Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Desert Kangaroo Rats live in sand dunes in very hot, dry deserts of the southwestern United States, even below sea level in Death Valley, California. They need deep sand for their burrows, and will not dig them in rapidly shifting sand. Only one Kangaroo Rat lives in each burrow, except for a mother with her young. Desert Kangaroo Rats leave their burrows at night to forage for seeds and other plant food to eat, but they are also active by day, digging new tunnels. The underground network of tunnels includes a grass-lined nest chamber and storerooms for food the Kangaroo Rat carries home in its fur-lined cheek pouches. Desert Kangaroo Rats communicate by drumming their feet on the ground, tooth-chattering, and with squeals, grunts, and growling sounds.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Stephens, F., 1887.  Description of a new species of Dipodomys, with some account of its habits, p. 42.  The American Naturalist, 21:42-49.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Ranges through arid regions of the southwestern United States (California, Nevada, Utah, Arizona), extending southward into northwestern Mexico (Senora and Baja California).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Desert kangaroo rats inhabit dunes in the most arid regions of southwestern North America. They occur at elevations ranging from 60 meters below sea level in Death Valley, California, to 1,710 meters in Huntoon Valley, Nevada (Best et al., 1989).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Western and southern Nevada (and small section of northeastern California) south through southeastern California, extreme southwestern Utah, and western and southern Arizona to northeastern Baja California and Sonora; occupies all of dunes within its geograhic and elevational range (-60 m at Death Valley to 1710 m in Huntoon Valley, Mineral County, Nevada) (Best et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

All of the members of the genus Dipodomys have fur-lined cheek pouches that are used to transport seeds. D. deserti has four toes on each hind foot, and all of the feet are covered with long hairs. The upper parts of the body are pale brown to grayish (depending on the subspecies), and the underside is white. D. deserti has indistinct white spots over the eyes, behind the ears (which extends across the shoulder to the white underbelly), and an indistinct white band across the hips. There is also a darker spot of pelage at the base of facial vibrissae (Best, 1999).

Males average 342 mm in length and females average 331 mm in total length. The tail is usually 201 mm long in males and 195 mm in females, which accounts for more than ½ of the total length. In both sexes, the tail has long, white-tipped guard hairs along the top. D deserti has the thickest hair in their genus. Juvenile pelage resembles that of the adult, but is typically shorter and less dense.

Desert kangaroo rats are one of the most sexually dimorphic species of kangaroo rats, with males being about 2.5% larger than females. Males weigh between 91 and 148 g, whereas females weigh from 83 to 141 g

D. deserti posses huge auditory bullae (which frequently meet in the center of the dorsal surface of the skull, completely hiding the interparietal and supraoccipital bones). The tooth enamel is thick. The sides of the teeth lack grooves, and they have flatter skulls than any other member of the genus Dipodomys.

Populations do not exhibit much geographic variation, possibly because D. deserti inhabit a region that has relatively homogenous terrain and no permanent geographic barriers separating populations (Best 1989).

Range mass: 83 to 148 g.

Range length: 331 to 342 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.517 W.

  • Best, T. 1999. Desert Kangaroo Rat: *Dipodomys deserti*. Pp. 525-527 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 38 cm

Weight: 138 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 342 mm males; 331 mm females

Weight:
Range: 91-148 g males; 83-141 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Prefers low desert with sandy soil and sparse vegetation, particularly stabilized dune areas with vegetation. In the United States, inhabits dunes from -60 m (Death Valley, CA) to 1,710 m asl (Nevada).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Dipodomys deserti is adapted to live in the lowest, hottest, and most arid regions of North America (Nader, 1978). D. deserti is associated with areas that have substantial accumulations of wind driven sand. The number of sand dunes may limit the distribution of D. deserti, but they may be present in arid regions that have silty ground and are also known to occur at one locality in central Arizona where the soil is gravelly (Best et al., 1989).

In contrast to larger members of the genus, desert kangaroo rats occur in areas that receive little precipitation. To compensate for the extreme and prolonged aridity of the region, they are restricted to sand dunes, which harbor richer food sources.

D. deserti uses mainly un-vegetated mounds for burrow sites. Burrows are typically made in areas which are not highly ephemeral. On the surface, the burrow is lumpy, uneven and has many sloping entrances that lead down into the maze of passages. Some of these may be plugged with dirt. Underground chambers consist of multiple storerooms and a central nest. Within these chambers, D. deserti stores large amounts of mesquite pods and other plant seeds.

Desert kangaroo rats may form widely spaced colonies with clusters of 6-12 large burrows in each colony. However, these colonies rarely last for long periods of time and will be moved when food is scarce (Best et al., 1989).

Range elevation: -60 to 1,710 m.

Habitat Regions: terrestrial

Terrestrial Biomes: desert or dune

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Low deserts, sandy soil with sparse vegetation; alkali sink, shadscale scrub, and creosote bush scrub, Lower and Upper Sonoran life zones. Mostly restricted to deposits of deep wind-blown sand (sometimes including deposits formed as result of human activity); less abundant near edge of dunes; recorded from gravelly soil in one area in Arizona. Nests in burrows dug in mounds, usually under vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Desert kangaroo rats do not generally eat succulent plants. They prefer a diet of dried plant matter from the previous year, particularly leaves of sage, and seeds of the creosote bush and will also eat seeds. D. deserti will drink water when it is available, but can survive long periods of time without water, subsisting on their dry diet (Best et al., 1989).

Plant Foods: leaves; seeds, grains, and nuts

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on seeds and green vegetation (Burt and Grossenheider 1964). Stores large quantities of seeds underground. May feed opportunistically on moths, beetles, and other insects (Rust 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Although the ecosystem roles of this species have not specifically be reported, they are prey to a large number of carnivores, and so the availability of these rodents is likely to affect predator populations. Also, through their seed caching behavior, they disperse seeds.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Desert kangaroo rats serve as prey to snakes, hawks, owls, bobcats, spotted skunks, coyotes and foxes (Best, 1999).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Colonies may die out following successive years of drought. May form widely spaced colonies comprising 6-12 large burrows. Maximum recorded density about 3/ha. Basically solitary except female with young (Best et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Although little has been reported on the longevity of wild D. deserti, lifespan in captive individuals has ranged between 5.5 years to 8 years (Brattsrom, 1959; Nader, 1979)

Typical lifespan

Status: captivity:
5.5 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.6 years (captivity) Observations: In captivity, these animals may live up to 8.6 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system has not been reported. However, that the males are larger than the females suggests competition between males for mating. This type of male-male competition is usually associated with some males obtaining matings with more females than other males do. Copulatory plugs are formed after mating, and these are typically a form of post-copulatory competition between males. This suggests that females are likely to mate with multiple males. It seems likely, therefore, that the mating system is polygynadrous.

Mating System: polygynandrous (promiscuous)

D. deserti show no definitive courtship period because of their intense aggressive behavior. However, there is a brief precopulatory period when the male and female halt their aggressive behavior. Reproductive activity begins early in January and continues through early July. Adult females will come into estrus 10-15 days post-partum and accept mating attempts by males. (Best et al., 1989) Females who have mated already typically resist further advances by males. A few hours after copulation, a copulatory plug forms in the vaginal orifice. This persists for several days, preventing or inhibiting further mating.

The gestation period ranges from 29-32 days and the number of embryos ranges from 1-6. One or two litters are produced annually. Young are born headfirst and the mother assists delivery by pulling on the fetal membrane. After parturition, the mother will kick sand on the neonates, perhaps to dry them. (Best, 1999).

Sexual maturity probably occurs around 2 months of age, as is common for other species of Dipodomys.

Breeding season: Reproduction begins in January, and ends in early July.

Range number of offspring: 1 to 6.

Range gestation period: 29 to 32 days.

Average weaning age: 21 days.

Average age at sexual or reproductive maturity (female): 2 months.

Average age at sexual or reproductive maturity (male): 2 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 3.04 g.

Average number of offspring: 3.

The mass of D. deserti at birth ranges between 2.2 and 4.6 g. The neonate is approximately 52 mm in length, and is naked, with thin, pink, transparent skin. Complete pigmentation and furring appear by weaning, around 21 days of age (Best, 1999). Females nurse their young in the nest . Immediately after they are born, a female kicks sand onto her offspring. This may help to dry them off.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pregnant females have been recorded December-August in different areas. Gestation lasts 29-32 days. Litter size is 1-6 (usually 3-4). Possibly 2 litters per year. Young are weaned in 15-25 days, reach adult size in about 3 months. Reproductive success closely follows success of winter annuals (Best et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dipodomys deserti

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1839-08|EF156837|Dipodomys deserti| AACCGCTGACTATTCTCTACTAACCACAAAGACATCGGCACCCTGTACATAATCTTCGGTGCTTGGGCTGGGATGGTGGGAACAGGCCTA---AGCATCCTAATTCGAGCAGAATTGGGTCAACCTGGCTCCCTATTAGGAGAT---GACCAAATCTACAATGTAGTTGTTACTGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCCATCATAATTGGTGGCTTCGGAAACTGACTGGTCCCTCTGATA---ATTGGTGCGCCGGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTGCTACCCCCTTCTTTCCTCCTCCTCCTAGCATCATCCATGGTTGAATCAGGGGCTGGAACCGGGTGAACCGTCTACCCCCCTTTAGCGGGAAATCTAGCTCACGCCGGAGCATCTGTTGACCTG---ACTATCTTTTCTCTTCATCTAGCAGGTGTGTCATCAATCTTAGGTGCAATCAACTTTATCACAACCATCATTAATATAAAACCACCAGCTATATCACAATATCAAACACCCCTATTCGTCTGATCAGTCCTAATCACAGCCGTGCTTCTACTCCTGTCTCTTCCAGTATTAGCTGCA---GGAATTACCATACTTCTGACTGACCGAAACCTTAATACCACCTTTTTTGACCCAGCAGGAGGCGGAGACCCAGTACTATATCAACACTTATTTTGATTCTTCGGGCACCCAGAAGTCTACATCCTAATCCTACCCGGATTTGGAATAATTTCCCATATCGTAACATACTACTCTGGAAAAAAA---GAACCCTTCGGCTATATAGGAATAGTATGAGCCATAATGTCCATCGGCTTCCTAGGATTCATCGTTTGAGCGCATCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dipodomys deserti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

This species has no special conservation status, but has been reported to suffer from automobile traffic. However, there is a positive impact on this species from agriculture, which may outweigh the negative effect of auto traffic.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is very common in suitable habitat. Density varies seasonally, but is typically 0.2-1.4 individuals/ha.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No known major threats. In some areas, this species is threatened by cars and recreational vehicles on dune areas. This species can live in disturbed areas such as agricultural zones were the soil has been overturned.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no reported negative effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no reported positive effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Desert Kangaroo Rat

The Desert Kangaroo Rat, Dipodomys deserti, is a species of rodent in the Heteromyidae family.

Range

the Desert Kangaroo Rat is found in arid parts of southwestern North America which include Death Valley, Great Basin, Mojave Desert and Sonoran deserts.[2]

Description

The Desert Kangaroo Rat, Dipodomys deserti, lives and mostly sleeps in a den in the day which is sealed off at extreme temperatures.[2] As they do not have access to water due to their desert habitat for long periods of time, they clean themselves by sand during the night and their fluid needs are derived directly the moisture contained in their mainly granivorous diet.[3]

References

  1. ^ Linzey, A. V., Timm, R., Álvarez-Castañeda, S. T., Castro-Arellano, I. & Lacher, T. (2008). Dipodomys deserti. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 27 March 2009.
  2. ^ a b Rieth, W. and Boykin, K.G. "Southwest Regional Gap Analysis Wildlife Habitat Relationship - Desert Kangaroo Rat" New Mexico Cooperative Fish & Wildlife Research Unit - New Mexico State University. 2004-2007. Accessed 2009-06-27.
  3. ^ Timberlake, W. and Hoffman, C.M. "How does the ecological foraging behavior of desert kangaroo rats (Dipodomys deserti) relate to their behavior on radial mazes?" Animal Learning & Behavior. Vol. 30, No. 4, 342-354, 2002. Accessed 2009-06-27.
  • Patton, J. L. 2005. Family Heteromyidae. Pp. 844-858 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!