Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Very little is known about these bears even though they are one of the largest carnivores in South America. They are believed to be diurnal (6) and have been observed to make nests in the trees whilst foraging or resting (4). Like other bears they are omnivores although vegetation appears to make up the majority of the diet, particularly fruit of plants from the Bromelid family (5). These bears are an important component of the ecosystem they inhabit, distributing a wide variety of seeds (5). The mating season runs from April to June, the female alone cares for the litter of 1-3 cubs that are born between November and February (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Spectacled bears are so named due to the white facial markings that encircle the eyes (2). These are relatively small bears with a dense black or dark brown coat; the white, or creamy-yellow, facial markings also extend down the chest and the pattern is unique to each individual (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Endemic to the Tropical Andes, the Andean bear is the only extant species of bear in South America. The northern limit of its range are Sierra de Perijá, Macizo de El Tamá and Cordillera de Mérida in Venezuela; southward it inhabits the Occidental, Central and Oriental Colombian ranges; both eastern and western slopes of the Ecuadorian Andes; all three Andean ranges of Peru, including a portion of the Pacific coastal desert; and the eastern slope of the Andes in Bolivia.

Historical reports include the Panama regions of El Darien (Jorgenson 1984) and Caledonia (Global Biodiversity Information Facility Data Portal 2008) but recent surveys of suspected populations in El Darien (Goldstein et al. 2007), as well as in northern Argentina, have not yielded conclusive evidence of bear presence.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tremarctos ornatus are the only bears to live in South America. Spectacled bears live along the slopes of the Andes mountains from Venezuela to Peru. Some have been found in eastern Panama and northern Argentina.

Biogeographic Regions: neotropical (Native )

  • Nowak, R. 1997. "Walker's Mammals of the World" (On-line). Accessed November 6, 2001 at http://www.press.jhu.edu/books/walkers_mammals_of_the_world/special.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout the Andes mountain range in South America, from Venezuela to the north of Argentina (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Spectacled bears are small, shaggy, and black. They have yellow rings around the eyes and often a lighter colored, usually cream, muzzle, throat, and chest. The markings are variable and can extend to the throat in some, the chest in others, or be totally absent. The coat ranges from black, brown, or even reddish in color. This species gets in name from the circles around the eyes which make the bears appear as though they are wearing spectacles. Females are 30%-40% smaller than males. These bears have plantigrade feet, where both the heel and toe touch the ground as they walk. One unique characteristic of these bears is that they have 13 pairs of ribs while other bear species have 14 pairs.

Range mass: 100 to 155 kg.

Range length: 1.5 to 1.8 m.

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Andean bears occupy a great variety of habitats, from desert-scrub to forests to high altitude grasslands, ranging in elevation from 250 to 4,750 m asl. They are reported to move along an altitudinal gradient among different habitat types, following seasonal patterns of food resources (Peyton 1980, Suarez 1988, Velez 1999, Paisley 2001, Cuesta et al. 2003). On the slopes of the eastern Andes, bear populations exist from the snowline down to 300 m asl in the Tapo-Caparo National Park in Venezuela, 1,200 m asl in Colombia, 600 m asl in Ecuador and Peru, and 550 m asl in Bolivia; on the western Andes of Peru they range down to 250 m asl (Peyton 1999a, Goldstein 2006)

With the notable exception of the dry forest-scrub habitat in north coastal Peru (Peyton 1999b), Andean bears are most commonly found in high elevation elfin forests, upper montane humid forest, and humid grasslands (Peyton 1987a,b, Velez 1999, Cuesta et al. 2003, Rios-Uzeda et al. 2005). Within this range, habitat preferences are uncertain. In portions of the central Andes in Bolivia, Andean bears were reported to select wet montane / foothill forests at lower elevations (Rumiz et al. 1999); elsewhere in Bolivia they heavily used cloud forests of the upper slopes of the Andes and rarely used dry montane forests (Rios-Uzeda et al. 2005). Bear presence can readily be identified in the high altitude grasslands due to the easier visibility and the durability of the obvious feeding sign, but these grasslands may not sustain bears year-round without access to forest (Suarez 1985, Paisley 2001).

Andean bears are omnivores, feeding mainly on vegetative material such as fruits and succulent plants, and occasionally meat. Common dietary mainstays throughout their distribution are the succulent parts of plants of the families Bromeliaceae and Arecaceae (Peyton 1980, Suarez 1988, Mondolfi 1989). However, food habits change from site to site and even within sites depending on the availability of particular resources. Tree and ground nests are used for resting where Andean bears feed on fruits high in the tree canopy and at sites where bears consume animal (e.g., livestock) carcasses (Goldstein 1991, Velez 1999). Activity patterns range from strictly diurnal for wild bears in Bolivia (Paisley and Garshelis 2006a) to mixed diurnal and nocturnal for reintroduced bears in Ecuador (Castellanos et al. 2005). As food is available year-round in all parts of their range, Andean bears do not hibernate. Based on the first few individuals of this species to be monitored using ground telemetry in Bolivia (Paisley and Garshelis 2006b) and Ecuador (Castellanos 2007 and pers. com. 2008), home ranges overlap to a high degree and minimum home range sizes vary from 10 to 160 km² (although these are underestimates, as the bears were regularly out of range of radiotelemetry in both studies).

Information on reproduction in this species is limited. Litter size is typically two cubs. The timing of births in the wild has rarely been observed, but in captivity birthing varies with latitude (Garshelis 2004). Presumed mating pairs have been observed in the wild during March-October.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spectacled bears seem to prefer densely forested areas, especially humid forests between 1,900 and 2,350 meters. However, they have been reported from habitats as diverse as rain forest, cloud forest, dry forest, steppe lands, and coastal scrub desert.

Range elevation: 180 to 4200 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest ; mountains

  • International Association for Bear Research and Management, 1999. "Bear Species Description" (On-line). Accessed Dec. 3, 2001 at http://www.bearbiology.com/spdesc.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spectacled bears have the reputation of being adaptable as they are found in a wide range of habitats and altitudes throughout the mountain range (2). They are found in cloud forests, high altitude grasslands and scrub desert (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

For the most part T. ornatus is an omnivore (but almost exclusively vegetarian) with a preference for fruit, particularly those in the family Bromeliaceae. Plants in this family can make up as much as 50% of spectacled bears' diet. These bears climb large cacti to get to the fruit at the top. They also strip the bark off of trees to eat. These bears have been known to climb over 10 meters to gather food and are incredibly mobile traveling from tree to tree in search of food. They may stay in one fruit tree for 3 to 4 days awaiting the ripening period. They eat a variety of food, depending what is available in the season. Their diet includes berries, cacti, tree shrubs, honey, and sugarcane. If necessary these bears will eat small rodents, birds, or insects and will kill cattle if other food is not available. Roughly 4% of their diet is animal matter. Spectacled bears have extremely strong jaws allowing them to eat foods other animals cannot, such as tree bark and bromeliad hearts.

Animal Foods: birds; mammals; insects

Plant Foods: wood, bark, or stems; fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Spectacled bears are very important to the floral ecology of the forests they inhabit. They are also an important disperser of the tree seeds they consume.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Tremarctos ornatus preys on:
Insecta
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Lifespan in the wild is unknown, but in captivity Tremarctos ornatus can reach 20-25 years. One bear lived for 36 years and 5 months in captivity.

Range lifespan

Status: captivity:
36 (high) years.

Average lifespan

Status: wild:
25 years.

Typical lifespan

Status: captivity:
20 to 25 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 39 years (captivity) Observations: One wild born animal was about 39 years of age when it died in captivity (Richard Weigl 2005). These animals may feature delayed implantation (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating pairs usually stay together one or two weeks, copulating many times. While the female is in estrus, which only occurs for one to five days, the male and female go through a ritual of mock fighting and playing until the female is ready to mate.

Mating System: polygynous

Details of the reproductive behavior of spectacled bears in the wild are few. Mating usually takes place between April and June, and the litters are born between November and February. When the egg is fertilized, it divides a few times, and then floats freely in the uterus for several months. This is called delayed implantation, and it helps to ensure that the young are born when food is available. Gestation length in captivity is about 8 months. The litters range from one to three young. At birth, cubs are blind and weigh between 300-360 grams.

Breeding season: April-June

Range number of offspring: 1 to 3.

Average gestation period: 8 months.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Average age at sexual or reproductive maturity (female): 4 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 320 g.

Average gestation period: 228 days.

Average number of offspring: 1.5.

Cubs are taken care of by their mothers, but grow quickly. After about a month cubs are able to go out with their mothers in search of food and after 6-8 months they can go off on their own.

Parental Investment: altricial

  • 2001. "All About Bears" (On-line). Accessed Dec. 3, 2001 at http://www.bears-bears.org/index.htm.
  • International Association for Bear Research and Management, 1999. "Bear Species Description" (On-line). Accessed Dec. 3, 2001 at http://www.bearbiology.com/spdesc.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tremarctos ornatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1780-08|NC_009969|Tremarctos ornatus| GACCGATGACTATTTTCCACAAACCATAAAGACATTGGTACTCTCTATATTCTATTCGGTGCATGAGCCGGAATAGTAGGTACTGCCCTC---AGCCTTCTAATCCGCGCTGAACTAGGTCAACCCGGAGCCCTGTTAGGGGAT---GATCAAATCTATAACGTGGTCGTAACTGCCCATGCATTCGTAATAATCTTCTTTATAGTAATGCCTATTATAATCGGAGGTTTTGGAAACTGATTAGTGCCTTTAATA---ATTGGCGCTCCCGATATAGCATTCCCTCGAATAAACAATATGAGTTTCTGATTACTGCCACCATCCTTCCTACTTCTTCTAGCCTCTTCCATAGTAGAAGCAGGTGCAGGGACTGGTTGAACTGTTTACCCCCCTCTAGCGGGCAATCTAGCCCATGCAGGAGCATCAGTAGACCTA---ACAATTTTTTCCCTACATTTAGCAGGCGTTTCCTCCATTCTAGGAGCTATTAACTTTATTACCACTATTATCAATATGAAGCCTCCTGCAATATCTCAATACCAAACTCCTCTGTTCGTATGATCCGTCCTAATTACGGCGGTACTTCTTCTCTTATCCTTACCAGTTCTGGCAGCT---GGGATTACTATGCTGCTGACAGATCGAAACCTCAACACTACTTTCTTTGATCCGGCAGGAGGAGGGGACCCCATTCTGTACCAACACTTGTTCTGATTCTTTGGGCACCCAGAGGTATATATCCTAATTCTTCCTGGATTCGGGATAATCTCACACATCGTCACGTACTATTCAGGGAAAAAA---GAACCCTTTGGTTATATAGGGATGGTTTGAGCAATGATATCCATCGGATTCTTAGGTTTCATCGTATGAGCCCATCACATATTCACTGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tremarctos ornatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Goldstein, I., Velez-Liendo, X., Paisley, S. & Garshelis, D.L. (IUCN SSC Bear Specialist Group)

Reviewer/s
McLellan, B.N. & Garshelis, D.L. (Bear Red List Authority)

Contributor/s
The following people assisted with range mapping: Velez-Liendo, X., Amanzo, J., Riveros, J.C., Garcia-Rangel, S. & Secada, L.

Justification
It is likely that Andean bear populations will decline by more than 30% within a 30-year window that includes both the past and future. Habitat loss continues at a rate of 2-4% per year, and the level of exploitation is thought to be high in many portions of the range. These threats have not ceased, nor are there any indications that they will diminish in the near future. Even though many protected areas have been established over the past 20 years and more are expected to be added in the next few years, those areas protect only a fraction of the remaining Andean bear habitat. Moreover, even within protected areas, bears are vulnerable to habitat destruction and poaching because many areas are inadequately patrolled. Road development and the advance of agriculture are particularly insidious because they diminish and fragment habitat, and also attract bears, which are killed when depredating crops. Increasing mining and oil exploitation pose additional significant threats to this species.

Based just on trends in human population density (and the deterioration of habitat and increased exploitation of animal populations that this inevitably entails), Cardillo et al. (2004) listed Andean bears among the Carnivores that are most likely to move toward extinction. By 2030, they predict that this species would meet the IUCN criteria for Endangered.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Populations of Andean bears may be in decline. Habitat destruction and fragmentation due to agricultural growth are the biggest causes of these bears' decline. Hunting by sportsmen and landowners are also contributing factors, dating back to the 1800's, when the Spanish first arrived in South America. Poachers killed the bear because of the large market for bear paws, where one paw can bring in between $10 and $20 U.S. dollars. Around 1980 these bears were not thought to be in much danger because they are so adaptable, many using habitats people could not access. It has been discovered since then that surviving populations are fragmentary and restricted to isolated forests on mountainsides. Protection for spectacled bears is minimal. National parks of South America have a low budget and the government supports the settler farmers. Some farmers even have permission to use the land that is protected. Scientists are worried because inbreeding has started to occur in Peru, bringing about a decrease in adult size and the size of litters. Education of the local people is important to conservationists to get public support.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU – A2bc) on the IUCN Red List 2002 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the late 1990s, a range map was produced and an approximate area of occupancy estimated (260,000 km²). By applying minimum and median density estimates from American black bears (Ursus americanus) to this area, Peyton et al. (1998) generated a rough range-wide population estimate (>20,000 Andean bears). Ruiz-Garcia (2003) attempted to obtain a population estimate by applying mutation rates to current genetic heterozygosity for bears in Venezuela, Colombia and Ecuador (assuming no genetic bottleneck); extrapolating this range-wide yielded a very wide span of estimates (approximately 5,000 to 30,000 breeding bears). Other investigators obtained population estimates from small study areas, using DNA fingerprinting (in a protected area in Ecuador; Viteri and Waits 2005) and camera trapping (in a protected area in Bolivia; Rios-Uzeda et al. 2007), but the sample sizes and area of coverage were too small to extrapolate further. Thus, valid country-wide or range-wide population estimates are still lacking.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Habitat loss and fragmentation, poaching, and the lack of knowledge about the distribution and status of the Andean bear are the principal threats to this species (Peyton 1999a, Rodriguez et al. 2003). Much of the range of the Andean bear has been fragmented by human activities, largely resulting from the expansion of the agricultural frontier. In some areas, mining, road development and oil exploitation are becoming a greater menace to Andean bear populations as well as to local communities, due to land expropriation, loss of habitat connectivity, and water and soil contamination (Peyton 1999a, Young and Leon 1999).

Many Andean bear populations are isolated in small to medium-sized patches of intact habitat, particularly in the northern part of the range (Yerena et al. 2003, Kattan et al. 2004). The situation tends to improve towards the southern range, with some large patches of wilderness still remaining (Peyton 1999a). Nevertheless, human population growth and national development plans throughout the Tropical Andes continue to be an important cause of habitat fragmentation and to threaten the connectivity among remaining wilderness patches.

Poaching is a serious threat throughout the Andean bear range. Bears are often killed after damaging crops, particularly maize, or after purportedly killing livestock (Goldstein 1991, Peyton 1999b, Rumiz and Salazar 1999, Suarez 1999, Castellanos 2002, Morales 2003). Also, Andean bear products are used for medicinal or ritual purposes and at some localities Andean bear meat is highly prized (Yerena 1999). Live bears are also sometimes captured and sold (Jorgenson and Sandoval 2005). Human induced mortality endangers the viability of small remnant populations.

Lack of knowledge about the distribution and status is a problem throughout the region. In many areas, information about the status of Andean bears is outdated or, particularly in the southern portion of the range, simply non-existent. The absence of knowledge makes it difficult to develop realistic management plans for the conservation of this species, or to monitor changes in its distribution (reflective of changes in population status).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Habitat destruction has been rife in the area that these bears inhabit and it is likely to have been one of the major causes of their decline in numbers (5). In addition, spectacled bears can be persecuted by local farmers who blame them for killing cattle and for destroying maize crops (2). Sadly, habitat fragmentation is bringing bears and humans into greater proximity, leading to increased human-bear conflict (6). These bears are also hunted for their meat, skin, fat and claws, which are all in demand locally (7). The gall bladders are occasionally marketed, being of value in traditional oriental medicine, and can fetch a high price on the international market; recent estimates put the price at US$150 for one, which is five times the average monthly wage in Ecuador (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In 1998, Peyton et al. reported that <20% (48,000 km²) of the range was legally protected, including 58 national parks, reserves or sanctuaries. Since then, several of the parks have been enlarged and new ones have been established. However, many of these contain habitats that are not adequate, and others are still too small or isolated to sustain viable bear populations, prompting efforts to develop corridors to link groups of protected areas (Yerena 1999, Yerena et al. 2003, Peyton 1999a,b, Jorgenson and Sandoval 2005).

Studies on the distribution, frequency and intensity of Andean bear-human conflicts have been carried out in some areas in order to better understand these situations and thereby develop management measures to reduce conflicts and the consequent killing of bears (Goldstein et al. 2006). Management plans to reduce bear-cattle conflicts have been developed at the Oyacachi, Ecuador, based on predation probability models (Goldstein 2006).

Workshops have been conducted in several of the range countries to train researchers and personnel from national parks on survey techniques, development of habitat models, and general knowledge about the ecology, distribution and status of the species (Goldstein 2006).

Andean bears are listed on Appendix I of CITES and are protected through national legislation in each range country. However, there are loopholes in these laws by which bears can be (and thus frequently are) killed or removed from the wild (Orejuela and Jorgenson 1999, Peyton 1999b, Rumiz and Salazar 1999, Suarez 1999, Yerena 1999, Jorgenson and Sandoval 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Protection of the spectacled bear is nominal in much of their range; they are legally protected but the enforcement is under-funded (7). International trade is banned by the listing of this bear on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). There are a number of national parks that contain spectacled bears but these often vast areas are massively understaffed and therefore ineffective for their conservation (7). Lincoln Park Zoo in Chicago (8) coordinates the International Studbook for this species and a captive breeding programme is also underway in Venezuela (7). Before effective conservation measures can be put into place more information is needed on this poorly understood species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

South American farmers have persecuted these bears for attacking their livestock. Some bears have been known to kill a cow every day until they were killed. Farmers also consider the bears to be a threat to maize fields. Special pesticides are sprayed onto the fields to keep the bears away. Sometimes whole families of bears are destroyed by these poisons. The actual damage done from these bears may be overestimated and in reality is caused by birds and forest rodents (Ward and Kynaston, 1995).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These bears are hunted for their meat, fur, fat, grease, and bile. The meat is especially liked in northern Peru. The fat is said to cure rheumatism and arthritis.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spectacled bear

Contents

The spectacled bear (Tremarctos ornatus), also known as the Andean bear and locally as ukuko, jukumari or ucumari, is the last remaining short-faced bear (subfamily Tremarctinae) and the closest living relative to the Florida spectacled bear[2] and short-faced bears of the Middle Pleistocene to Late Pleistocene age.[3][4]

Description

The spectacled bear is a mid-sized species of bear native to South America. It has black fur with a distinctive beige-coloured marking across its face and upper chest, though not all Andean bears have "spectacle" markings. Males are a third larger than females in dimensions and sometimes twice their weight.[5] Males can weigh 100 – 200 kilograms (220 – 440 lb), and females 35 –82 kilograms (77 – 181 lb).[6] Length can range from 120 to 200 cm (47–79 in) long and shoulder height from 60 to 90 cm (24–30 in).[7][8][9] They are found in several areas of northern and western South America, including eastern Panama,[10] western Venezuela,[11] Colombia, Ecuador, Peru, western Bolivia, and northwestern Argentina. Spectacled bears are the only surviving species of bear native to South America, and the only surviving member of the subfamily Tremarctinae. Their survival has depended mostly on their ability to climb even the tallest trees of the Andes.

Naming and etymology

Tremarctos ornatus is commonly referred to in English as the "spectacled bear", a reference to the light colouring on its chest, neck and face which may resemble eyeglasses in some individuals, or the "Andean bear" for its distribution along the Andes.

The root trem- comes from a Greek word meaning "hole;" arctos is the Greek word for "bear." Tremarctos is a reference to an unusual hole on the animal's humerus. Ornatus, Latin for "decorated", is a reference to the markings that give the bear its common English name.

Behavior and diet

A spectacled bear skull
Spectacled bear at a zoo in Venezuela

Although the bears tend to isolate themselves from one another to avoid competition, they are non-territorial. When encountered by humans or other spectacled bears, they will react in a docile but cautious manner, unless the intruder is seen as a threat or a mother's cubs are endangered. Like other bears, mothers are protective of their young and have attacked poachers. However, no deaths have been recorded by South American state governments. They usually attempt to retreat from humans, often by climbing trees.[12] Once up a tree, they often build a platform, perhaps to aid in concealment, as well as to rest and store food on.[12] The only predators of cubs are cougars and jaguars, generally the only threat against adult bears is humans.[13]

Spectacled bears are more herbivorous than most other bears; normally about 5 to 7% of their diet is meat. The most common foods for these bears include cactus, palm nuts, orchid bulbs, fallen fruit on the forest floor and unopened palm leaves. Much of this vegetation is very tough to open or digest for most animals and the bear is one of the few to exploit these food sources. These bears also eat sugarcane, honey and corn and have been known to travel above the tree line for berries and bromeliads. Animal prey is usually quite small but these bears can predate adult deer, llama and domestic cattle and horses.[14] Animal prey has included rabbits, mice, other rodents, birds at the nest (especially larger, ground-nesting birds), arthropods and carrion.[15] They are occasionally accused of killing livestock, especially cattle, and raiding corn fields.[12] Allegedly, some bears become habituated to eating cattle but the bears are actually more likely to eat cattle as carrion and some farmers may accidentally assume the spectacled bear killed them. Due to fear of loss of stock, bears may be killed on sight.[16][17]


Conservation

A spectacled bear at the Houston Zoo.

The spectacled bear population is under threat for a number of reasons. The bears are hunted by locals due to a belief they will eat livestock (although spectacled bears do not eat large quantities of meat). The gall bladders of spectacled bears are also valued in traditional Chinese medicine and can fetch a high price on the international market. Extensive logging and farming have led to a loss of habitat for the bears. As the bear's food sources have been disappearing, it relies on crops for food. For this reason, farmers see the bears as competition and hunt them. Legislation against hunting the bears exists, but is rarely enforced.[18]

Media

In the documentary Paddington Bear: The Early Years, British actor Stephen Fry encounters a Spectacled bear called Yogi, who was kept in a small cage by Andean villagers (see also Paddington Bear). Fry bartered with the villagers to have the bear released and it was taken to an enclosure in Machu Picchu. Fry's interest in the bears led to the follow-up documentary, Stephen Fry and the Spectacled Bears, and he also wrote and published his experiences in Rescuing the Spectacled Bear: A Peruvian Diary.

In the BBC television programme Serious Andes a team of eight teenagers build a pre-release enclosure for two spectacled bears before returning them to the wild. The BBC documentary "Spectacled Bears: Shadows of the Forest" looks at some of the bear research being done in Peru and Ecuador and what the researchers are discovering.

References

  1. ^ Goldstein, I., Velez-Liendo, X., Paisley, S. & Garshelis, D.L. (2008). Tremarctos ornatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 27 January 2009. Listed as Vulnerable (VU A4cd)
  2. ^ Krause, J.; Unger, T.; Noçon, A.; Malaspinas, A.; Kolokotronis, S.; Stiller, M.; Soibelzon, L.; Spriggs, H.; Dear, P. H.; Briggs, A. W.; Bray, S. C. E.; O'Brien, S. J.; Rabeder, G.; Matheus, P.; Cooper, A.; Slatkin, M.; Pääbo, S.; Hofreiter, M. (2008-07-28). "Mitochondrial genomes reveal an explosive radiation of extinct and extant bears near the Miocene-Pliocene boundary". BMC Evolutionary Biology 8 (220): 220. doi:10.1186/1471-2148-8-220. PMC 2518930. PMID 18662376. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2518930. 
  3. ^ Spectacled Bear. Grizzly Bear.org. Retrieved on 2011-09-26.
  4. ^ Bear Planet. Bear Planet. Retrieved on 2011-09-26.
  5. ^ Brown, Gary (1996). Great Bear Almanac. p. 340. ISBN 1-55821-474-7. 
  6. ^ Spectacled, or Andean, Bear – National Zoo| FONZ. Nationalzoo.si.edu. Retrieved on 2011-09-26.
  7. ^ Spectacled bear videos, photos and facts – Tremarctos ornatus. ARKive. Retrieved on 2011-09-26.
  8. ^ Spectacled Bear. Brazilianfauna.com. Retrieved on 2011-09-26.
  9. ^ Maurice Burton; Robert Burton (1970). The international wildlife encyclopedia. Marshall Cavendish. pp. 2470–. ISBN 978-0-7614-7266-7. http://books.google.com/books?id=y9TsB3id66cC&pg=PA2470. Retrieved 26 September 2011. 
  10. ^ Bunnell, Fred (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. p. 96. ISBN 0-87196-871-1. 
  11. ^ "Spectacled bear, Andean bear, ucumari". BBC – Science & Nature – Wildfacts. BBC. http://www.bbc.co.uk/nature/wildfacts/factfiles/11.shtml. 
  12. ^ a b c LaFee, Scott (2009-09-07). "Hanging on, bearly: South America's only bear species struggles to avoid extinction". SignOnSanDiego.Com. The San Diego Union-Tribune. http://www3.signonsandiego.com/stories/2009/sep/07/wild907/?science&zIndex=161647. Retrieved 2009-09-09. 
  13. ^ Spectacled Bear. rosamondgiffordzoo.org
  14. ^ Spectacled bear Tremarctos ornatus – Natural Diet (Literature Reports). Wildlife1.wildlifeinformation.org. Retrieved on 2011-09-26.
  15. ^ Spectacled Bears. Bears Of The World. Retrieved on 2011-09-26.
  16. ^ Peru :: Who We Are. Spectacled Bear Conservation. Retrieved on 2011-09-26.
  17. ^ Carnivora – Spectacled Bear – Tremarctos ornatus. Carnivoraforum.com. Retrieved on 2011-09-26.
  18. ^ "Endangered Bears," The Pet Wiki, retrieved Feb. 14, 2012.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!