Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

"Also known as the Morro Bay Kangaroo Rat and the Tulare Kangaroo Rat, Heermann's Kangaroo Rats live in many different kinds of habitats in southern California. Although they often take advantage of tunnels dug by ground squirrels, they also dig their own. Burrows can be more than 10 m long and rather labyrinthine, with loops and side branches. Most have areas for dust-bathing nearby, which the animals often use after foraging. An individual may spend only one hour in 24 outside its burrow. These Kangaroo Rats breed from February to October and have litters of 2 or 3 young. They are naked at birth. Fine hairs start to appear when they are three days old, and their eyes open in about two weeks. Weaning begins soon after, and when they are about 40 days old they learn to dig, excavating small pits with their forefeet. When they are 20 weeks old they are full grown, with an adult's coat of fur."

Adaptation: "The second through the fourth neck vertebrae of Heerman's kangaroo rat are fused, probably to rigidify the spine as an adaptation to their leaping style of cursorial locomotion."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: LeConte, J., 1853.  Remarks on the genus Dipodomys, p. 224.  Proceedings of the Academy of Natural Sciences of Philadelphia, 6:224-225.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from west-central California, north to Suisun Bay and the American River, southward through the San Joaquin Valley below about 3,000 ft, and extending through the interior valleys and mountains to the coast at Morro Bay and from Point Sal to Point Conception in Santa Barbara County (Grinnell, 1922; Hall, 1981; Kelt, 1988; Williams et al., 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Heermann's kangaroo rat, Dipodomys heermanni, is found exclusively in the state of California. The northern boundary of the species can be defined by a line connecting Suisun Bay to Lake Tahoe. The range extends south for roughly 500 kilometers to Point Conception in Santa Barbara Dipodomys heermanni occurs widely throughout the central portion of the state, and extends westward to the coast at some points. While found in a variety of habitats, Heermann's kangaroo rat is limited to elevations of 3000 feet and below (Williams et al 1993).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) West-central California, north to Suisun Bay and the American River, southward through the San Joaquin Valley below about 3,000 feet, and extending through the interior valleys and mountains to the coast at morro Bay and from Point Sal to Point Conception in Santa Barbara County (Grinnell 1922, Hall 1981, Kelt 1988, Williams et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Heermann's kangaroo rat ranges in size from 250 to 313 mm in length, with the tail averaging 180 mm in length. It has a long tufted tail, long hind feet/limbs, short forefeet, dorsal color varying from tawny brown to buff, and a white stripe running along the upper thigh. The hip stripe is conspicuously absent in the subspecies D. h. morroensis. Dipodomys heermanni has 5 toes on the hind foot, and is a member of the "broad-faced" kangaroo rat group. The combination of five toes and broad face distinguish D. heermanni from all other sympatric species of kangaroo rats (except the significantly larger D. ingens) (Brylski 1993, Kelt 1988).

Heermann's kangaroo rat is sexually dimorphic in both external and cranial measurements, with males larger in all cases. The rat has a total of 20 teeth, with the dental formula I=1/1, C=0/0, P=1/1, M=3/3. Dipodomys heermanni has a secretory gland located between the shoulders which is thought to play a part in scent communication or pelage maintenance. The gland does not show seasonal dimorphism in D. heermanni. Variation in tail and body color, among other characters, helps to differentiate the nine recognized subspecies (Best 1993, Brylski 1993).

Range mass: 60 to 90 g.

Average basal metabolic rate: 0.408 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 34 cm

Weight: 94 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 300.4 mm males; 295.1 mm females
Range: 250-313 mm

Weight:
Range: 70-80 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Heermann's kangaroo rats primarily inhabit dry, gravelly valley grasslands and open chaparral. They may also occur in open foothill woodlands and the lower and upper Sonoran life zones. They prefer sparsely vegetated areas with loosely textured soil. When inactive, they occupy an underground burrow, within which young are born in a nest. Kangaroo rats may dig burrows from the shelter of ground squirrel burrows. Reproduction occurs mainly from February through October where breeding peaks in April and declines after July. Gestation lasts 30-32 days. Litter size is two to five young and adults may produce multiple litters annually. Young appear above ground at four to six weeks. Females breed during their first year.

Diet is mainly seeds, they also eats green vegetation, especially in winter and spring. They also feeds seasonally on small amounts of insect material. They obtain food from ground surface or cuts standing seed heads or green vegetation. This species generally emerges soon after dark. Rain and fog, and sometimes moonlight, may inhibit activity. In San Luis Obispo County, little or no activity occurred in January and February; activity increased in early summer, declined in mid-summer, with possible fall resurgence.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Heermann's kangaroo rat is found in a great diversity of habitats. Some of the subspecies prefer the plains of the central California coast, some inhabit sandy valley bottoms, and some are more likely to be found on hilly knolls with shallow soils. These habitats extend from the foothills of the Sierra Nevada to the interior and coastal valleys (Kelt 1988).

Terrestrial Biomes: savanna or grassland ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily inhabits dry, gravelly valley grasslands, open chaparral. May also occur in open foothill woodlands. Lower and Upper Sonoran life zones. Prefers sparsely vegetated areas with loosely textured soil. When inactive, occupies underground burrow. Young are born in a nest in an underground burrow. May dig burrow from shelter of ground squirrel burrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Heermann's kangaroo rat feeds on a variety of plant species. Grasses are eaten as the kangaroo rat forages on the ground surface, while seeds are stored in the cheek pouches and taken home to the burrow for storage and later consumption. Dipodomys heermanni feeds on different plants as seasons change. In spring, Erodium species are the prominent source of food. In the dry season, Bromus mollis is taken most frequently, while Eromocarpus is the favored food in fall. With the onset of winter, Erodium becomes the primary food source once again. The kangaroo rat will also feed on insects such as moths, beetles, and grasshoppers (Kelt 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet is mainly seeds; also eats green vegetation, especially in winter and spring. Also feeds seasonally on small amounts of insect material. Obtains food from ground surface or cuts standing seed heads or green vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Population density varies widely with habitat. In San Luis Obispo County, density estimates varied from 42/ha in best habitat to 5/ha in marginal habitat. In one area in the same county, individual foraging range was estimated at 30-122 m across.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Generally emerges soon after dark. Rain and fog, and sometimes moonlight, may inhibit activity.

In San Luis Obispo County, little or no activity occurred in January and February; activity increased in early summer, declined in mid-summer, with possible fall resurgence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
8.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Heermann's kangaroo rat breeds from February to October. Breeding peaks in April. The gestation period lasts 31 days, with litters of up to 6 pups being produced. Average litter size has been reported to range from 2.6 to 3.7. The newborn kangaroo rat is mostly hairless, and the eyes and outer ears are closed. The cheek pouches at this stage are simple folds. By day 3, the young rat is able to crawl and begins to grow dorsal and cranial hairs. It has skin pigmentation that matches adult pelage patterns. By day 9, the sex of the rat can be determined by checking for swellings in the genital area (swellings are present in males, absent in females). By day 14 the kangaroo rat pup can stand, and achieves bipedality by day 20. The weaning process begins in the third week and is completed by day 25. Sexual maturity is achieved at some point past the third week; in congenerics of D. heermanni, maturity was achieved at times ranging from day 32 to day 56. Foraging begins at 4 weeks, adult weight is reached at 2.5-4 months, and the molt to adult pelage is complete by the fifth month (Eisenberg 1993, Kelt 1988, Nowak 1991).

Average birth mass: 3.91 g.

Average gestation period: 31 days.

Average number of offspring: 3.1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mainly from February through October; breeding peaks in April, declines after July. Gestation lasts 30-32 days. Litter size is 2-5; may produce multiple litters annually. Young appear above ground at 4-6 weeks. Females breed during their first year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dipodomys heermanni

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1838-08|EF156838|Dipodomys heermanni| AATCGTTGACTATTTTCAACAAATCATAAAGATATCGGGACCCTTTATATAATTTTTGGTGCTTGAGCCGGAATAGTGGGAACAGGCCTA---AGTATCCTCATTCGAGCGGAACTTGGTCAGCCAGGCTCATTATTAGGAGAC---GACCAGATTTATAATGTAATTGTTACTGCCCACGCATTTGTAATAATTTTCTTTATAGTGATGCCTATTCTAATTGGCGGCTTTGGAAACTGACTAGTTCCACTAATA---ATTGGTGCACCTGATATAGCTTTCCCACGAATAAATAACATGAGCTTTTGACTCCTACCACCCTCTTTTCTTCTACTATTAGCATCATCCATAGTTGAATCAGGAGCCGGAACTGGATGAACTGTTTACCCTCCATTAGCAGGAAATCTAGCACATGCTGGAGCTTCTGTCGACCTT---ACAATCTTCTCACTTCACCTAGCAGGAGTTTCATCAATTCTCGGAGCAATCAACTTTATTACAACAATTATTAACATAAAACCACCAGCCATGTCACAATATCAAACACCTCTATTCGTTTGATCAGTACTTATCACAGCTGTACTTCTTCTCCTATCACTACCAGTGTTGGCCGCA---GGAATTACGATACTTCTTACAGATCGTAACCTCAATACAACTTTTTTTGATCCTGCAGGAGGAGGAGACCCAGTACTTTACCAACACCTGTTCTGATTTTTCGGTCACCCAGAAGTATATATTCTTATTCTCCCCGGGTTTGGAATAATTTCTCATATTGTAACATACTATTCTGGAAAAAAA---GAACCATTTGGATATATAGGTGTAGTATGAGCTATAATATCCATTGGATTCTTAGGATTCATGGTATGAGCACATCACATATTTACAGTAGGAATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dipodomys heermanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern since its extent of occurrence is much greater than 20,000 km², its populations are stable, and there are no major threats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The subspecies D. h. berkeleyensis is listed as Vulnerable by the IUCN. The IUCN also lists the subspecies D. h. morroensis (the Morro Bay kangaroo rat) as being Critically Endangered. The Morro Bay rat is also classified as endangered by both the federal government and by the state of California. CITES does not list Heerman's kangaroo rat. Human settlement and the resulting habitat fragmentation in the Morro Bay rat's home range has severely decreased this population (CITES 1999, Kelt 1988, WCMC 1999).

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Occurs in west-central California; many occurrences; trend is poorly known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The Morro Bay kangaroo rat, D. heermanni morroensis, is Critically Endangered; the Berkeley Hills kangaroo rat, D. heermanni berkleyensis, is Vulnerable, and the Merced kangaroo rat, D. heermanni dixoni, is Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is apparently secure within its range (NatureServe). Population density varies widely with habitat. In San Luis Obispo County, density estimates varied from 42/ha in best habitat to 5/ha in marginal habitat.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no known threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The subspecies morroensis on the south side of Morro Bay, San Luis Obispo County, California, is listed by USFWS as Endangered.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The kangaroo rat seems to destroy much vegetation that it does not eat (Kelt 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Heerman's kangaroo rat has been used in research projects, and is a valuable lab species. It might also has some value as a pet, but has not been commercially exploited in the pet trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Heermann's Kangaroo Rat

Heermann's Kangaroo Rat, Dipodomys heermanni, is a species of rodent in the Heteromyidae family.

Dipodomys heermanni is endemic to California in the United States.[1]

References

  1. ^ a b Linzey, A. V. & NatureServe (Hammerson, G.) (2008). Dipodomys heermanni. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 27 March 2009.
  • Patton, J. L. 2005. Family Heteromyidae. Pp. 844-858 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: Dipodomys heermanni formerly included D. californicus, which Hall (1981) regarded as a subspecies of D. heermanni. Based on chromosomal and biochemical differences, Patton et al. (1976) and Patton (in Wilson and Reeder 1993, 2005) regarded D. heermanni and D. californicus as distinct species, as did Williams et al. (1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!