of North American Bison. Archived from the original on July 25, 2011. Retrieved July 27, 2011. 
  62. ^ Adams, James Truslow (1940). Dictionary of American History. New York: Charles Scribner's Sons. ISBN 0-8226-0349-7. 
  63. ^ Jawort, Adrian (May 9, 2011). "Genocide by Other Means: U.S. Army Slaughtered Buffalo in Plains Indian Wars". Indian Country Today. Retrieved April 3, 2014. 
  64. ^ Nader, The (October 18, 2008). "Buffalo T-Shirt Sale – Ralph Nader for President in 2008". Votenader.org. Retrieved February 19, 2011. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Wood bison

The wood bison (Bison bison athabascae) or mountain bison (often called the wood buffalo or mountain buffalo), is a distinct northern subspecies or ecotype[2][3][4][5][6][7] of the American bison. Its original range included much of the boreal forest regions of Alaska, Yukon, western Northwest Territories, northeastern British Columbia, northern Alberta, and northwestern Saskatchewan.[8] It is currently listed as threatened on Schedule I of the Species At Risk Act.[9]

Morphology[edit]

The wood bison differs from the plains bison (Bison bison bison), the other surviving North American subspecies/ecotype, in a number of important ways. Most notably, the wood bison is heavier, with large males weighing over 900 kilograms (2,000 lb), making it the largest terrestrial animal in North America. The highest point of the wood bison is well ahead of its front legs, while the plains bison's highest point is directly above the front legs. Wood bison also have larger horn cores, a darker and woollier pelage, and less hair on their forelegs and beard.[4]

Conservation[edit]

Wood bisons including a calf in Nordhorn

In addition to the loss of habitat and hunting, wood bison populations have also been in danger of hybridizing with plains bison, and therefore polluting the genetic stock.

As with other bison, the wood bison's population was devastated by hunting and other factors. By the early 1900s, they were regarded as extremely rare or perhaps nearly extinct. However, a herd of about 200 was discovered in Alberta, Canada in 1957. This herd has since recovered to a total population of approximately 2,500, largely as a result of conservation efforts by Canadian government agencies. In 1988, the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) changed the subspecies' conservation status from "endangered" to "threatened".

On June 17, 2008, 53 Canadian wood bison were transferred from Elk Island National Park in Alberta, Canada, to the Alaska Wildlife Conservation Center near Anchorage, Alaska.[10] There they were to be held in quarantine for two years, and then re-introduced to their native habitat in the Minto Flats area near Fairbanks, but this plan is still on hold as of 2013.[11][12] In May 2014, the U.S. Fish and Wildlife Service published a final rule allowing the reintroduction of a "non-essential experimental" population of wood bison into three areas of Alaska. The Alaska Department of Fish and Game expects to start introducing the first animals to the Innoko River area in western Alaska in spring 2015. The new regulation will take effect June 6.

Currently there are approximately 7,000 wood bison in the wild, located in the Northwest Territories, Yukon, British Columbia, Alberta, and Manitoba.[13][14]

In 2006 as part of an international conservation project, an outherd was established in Yakutia, Russia,[15][16][17] where the related steppe bison died out over 6000 years ago.[clarification needed] Additional bison were sent from Alberta in 2011 and 2013 to Russia bringing the total up to 120.[18]

Diseases[edit]

Publicly owned free-ranging herds in Alberta, British Columbia, Yukon, and the Northwest Territories comprise 90% of existing wood bison, although six smaller public and private captive breeding herds with conservation objectives comprise approximately 10% of the total (n ≈ 900). These captive herds and two large isolated free-ranging herds in the Yukon and Northwest Territories all derive from disease-free and morphologically representative founding stock from northern Wood Buffalo National Park in northeastern Alberta and southern Northwest Territories. These captive herds are particularly important for conservation and recovery purposes, because the larger free-ranging herds in and around Wood Buffalo National Park were infected with bovine brucellosis and tuberculosis after 7,000 plains bison (Bison bison bison) were trans-shipped by barge from Buffalo National Park near Wainwright, Alberta in the 1920s.

Diseases including brucellosis and tuberculosis remain endemic in the free-ranging herds in and around Wood Buffalo National Park.[19] The diseases represent a serious management issue for governments, various local Aboriginal groups, and the cattle industry rapidly encroaching on the park's boundaries. Disease management strategies and initiatives began in the 1950s, and have yet to result in a reduction of the incidence of either disease despite considerable expenditure and increased public involvement.

Name[edit]

The term "buffalo" is sometimes considered to be a misnomer for this animal, as it is only distantly related to either of the two "true buffalo", the Asian water buffalo and the African buffalo. However, "bison" is a Greek word meaning ox-like animal, while "buffalo" originated with the French fur trappers who called these massive beasts bœufs, meaning ox or bullock—so both names, "bison" and "buffalo", have a similar meaning. Though the name "Bison" might be considered to be more scientifically correct, as a result of standard usage the name "Buffalo" is also considered correct and is listed in many dictionaries as an acceptable name for American Buffalo or bison. In reference to this animal, the term "buffalo", dates to 1635 in North American usage when the term was first recorded for the American mammal. It thus has a much longer history than the term "bison", which was first recorded in 1774.[20] The American bison is very closely related to the wisent or European bison.

See also[edit]

References[edit]

  1. ^ Gates, C. & Aune, K. 2008. Bison bison. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.1. <www.iucnredlist.org>. Downloaded on 06 September 2012.
  2. ^ Geist, V. (1991). "Phantom Subspecies: The Wood Bison, Bison bison "athabascae" Rhoads 1897, Is Not a Valid Taxon, but an Ecotype.". Arctic 44 (4): 283–300. doi:10.14430/arctic1552. 
  3. ^ Kay, Charles E.; White, Clifford A. (2001). "Reintroduction of Bison into the Rocky Mountain Parks of Canada: Historical and Archaeological Evidence". Crossing Boundaries in Park Management: Proceedings of the 11th Conference on Research and Resource Management in Parks and on Public Lands. Hancock, Michigan: George Wright Soc. pp. 143–151. Retrieved December 2, 2009. 
  4. ^ a b Bork, A. M. coauthors=Strobeck, C. M.; Yeh, F. C.; Hudson, R. J.; Salmon, R. K. (1991). "Genetic Relationship of Wood and Plains Bison Based on Restriction Fragment Length Polymorphisms". Canadian Journal of Zoology 69 (1): 43–48. doi:10.1139/z91-007. 
  5. ^ Halbert, Natalie D.; Raudsepp, Terje; Chowdhary, Bhanu P.; Derr, James N. (2004). "Conservation Genetic Analysis of the Texas State Bison Herd". Journal of Mammalogy 85 (5): 924–931. doi:10.1644/BER-029. 
  6. ^ Wilson, G. A.; Strobeck, C. (1999). "Genetic Variation within and Relatedness among Wood and Plains Bison Populations". Genome 42 (3): 483–496. doi:10.1139/gen-42-3-483. PMID 10382295. 
  7. ^ Boyd, Delaney P. (2003). Conservation of North American Bison: Status and Recommendations (MS thesis). University of Calgary. Retrieved December 2, 2009. 
  8. ^ Wood Bison Restoration in Alaska, Alaska Department of Fish & Game, Division of Wildlife Conservation
  9. ^ Species At Risk Registry: Wood Bison
  10. ^ Canada Helps Restore Wood Bison to Alaska in International Conservation Effort to Recover a Threatened Species, Yahoo! Finance, July 9, 2008
  11. ^ Release of bison into Alaska wilderness put on hold again, Fairbanks Daily News-Miner, Aug 14, 2011
  12. ^ http://www.alaskawildlife.org/animals/wood-bison/
  13. ^ Ministry of Environment and Natural Resources - Northwest Territories, Ministry of Environment and Natural Resources - Northwest Territories
  14. ^ Gates, Zimov, Stephenson, Chapin. "Wood Bison Recovery: Restoring Grazing Systems in Canada, Alaska and Eastern Siberia". Retrieved February 9, 2010. 
  15. ^ CBC News, "Alberta bison bound for Russia", 14 February 2011
  16. ^ Edmonton Journal, "Elk Island wood bison big hit in Russia", Hanneke Brooymans, 5 August 2010
  17. ^ Edmonton Journal, "Bison troubles", CanWest MediaWorks Publications, 5 October 2006
  18. ^ CBC News, "More Alberta bison to roam Russia", 23 September, 2013
  19. ^ Joly, D. O.; Messier, F. (2004-06-16). "Factors affecting apparent prevalence of tuberculosis and brucellosis nubs are amazing". Journal of Animal Ecology 7 (4): 623–631. doi:10.1111/j.0021-8790.2004.00836.x. Retrieved 2009-04-30. 
  20. ^ The American Heritage Dictionary of the English Language, Fourth Edition
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors regard New World B. bison and Old World B. bonasus as conspecific; they were regarded as separate species by Meagher (1986) and Grubb (in Wilson and Reeder 1993, 2005).

There has been some difference of opinion as to whether the two subspecies, B. b. bison and B. b. athabascae, are worthy of recognition; different types of data suggest different conclusions (see Bork et al. 1991). van Zyll de Jong (1986) found that cranial and post-cranial skeletal data indicate a phenotypic discontinuity between grassland and woodland populations and concluded that recognition of the subspecies bison and athabascae is fully justified. External phenotypic data support this distinction as well (van Zyll de Jong et al. 1995). See Geist (1990, 1991) for a summary of evidence that there are no taxonomically valid differences between wood and plains bison. MtDNA data (Polziehn et al. 1996) indicate that both the plains bison (subspecies bison) and the wood bison (subspecies athabascae) form polyphyletic groups; neither is a well-defined taxon. Gates et al. (2001), however, argued that mtDNA data are not appropriate for determining the relationship between the two groups. Wilson and Strobeck (1999) investigated variability in 11 microsatellite loci of bison genomic DNA and concluded that the genetic clustering of wood bison indicates that they are functioning as a genetic entity separate from plains bison. Grubb (in Wilson and Reeder 2005) did not recognize any subspecies.

The generic allocation of this species is debatable. Mitochondrial and ribosomal DNA analyses, together with reproductive, cranial, and other molecular data, strongly indicate that the genus Bison should be treated as a synonym of Bos rather than as a distinct genus in the tribe Bovini (Miyamoto et al. 1989, Wall et al. 1992). Baker et al. (2003) listed the bison as Bos bison. Without explanation, Grubb (in Wilson and Reeder 2005) recognized Bison and Bos as distinct genera.

See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

American bison
bison
plains bison
wood bison
prairie bison
woodland bison
mountain bison

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for the American bison is Bos bison
Linnaeus [99]. It is in the family Bovidae [34]. American bison taxonomy has been a
controversial issue for many years and classification to the subspecies
level remains a matter of debate [11,53]. However, most authorities
recognize two subspecies, the plains bison (Bos bison bison) and the
wood bison (B. bison athabascae Rhoads) [11,34,53].
  • 11.  Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of        North America. Baltimore, MD: The Johns Hopkins University Press. 1147        p.  [21085]
  • 53.  Meagher, Mary. 1986. Bison bison. Mammalian Species. 266: 1-8.  [24519]
  • 34.  Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2.        New York: John Wiley and Sons. 1271 p.  [14765]
  • 99.  Baker, Robert J.; Bradley, Lisa C.; Bradley, Robert D.; Dragoo, Jerry W.;        Engstrom, Mark D.; Hoffmann, Robert S.; Jones, Cheri A.; Reid, Fiona; Rice,        Dale W.; Jones, Clyde. 2003. Revised checklist of North American mammals north        of Mexico, 2003. Occasional Papers No. 229. Lubbock, TX: Museum of Texas Tech        University. 23 p. [50946]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!