Overview

Brief Summary

Biology

Sloth bears are mainly solitary except for mothers with their cubs. They occupy home ranges that are marked by stripping bark from trees, although intruders appear to be tolerated. Adults are generally active throughout both the day and night, except for females with cubs, which seem to restrict their activity to daylight hours. The mating season is recorded to run from June to July, although it may run year-round in some areas. A number of males will follow a receptive female around for days, mating with her in turn, and generally lacking aggression between each other (5). Females give birth (usually to two cubs) after a gestation period of around six to seven months (5) (6), in a den located in the base of a hollow tree. She will remain with her cubs for the first three months and once they are able to leave the safety of the den they will spend the majority of the time riding on her back. Cubs stay with their mother for up to 2.5 years and females therefore only breed at two or three year intervals (5). Sloth bears are unique amongst bears in that the majority of their diet is composed of insects, particularly termites and ants (5). Breaking open a termite mound with its strong front claws, the sloth bear will then insert its snout and blow away earth and dust before sucking the termites into their mouth (4). The lack of upper incisors creates a channel through which the bear sucks insects, and they are able to voluntarily close their nostrils, which prevents the inhalation of dust (5). Sloth bears also feed on honey, enduring the stings of bees to obtain honeycombs (2), as well as eggs, carrion, vegetation and fruits when in season (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The small sloth bear is unique amongst the bears, as insects are its main food source (4). It has a long, shaggy, coat with particularly long hair over the shoulders (5), and is typically black, although some individuals with cinnamon or reddish coats have been seen (5) (6). A distinctive pale whitish or cream marking on the chest forms a 'U' or 'Y' shape (2), and the relatively long, mobile muzzle is also pale in colour (5) (6). The snout of the sloth bear, along with its bare lips, and lack of upper incisors, are adaptations for its insect-based diet. The front feet are turned inwards and have large and slightly curved ivory claws for digging (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Sloth bears are present in India, Nepal, Sri Lanka, and Bhutan. Until recently they were also known to occur in Bangladesh, but their continued existence there is uncertain: the last documented records are from the late 1990s. In historic times, sloth bears never ranged further west than Gujarat, India, and probably no further east than the states of northeastern India, although some unverified reports suggested that they once occurred in the southwestern corner of present day Myanmar (Erdbrink 1953). Although still widely present in its former range, its distribution is now highly fragmented.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Melursus ursinus is found throughout India, Sri Lanka, and further north into Bangladesh, Nepal, and Bhutan. This species was fairly common in India and Sri Lanka until as recently as 20 years ago, now they are harder to find (Ward and Kynaston, 1995).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found on the Indian subcontinent in Nepal, Bhutan, Bangladesh, India and Sri Lanka. Two separate subspecies are recognised; the Sri Lankan sloth bear Melursus ursinus inornatus and the Indian sloth bear M. u. ursinus (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sloth bears have a shaggy black coat, especially over the shoulders. Brown and grey hairs found on the coat give the appearance of a cinnamon color on some bears. This heavy coat may be an adaptation to deal with cold. These bears have long snouts, which are similar to but less elongate than those of anteaters. The molars are broad and flat, representing a trend away from carnivory. The body structure of M. ursinus is awkward with huge feet and enormous claws. Sloth bears are nevertheless capable of galloping faster than a person can run. Compared to the body, the face appears naked and grey. They have extremely large tongues, a mobile snout, and they can voluntarily open and close their nostrils, all of which prove helpful with their diets. These bears have a light "U" or "Y" shaped patch on their chests. The color of these markings varies from white to yellow to chesnut brown. Females can weigh between 55 and 95 kg. Males are 30 to 40% heavier than females and can weigh between 80 and 140 kg. Adults measure 60 to 90 cm at the shoulder.

Range mass: 55 to 140 kg.

Range length: 1.5 to 1.9 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 47.064 W.

  • Sanderson, I. 1972. Living Mammals of the World. Garden City, New York: Doubleday & Company.
  • Blomstrom, D. 2000. "Sloth Bear" (On-line). Accessed October 30, 2001 at http://www.geobop.com/Mammals/Carnivora/Ursidae/Ursus_ursinus/.
  • International Association for Bear Research and Management (IBA), September 22, 1999. "Bear Species Descriptions" (On-line). Accessed October 30, 2001 at http://www.bearbiology.com/specdesc.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Sloth bears subsist primarily on termites, ants, and fruits. This is the only species of bear adapted specifically for myrmecophagy (ant and termite-eating; Garshelis et al. 1999b, Sacco and Van Valkenburgh 2004). The ratio of insects to fruits in the diet varies seasonally and geographically (Baskaran et al. 1997, Joshi et al. 1997, Bargali et al. 2004, Sreekumar and Balakrishnan 2002).

Sloth bears occupy a wide range of habitats on the Indian mainland including wet or dry tropical forests, savannas, scrublands, and grasslands (Joshi et al. 1995, Sreekumar and Balakrishnan 2002, Akhtar et al. 2004, Ratnayeke et al. in press). They are primarily a lowland species. Most sloth bear range in India and Nepal is limited to habitats below 1,500 m, although the species may occur as high as 2,000 m in the forests of the Western Ghats (Johnsingh 2003). In Sri Lanka, sloth bears are confined to the remaining dry forests in the north and eastern parts of the island, mostly below 300 m (Ratnayeke et al. 2006). In areas where cover is sparse, and where daytime temperatures are high (a large part of the range), the bear is largely nocturnal or crepuscular and will shelter in rock outcrops, thickets, and tree cavities during the heat of the day. Although sloth bears may be active during the day in protected areas, they tend to be almost exclusively nocturnal in disturbed and fragmented forests interspersed with human habitations (Akhtar et al. 2004).

Studies in Nepal and Sri Lanka suggest that sloth bears avoid areas where human disturbance is high, so crop depredation by sloth bears is typically rare (Joshi et al. 1995, Ratnayeke et al. in press). Conversely, in some parts of India, sloth bears routinely raid peanut, maize, and fruit crops (e.g., Changani 2002). Chauhan (2006) suggests that such crop depredations may occur because these habitats are severely affected by human exploitation, including the extraction of several food sources for bears.

Sloth bears typically breed during June-July, and females give birth, usually to one or two cubs, during November –January (Laurie and Seidensticker 1977, Joshi et al. 1999, Chauhan et al. 2003). Cubs typically ride on the mother’s back during their first nine months, presumably to reduce the risk of predation. Cubs remain with their mothers for 1.5–2.5 years.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sloth bears live mainly in tropical areas. They can be found in forested areas and grasslands. They are more frequently found at lower elevations and seem to prefer drier forests and areas with rocky outcrops (Ward and Kynaston, 1995; IBA, 1999).

Habitat Regions: tropical

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sloth bears are found in a wide variety of habitats on the subcontinent, from grasslands and thorn scrub to evergreen forest (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sloth bears are omnivorous, although their diet typically includes a large proportion of insect foods. Their diet includes leaves, honey, flowers, and fruits. During the months of March through June, fruits are more common and on occasion may make up 50% of these bears' diet. They prefer termite or bee nests and will do everything to get at them. While raiding termite nests these bears insert their long snouts into the nest, rip open the nest with their long claws, blow away the earth and dust, then feast on their prize by vacuuming the termites into their mouths. This sucking action is also accompanied with a series of puffings and belchings which can be heard up to 185 m away. The ability to voluntarily open and close the nostrils prevents the inhalation of dust during this process. Termites are a very secure food source, as they are present all year round. When nearby populated areas sloth bears feed on cultivated crops like sugar cane and maize (Ward and Kynaston, 1995; Sanderson, 1972).

Animal Foods: insects

Plant Foods: leaves; fruit; flowers

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Since these bears include some fruit in their diet, they disperse the seeds of the fruit they eat. Also, by feeding on numerous amounts of termites, they keep the termite populations in check (Ward and Kynaston, 1995).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

These bears only risk predation from large predators such as tigers and leopards. Female sloth bears with cubs will occasionally vary from their nocturnal tendencies to avoid these nocturnal predators (Ward and Kynaston, 1995).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Melursus ursinus preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Melursus ursinus is prey of:
Ursinae
Panthera pardus
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Captive sloth bears have lived up to 40 years (Ward and Kynaston, 1995).

Range lifespan

Status: captivity:
40 (high) years.

Average lifespan

Status: captivity:
30.0 years.

Average lifespan

Status: captivity:
40.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.3 years (captivity) Observations: It has been reported that these animals can live up to 40 years in captivity (Ronald Nowak 1999), which has not been verified. Record longevity in captivity belongs to one wild born female that was 33.3 years of age when she died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Sloth bears tend to be very noisy during mating (Blomstrom, 2000).

Information on the reproductive behavior of M. ursinus varies. Some studies have them mating mostly between May and July, whereas others report mating and giving birth at any tiime of year. These differences may be due to the location of the bears studied. Field studies in India found sloth bears to mate mostly in June. On the other hand, field studies in Sri Lanka discovered they mate over a greater part of the year. In captivity, a pair only mates for about 1 to 2 days. Most births occur from September to January. Pregnancy lasts between 6 and 7 months. One to two offspring are usually born, rarely three, but it does occur. Females usually search for a cave or a ground shelter in which to give birth (Ward and Kynaston, 1995; Sanderson, 1972; IBA, 1999; Blomstrom, 2000).

Breeding season: depends on location

Range number of offspring: 1 to 3.

Average gestation period: 6-7 months.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 400 g.

Average gestation period: 198 days.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

After birth (usually in a ground shelter of some sort), sloth bears are blind for about 3 weeks. Following a period of about 4 to 5 weeks the young leave the den. The cubs stay with their mother until they reach adulthood at about 2 to 3 years of age (Ward and Kynasaton, 1995; Blomstrom, 2000). Cubs often ride on the mother's back (Ward and Kynaston, 1995). Males are not reported to participate in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melursus ursinus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1781-08|NC_009970|Melursus ursinus| AATCGATGACTATTCTCTACAAATCACAAAGACATTGGTACTCTTTACCTTCTGTTCGGTGCATGAGCCGGAATAGTGGGCACTGCTCTC---AGCCTTTTAATTCGTGCCGAACTAGGTCAACCCGGGGCTCTGTTGGGGGAT---GATCAGATCTACAACGTAGTCGTAACCGCCCATGCATTTGTGATAATCTTCTTCATAGTCATGCCTATTATAATTGGGGGGTTCGGGAATTGATTAGTGCCCTTGATA---ATCGGTGCTCCTGACATAGCGTTTCCTCGAATAAATAACATGAGTTTCTGACTACTGCCGCCATCTTTCTTATTGCTTCTGGCCTCTTCCATAGTAGAAGCAGGCGCAGGAACTGGGTGAACGGTCTATCCCCCTTTAGCAGGTAATCTGGCCCATGCAGGAGCATCAGTAGACTTA---ACAATCTTTTCTCTGCACTTAGCAGGCGTCTCTTCTATTCTAGGAGCTATCAACTTCATTACTACTATCATCAACATGAAGCCCCCTGCAATATCTCAGTACCAAACTCCTCTATTTGTGTGATCAGTCCTAATCACGGCAGTGCTCCTTCTTTTATCTCTGCCAGTCTTAGCAGCC---GGAATTACTATATTACTTACAGATCGAAATCTCAACACTACCTTTTTTGACCCAGCTGGAGGGGGAGACCCCATTCTATACCAACACTTGTTCTGATTCTTCGGACACCCTGAAGTTTATATCCTAATTCTTCCTGGGTTTGGAATGATCTCTCACATTGTTACCTATTACTCAGGAAAAAAA---GAACCCTTTGGCTATATAGGAATAGTTTGAGCGATGATATCCATCGGATTCTTAGGATTTATCGTGTGAGCTCACCATATGTTTACCGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melursus ursinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+4cd;C1

Version
3.1

Year Assessed
2008

Assessor/s
Garshelis, D.L., Ratnayeke S. & Chauhan, N.P.S. (IUCN SSC Bear Specialist Group)

Reviewer/s
McLellan, B.N. & Garshelis, D.L. (Bear Red List Authority)

Contributor/s
The following people assisted with range mapping: Akhtar, N., Bargali, H., Chauhan, N.P.S., Choudhury, Islam, A., Joshi, A., Ratnayeke, S., Sarker, S. & Wijeyamohan, S.

Justification
Although no truly reliable large-scale population estimates exist for sloth bears, best guesstimates indicate a reasonable possibility of there being ~20,000 or fewer animals, and thus <10,000 adult animals. Moreover, strong evidence of their range reduction suggests that their population has declined by 30-49% over the past 30 years largely as a result of habitat loss, and to some extent from exploitation for parts, or systematic elimination as a pest. The recent probable extirpation of sloth bears in Bangladesh highlights serious concerns over persistence of small, isolated sloth bear populations elsewhere in their range, especially in unprotected areas. They are particularly vulnerable to loss of habitat because of their reliance on lowland areas, which tend to be the places most readily used by people. Poaching and trade in sloth bears or their parts is also common in many parts of their range, including the capture and removal of cubs from the wild. Given the lack of effective measures to control the rate of habitat loss and exploitation, sloth bear populations are expected to continue declining.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As is the case for many species, the destruction of sloth bears' habitats is a major cause for their rapidly declining numbers. Sri Lanka has lost about 1.85 million hectacres of natural high forest between 1956-1983. Reasons for the destruction include agricultural and developmental plans. An indirect threat to this species is the destruction of termite mounds for fine soil for tennis courts. Termites are a main source of food for these bears. These bears have also been hunted because of their reputation for aggression and crop destruction (Ward and Kynaston, 1995).

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A mark-resight based population estimate is available for one park in Nepal; density was estimated at 27 bears/100 km² for the whole park, and as high as 72 bears /100 km² in a core area (Garshelis et al. 1999a). Other population estimates (guesstimates) exist for many other parks and reserves, but these were based on uncertain methodology (mainly just expert opinion gleaned from interviews and questionnaires). Good information is available on area of occupied range in India (Chauhan 2006, Yoganand et al. 2006), Nepal (Garshelis et al. 1999a), and Sri Lanka (Ratnayeke et al. 2006). Some attempts have been made to apply estimated densities in various protected areas to occupied area to obtain a rangewide population estimate. Depending on methods and data employed in this process, rangewide estimates vary from <10,000 to somewhat >20,000 (Garshelis et al. 1999b, Chauhan 2006, Yoganand et al. 2006). None of these estimates are considered reliable enough to track changes in population size.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Major threats to this species are habitat loss and poaching (Johnsingh 2003, Chauhan 2006). Habitat has been lost, degraded, and fragmented by overharvest of forest products (timber, fuel wood, fodder, fruits, honey), establishment of monoculture plantations (e.g., teak, eucalyptus), settlement of refugees, and expansion of agricultural areas, human settlements, and roads (Santiapillai and Santiapillai 1990). Poaching, mainly for the commercial trade in bear parts, has been reported (Servheen 1990, Garshelis et al. 1999b), but its current extent and impact on bear populations is uncertain. Poaching also occurs for local use (e.g., male reproductive organs used as aphrodisiac; bones, teeth and claws used to ward off evil spirits; bear fat used for native medicine and hair regeneration; Santiapillai and Santiapillai 1990, Chauhan 2006). Capture of live cubs for use as "dancing bears" remains a significant threat in some parts of the range (Seshamani and Satyanarayan 1997). Also, in some parts of the range, encounters between people and sloth bears have led to numerous human injuries and many deaths (Rajpurohit and Krausman 2000, Bargali et al. 2005, Chauhan 2006). Such incidents tend to occur where people frequently use bear habitat, and where the habitat has thus become severely degraded. Bears that attack or threaten to attack people may be destroyed.

The only natural threats to sloth bears are tigers (Panthera tigris) and possibly leopards (P. pardus). In fact, the threat of tiger predation may account for the very aggressive nature of sloth bears (Joshi et al. 1999). Sloth bears have been observed fending off approaches by tigers, but they have also occasionally been observed as a prey item of tigers (e.g., Gopal 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Sloth bears are the most widespread bears in the Indian subcontinent and were once so numerous that they were easily speared from horseback. As the human population exploded, the bear's traditional habitat was cleared for timber, agriculture and development. Fragmented populations remain in protected areas. In India, bears are poached for their gall bladders and other parts which are prized in traditional Chinese medicine; it is estimated that parts from up to 1,500 bears a year were sold in Japan in the late 1970s. Sloth bears were the original 'dancing bears' and are were also used in bear baiting; the capture of live bears continues to this day. Where they come into contact with humans, these bears have an aggressive reputation and individuals may be killed in retaliation for attacks or for damage to crops (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Sloth bears are reported to exist in 174 Protected Areas in India, which include 46 National Parks and 128 Wildlife Sanctuaries (Chauhan 2006). Populations appear to be reasonably well protected inside these PAs, but faced with deteriorating habitat conditions outside PAs (Santiapillai and Santiapillai 1990, Akhtar et al. 2006). Reduced cover and food resources outside PAs (Akhtar et al. 2004) have led to increased bear–human conflicts, including frequent maulings (Bargali et al. 2005). It is estimated that half to two-thirds of the sloth bears in India live outside protected areas. About half the occupied range in Sri Lanka is outside protected areas (Ratnayeke et al. 2006).

Sloth bears are listed in Appendix I of CITES and are completely protected under Schedule I of the Indian Wildlife Protection Act. They are also protected to varying degrees by national laws in the other range countries. However, they can be killed to protect life or property. Given the aggressive nature of this animal, and the increasing number of encounters between bears and people, these bears are widely feared. Although education may help to reduce bear-human conflicts and enhance a conservation ethic among locals, the root of the problem is largely related to deteriorating habitat, which increases the chance of interaction between people and bears. Thus, habitat improvements (government or community-based reforestation) would be helpful in alleviating such conflicts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Sloth bears are protected under Schedule I of the Indian Wildlife Protection Act of 1972, and although they do not receive legal protection in Nepal, the level of hunting appears to be low (5). International trade is prohibited by their listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). Sloth bear populations have benefited where they occur within reserves established to protect other more high profile species, such as tigers and elephants; they occur within Ranthambore National Park in India and the Royal Chitwan National Park, Nepal. The conservation of these unique bears may need to be directly managed however, if their last strongholds are to persist (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sloth bears will enter crop fields such as maize. They also have a reputation for being unpredictable and aggressive (although this may be an unfair description) toward humans. They are quite possibly the most dangerous wild animal in Central India. When they are in human territory, or vice versa, numerous human casualties occur. One study found that between April 1989 and March 1994, there were 735 victims of sloth bear assaults and 48 were fatal (Rajpurohit and Krausman, 2000).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The gall bladders and fat of M. ursinus are used in traditional medicine (Ward and Kynaston, 1995).

Positive Impacts: source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sloth bear

The sloth bear (Ursus ursinus[3] =Melursus ursinus), also known as the labiated bear,[4] is a nocturnal insectivorous species of bear found wild within the Indian subcontinent. The sloth bear evolved from ancestral brown bears during the Pleistocene and shares features found in insect-eating mammals through convergent evolution. The population isolated in Sri Lanka is considered as a subspecies. Unlike brown and black bears, sloth bears have lankier builds, long shaggy coats that form a mane around the face, long sickle shaped claws, and a specially adapted lower lip and palate used for sucking insects. Sloth bears breed during spring and early summer and give birth near the beginning of winter. They feed on termites, honeybee colonies and fruits. Sloth bears sometimes attack humans that encroach on their territory. Historically, humans have drastically reduced their habitat and diminished their population by hunting them for food and products such as their baculum and claws. These bears have been used for as performing pets due to their tameable nature.

Contents

Naming and etymology

Initially thought to be related to the South American sloths, Shaw and Nodder in 1791 called it Bradypus ursinus noting that it was bear-like but giving weight to the long claws and the absence of upper middle incisors. Meyer (1793) identified it as a bear and called it Melursus lybius and in 1817, de Blainville called it Ursus labiatus because of the long lips. Iliger called it Prochilus hirsutus, the Greek genus name indicating long lips while the specific name noted its long and coarse hair. Fischer called it Chondrorhynchus hirsutus while Tiedemann called it Ursus longirostris.[5]

Local names

Evolution

Sloth bears may have reached their current form in the early Pleistocene, the time when the bear family specialized and dispersed. A fragment of fossilized humerus from the Pleistocene, found in Andhra Pradesh's Kurnool Basin is identical to the modern sloth bear's. The fossilized skulls of a bear once named Melursus theobaldi found in the Shivaliks from the early Pleistocene or early Pliocene are thought by certain authors to represent an intermediate stage between sloth bears and ancestral brown bears. M. theobaldi itself had teeth intermediate in size between sloth bears and other bear species, though its palate was the same size as the former species, leading to the theory that it is the sloth bear's direct ancestor. Sloth bears probably arose during the mid-Pliocene and evolved in the Indian subcontinent. The sloth bear bears evidence of having undergone a convergent evolution similar to that of other ant-eating mammals.[8]

Physical description

Skulls of a Sri Lankan sloth bear (left) and a common sloth bear (right) from the Muséum national d'histoire naturelle
Sloth bear skull. Note the lack of two upper incisors

Sloth bears are distinguished from Asian black bears by their lankier builds, longer, shaggier coat, pale muzzle and white claws.[9] Sloth bear muzzles are thick and long, with small jaws and bulbous snouts with wide nostrils. They have long lower lips which can be stretched over the outer edge of the nose, and lack upper incisors, thus allowing them to suck up large numbers of insects. The premolars and molars are smaller than in other bears, as they do not chew as much vegetation. In adults, the teeth are usually in poor condition, due to the amount of dirt they suck up and chew when feeding on insects.[10] The back of the palate is long and broad, as is typical in other ant-eating mammals.[8] The paws are disproportionately large, and have highly developed, sickle shaped blunt claws which measure 4 inches in length. Their toe pads are connected by a hairless web. They have the longest tail in the bear family, which can grow to 6–7 inches.[10] Their back legs are not very strong, though they are knee-jointed, and allow the sloth bear to assume almost any position.[11] The ears are very large and floppy. Sloth bear fur is completely black (rusty for some specimens), save for a whitish Y or V shaped mark on the chest.[10] This feature is sometimes absent, particularly in Sri Lankan specimens.[8] This feature, which is also present in Asian black bears and sun bears, is thought to serve as a threat display, as all three species are sympatric with tigers.[8] The coat is long, shaggy and unkempt, and is particularly heavy behind the neck and between the shoulders, forming a mane which can be 30 cm long.[8][10] The belly and underlegs are almost bare. Adult sloth bears weigh 100 kg (220 lbs) on average, though weight can range variously from 55 kg (121 lbs) to 190 kg (400 lbs).[12][13] They are 60–90 cm (2–3 ft) high at the shoulder, and have a body length of 1.4–1.9 m (4.6–6.3 ft).[10][14][15][16] Females are smaller than males, and have more fur between the shoulders.[11]

Behavior

A Sri Lankan sloth bear on a tree

Adult sloth bears may travel in pairs, with the males being gentle with cubs. They may fight for food. They walk in a slow, shambling motion, with their feet being set down in a noisy, flapping motion. They are capable of galloping faster than running humans.[17] Although they appear slow and clumsy, sloth bears are excellent climbers. They climb to feed and rest, though not to escape enemies, as they prefer to stand their ground. They are capable of climbing on smooth surfaces and hang upside down like sloths.[10] They are good swimmers, and primarily enter water to play.[10] To mark their territory, sloth bears will scrape trees with their forepaws, and rub against them with their flanks.[17] Sloth bears have a great vocal range. Gary Brown, in his Great Bear Almanac lists over 25 different sounds in 16 different contexts. Sounds such as barks, screams, grunts, roars, snarls, wickers, woofs and yelps are made when angered, threatening or when fighting. When hurt or afraid, they shriek, yowl or whimper. When feeding, sloth bears make loud huffing and sucking noises,[17] which can be heard over 100 metres away.[10] Sounds such as gurgling or humming are made by bears resting or sucking their paws. Sows will emit crooning sounds to their cubs. The species is the most vociferous when mating, and make loud, melodious calls when doing so. Sloth bears do not hibernate. They make their day beds out of broken branches in trees, and will rest in caves during the wet season. Sloth bears are the most nocturnal of bears, though sows become more active in daytime when with cubs.[17]

Reproduction

A mother with a cub on her back (Daroji sloth bear sanctuary, India)

The breeding season for sloth bears varies according to location: in India, they mate in April, May and June, and give birth in December and early January, while in Sri Lanka, it can be done all year. Sows gestate for 210 days near about 7 months, and typically give birth in caves or in shelters under boulders. Litters usually consist of 1–2 cubs, rarely 3.[17] Cubs are born blind, and open their eyes after four weeks.[6] Sloth bear cubs develop quickly compared to most other bear species: they will start walking a month after birth, become independent at 24–36 months, and become sexually mature at the age of 3 years. Young cubs will ride on their mother's back when she walks, runs or climbs trees until they reach a third of her size. Individual riding positions are maintained by cubs through fighting. Intervals between litters can last 2–3 years.[17]

Dietary habits

Sloth bears are expert hunters of termites, which they locate by smell.[17] On arriving at an ant-hill, they scrape at the structure with their claws till they reach the large combs at the bottom of the galleries, and will disperse the dirt with violent puffs. The termites are then sucked up through the muzzle, producing a hoovering sound which can be heard 180 meters away.[6] Their olfactory senses are strong enough to detect grubs three feet below ground. Unlike other bears, they do not congregate in feeding groups. They rarely prey on other mammals.[17] Sloth bears may supplement their diet with fruit and plant matter: in March and April, they will eat the fallen petals of mowha trees and are partial to mangoes, sugar cane, the pods of the Golden Shower Tree and the fruit of the jack-tree. Sloth bears are extremely fond of honey.[6] When feeding their cubs, sows are reported to regurgitate a mixture of half digested jack fruit, wood apples[disambiguation needed ] and pieces of honey comb. This sticky substance hardens into a dark yellow circular bread-like mass which is fed to the cubs. This "bear's bread" is considered a delicacy by some of India's natives.[18]

Relationships with other animals

Bengal tigers will occasionally prey on sloth bears. Tigers usually give sloth bears a wide berth, though some specimens may become habitual bear killers[19] and it is not uncommon to find sloth bear fur in tiger scats.[20] Tigers typically hunt sloth bears by waiting for them near termite mounds, then creep behind them and seize them by the back of their necks and force them to the ground with their weight.[21] One tiger was reported to simply break its victim's back with its paw, then wait for the paralysed bear to exhaust itself trying to escape before going in for the kill.[19] When confronted by tigers face to face, sloth bears will charge at them, crying loudly. A young, or already satiated tiger will usually retreat from an assertive sloth bear, as the bear's claws can inflict serious wounds, and most tigers end the hunt if the bears become aware of the tiger's presence before the pounce.[21] A female bear with cubs was observed to stand its ground and prevail in a confrontation against two tigers (one female, one male) in rapid succession.[22] Sloth bears may scavenge on tiger kills.[23] As tigers are known to mimic the calls of sambar deer to attract them, sloth bears react fearfully even to the sounds made by deer themselves.[21] Indian leopards can also be a threat, as they are able to follow sloth bears up trees.[24] Sloth bears will occasionally chase leopards from their kills.[17]

Sloth bears are sympatric with Asiatic black bears in Northern India, and the two species, along with the sun bear, co-exist in some of the national parks and wildlife sanctuaries. They are also found together in Assam, Manipur and Mizoram, in the hills south of the Brahmaputra river, the only places occupied by all three bear species. The three species do not act aggressively toward each other.[24]

Dhole packs may attack sloth bears, though they are not a usual prey item.[25] When attacking sloth bears, dholes will try to prevent the bear from retreating in caves.[26]

Asian elephants apparently do not tolerate sloth bears in their vicinity. The reason for this is unknown, as individual elephants known to maintain their composure near tigers have been reported to charge bears.[6] Indian rhinoceros have a similar intolerance for sloth bears, and will charge at them.[17]

Subspecies and range

NameDistributionDescription
Sri Lankan sloth bear (Melursus ursinus inornatus) Pucheran, 1855
Sloth bear.jpg
Sri LankaSri Lankan sloth bears have much shorter body hair, making them appear less shaggy. They are also smaller in dimensions, even in the teeth. They sometimes lack the characteristic white chest mark.[8] At the turn of the century, sloth bears were found throughout Sri Lanka, but reduced in number after the turn of the century, due to wide-scale conversion of upland forests into tea and coffee plantations. They are now restricted to the northern and eastern lowlands.[27]
Common sloth bear (Melursus ursinus ursinus) (Shaw, 1791)Lippenbaer-24.jpgIndia, Nepal, Bhutan, Bangladesh and PakistanIn India, their distribution is patchy, and mostly occur in areas of forest cover. They are absent in the high mountains of Himachal Pradesh and Jammu and Kashmir, the northwestern deserts of Rajasthan, and a broad non-forested swath in the south. Sloth bears are the most widespread bear species in India, being found in the Siwaliks(also in Pakistan), low hills bordering the outer range of the Himalayas from Punjab to Arunachal Pradesh, though they are no longer found as far west as Punjab. They are isolated from the sloth bear populations of Nepal, due to the connection being broken by agricultural lands. Sloth bears in Nepal are mainly restricted to the Terai, the southern strip of lowland forest and grasslands bordering India. A few isolated populations may still occur in the Chittagong and Sylhet regions of eastern Bangladesh.[27]

Relationships with humans

Attacks on humans

According to Robert Armitage Sterndale, in his Mammalia of India (1884, p. 62):

[The sloth bear] is also more inclined to attack man unprovoked than almost any other animal, and casualties inflicted by it are unfortunately very common, the victim being often terribly disfigured even if not killed, as the bear strikes at the head and face. Blanford was inclined to consider bears more dangerous than tigers...

Captain Williamson in his Oriental Field Sports wrote of how sloth bears rarely killed their human victims outright, but would suck and chew on their limbs till they were reduced to bloody pulps.[4] One specimen, known as the Sloth bear of Mysore, was singlehandedly responsible for the deaths of 12 people and the mutilation of 2 dozen others before being shot by Kenneth Anderson.[28] Although sloth bears have attacked humans, they rarely become man-eaters. Dunbar-Brander's Wild Animals of Central India mentions a case in which a sow with two cubs began a six week reign of terror in Chanda, a district of the Central Provinces, during which more than one of their victims had been eaten,[29] while the sloth bear of Mysore partially ate at least three of its victims.[28] R.G. Burton deduced from comparing statistics that sloth bears killed more people than Asian black bears,[29] and Theodore Roosevelt considered them to be more dangerous than American black bears.[30] In Madhya Pradesh, sloth bear attacks accounted for the deaths of 48 people and the injuring of 686 others between the years 1989 and 1994, probably due in part to the density of population and competition for food sources.[31] A total of 137 attacks (resulting in 11 deaths) occurred between April 1998 and December 2000 in the North Bilaspur Forest Division of Chhattisgarh. The majority of attacks were perpetrated by single bears, and occurred in kitchen gardens, crop fields, and in adjoining forests during the monsoon season.[32] One Mr. Watts Jones wrote a first hand account of how it feels to be attacked by a sloth bear, recalling when he failed to score a direct hit against a bear he had targeted:

I do not know exactly what happened next, neither does my hunter who was with me; but I believe, from the marks in the snow, that in his rush the bear knocked me over backwards in fact, knocked me three or four feet away. When next I remember anything, the bear's weight was on me, and he was biting my leg. He bit two or three times. I felt the flesh crush, but I felt no pain at all. It was rather like having a tooth out with gas. I felt no particular terror, though I thought the bear had got me; but in a hazy sort of way I wondered when he would kill me, and thought what a fool I was to get killed by a stupid beast like a bear. The shikari then very pluckily came up and fired a shot into the bear, and he left me. I felt the weight lift off me, and got up. I did not think I was much hurt. ... The main wound was a flap of flesh torn out of the inside of my left thigh and left hanging. It was fairly deep, and I could see all the muscles working underneath when I lifted it up to clean the wound."[33]

It is likely that sloth bears view humans as predators, as their reactions to them (roaring, followed by retreat or charging) are similar to those evoked in the presence of tigers and leopards.[8]

Hunting and products

Illustration of British officers hunting a sloth bear on horseback

One method of hunting sloth bears involved the use of beaters, in which case, a hunter waiting on a post could either shoot the approaching bear through the shoulder or on the white chest mark if it was moving directly to him. Sloth bears are very resistant to body shots, and can charge hunters if wounded, though a man of steady nerves could score a direct hit from within a few paces of a charging bear. Sloth bears were easy to track during the wet season, as their clear footprints could be followed straight to their lairs. The majority of sloth bears killed in forests were due to chance encounters with them during hunts for other game. In hilly or mountainous regions, two methods were used to hunt sloth bears there: one was to lie in wait above the bear's lair at dawn and wait for the bear to return from its nocturnal foraging. Another was to rouse them at daytime by firing flares into the cave to draw them out.[34] Sloth bears were also occasionally speared on horseback.[27] In Sri Lanka, the baculum of a sloth bear was once used as a charm against barrenness.[11]

Tameability

A tame bear and its handler in Pushkar

Officers in British India often kept sloth bears as pets.[6] The wife of Kenneth Anderson kept an orphaned sloth bear cub from Mysore, which she christened "Bruno". The bear could be fed on almost anything (including motor oil) and was very affectionate toward people. It was even taught numerous tricks, such as cradling a woodblock like a baby or pointing a bamboo stick like a gun.[35]

Dancing bears were historically a popular entertainment in India, dating back to the 13th century and the pre-Mughal era. The Kalandars, who practised the tradition of capturing sloth bears for entertainment purposes, were often employed in the courts of Mughal emperors to stage spectacles involving trained bears.[6] They were once common in the towns of Calcutta, where they often disturbed the horses of British officers.[6]

Despite a ban on the practice that was enacted in 1972, there were as many as 800 dancing bears in the streets of India during the latter part of the 20th century, particularly on the highway between Delhi, Agra, and Jaipur. Sloth bear cubs, which were usually purchased at the age of six months from traders and poachers, were trained to dance and follow commands through coercive stimuli and starvation. Males were castrated at an early age, and their teeth were knocked out at the age of one year in order to prevent them from seriously injuring their handlers. The bears were typically fitted with a nose ring attached to a four foot leash. Some were found to be blind from malnutrition.[36]

In 2009, following a seven year campaign by a coalition in Indian and international animal welfare groups, the last Kalandar dancing bear was set free.[37] The effort to end the practice involved helping the bear handlers find jobs and education, which enabled them to reduce their reliance on dancing bear income.[38]

Cultural references

In Rudyard Kipling's The Jungle Book, Baloo "the sleepy old grey bear" teaches the Law of the Jungle to the wolf cubs of the Seeonee wolf pack, as well as to his most challenging pupil, the "man-cub" Mowgli. Robert Armitage Sterndale, from whom Kipling derived most of his knowledge of Indian fauna, used the Hindustani word "Bhalu" for several bear species, though Daniel Karlin, who edited the Penguin reissue of The Jungle Book in 1989 states that with the exception of colour, Kipling's descriptions of Baloo are consistent with the sloth bear, as brown bears and Asian black bears do not occur in the Seoni area where the novel takes place. Also, the name "sloth" can be used in the context of sleepiness. Karlin states however that Baloo's diet of ".. only roots and nuts and honey" is a trait more common to the Asian black bear than to the sloth bear.[39]

References

  1. ^ Sloth Bears. Smithonian National Zoological Park
  2. ^ Garshelis, D.L., Ratnayeke S. & Chauhan, N.P.S. (2008). Melursus ursinus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 January 2009.Listed as Vulnerable (VU A2cd+4cd, C1 v3.1)
  3. ^ Krause, J.; Unger, T.; Noçon, A.; Malaspinas, A.; Kolokotronis, S.; Stiller, M.; Soibelzon, L.; Spriggs, H.; Dear, P. H.; Briggs, A. W.; Bray, S. C. E.; O'Brien, S. J.; Rabeder, G.; Matheus, P.; Cooper, A.; Slatkin, M.; Pääbo, S.; Hofreiter, M. (2008). "Mitochondrial genomes reveal an explosive radiation of extinct and extant bears near the Miocene-Pliocene boundary". BMC Evolutionary Biology 8 (220): 220. doi:10.1186/1471-2148-8-220. PMC 2518930. PMID 18662376. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2518930. 
  4. ^ a b The forest, the jungle, and the prairie or, Scenes with the trapper and the hunter in many lands by Alfred Elliott. Publisher T. Nelson, and Sons, Paternoster Row; Edinburgh; and New York., 1868
  5. ^ Owen, R (1833). "The Labiated Bear". The Zoological Magazine. Number 3: 81–85. http://www.archive.org/stream/zoologicalmagazi00owen#page/81/mode/1up. 
  6. ^ a b c d e f g h i j k l m n o p q r US.Archive.org, Sterndale's Mammalia of India, A New and Abridged Edition, thoroughly revised and with an Appendix on the Reptilia by Frank Finn, B.A., F.Z.S. Late Deputy Superintendent Indian Museum, Calcutta, 1929
  7. ^ IAR.org.uk[dead link]
  8. ^ a b c d e f g Comcast.net, Sloth Bear Melursus ursinus, Final draft: Chapter for the book “Mammals of South Asia” (Eds. Johnsingh, A. J. T. and Manjrekar, N.), Authors: K. Yoganand, Clifford G. Rice and A. J. T. Johnsingh
  9. ^ WildLifeInformation.org, Melursus ursinus – Sloth bear
  10. ^ a b c d e f g h Bear Anatomy and Physiology from Gary Brown's The Great Bear Almanac, Lyons & Burford, Publishers, 1993
  11. ^ a b c Harry Storey (31 May 2008). Hunting and Shooting in Ceylon. Dabney Press. pp. 268–. ISBN 978-1-4097-2852-8. http://books.google.com/books?id=WOxoRzoD9PsC&pg=PA268. Retrieved 26 September 2011. 
  12. ^ Brian K. McNab (1992). "Rate of Metabolism in the Termite-Eating Sloth Bear (Ursus ursinus)". Journal of Mammalogy 73 (1): 168–172. doi:10.2307/1381879. JSTOR 1381879. 
  13. ^ "Sloth bear videos, photos and facts – Melursus ursinus". ARKive. http://www.arkive.org/sloth-bear/melursus-ursinus/. Retrieved 18 April 2011. 
  14. ^ "Sloth Bear". The Animal Files. http://www.theanimalfiles.com/mammals/carnivores/bear_sloth.html. Retrieved 18 April 2011. 
  15. ^ "Sloth Bear". Arktofile.net. http://arktofile.net/pages/bear_sloth.html. Retrieved 18 April 2011. 
  16. ^ "San Diego Zoo's Animal Bytes: Sloth Bear". Sandiegozoo.org. http://www.sandiegozoo.org/animalbytes/t-sloth_bear.html. Retrieved 18 April 2011. 
  17. ^ a b c d e f g h i j Bear Behavior and Activities from Gary Brown's The Great Bear Almanac, Lyons & Burford, Publishers, 1993
  18. ^ Anderson, Kenneth (1954). Nine Man-Eaters and One Rogue. p. 251. ISBN 1-887269-11-8. 
  19. ^ a b Mills, Stephen (2004). Tiger. Richmond Hill., Ont.: Firefly Books. p. 168. ISBN 1-55297-949-0. 
  20. ^ Tigers eat sloth bears, don’t they?
  21. ^ a b c Perry, Richard (1965). The World of the Tiger. p. 260. ASIN: B0007DU2IU. 
  22. ^ Bear Tiger confrontation – 10 pics that tell a story. Dickysingh.com (2011-04-10). Retrieved on 2011-09-26.
  23. ^ The Deer and the Tiger: A Study of Wildlife in India, Midway Reprint, Author George B. Schaller, Edition reprint, illustrated, University of Chicago Press, 1984, ISBN 0-226-73631-8
  24. ^ a b Barbara Hadley The Sloth Bear. IUCN/SSC. Bear Specialist Group. IAR.org.uk
  25. ^ Fox, Michael W. (1984). The Whistling Hunters: Field Studies of the Asiatic Wild Dog (Cuon Alpinus). Albany: State University of New York Press. p. 150. ISBN 0-87395-843-8. http://www.amazon.com/dp/0873958438. 
  26. ^ Animal Kingdom of the World, Author S.K. Tiwari, Publisher Sarup & Sons, 1999, ISBN 81-7625-071-6
  27. ^ a b c David L. Garshelis, Anup R. Joshi, James L. D. Smith, and Clifford G. Rice. "Sloth Bear Conservation Action Plan" (PDF). http://wildlife1.wildlifeinformation.org/000ADOBES/Bears/Bears_IUCN_ActionPlan/bearsAP_chapter12.pdf. Retrieved 18 April 2011. 
  28. ^ a b “The Black Bear of Mysore”, from Man-Eaters and Jungle Killers, Kenneth Anderson, Allen & Unwin, 1957
  29. ^ a b A Book of Man Eaters by Brigadier General R.G. Burton, Mittal Publications
  30. ^ Ranch Life and the Hunting Trail by Theodore Roosevelt, Published by U of Nebraska Press, 1983, ISBN 0-8032-8913-8]
  31. ^ Rajpurohit, K. S. and P. R. Krausman (2000). "Human – sloth-bear conflicts in Madhya Pradesh, India". Wildl. Soc. Bull. 28 (2): 393–9. JSTOR 3783697. 
  32. ^ Bargali, H. S.; Akhtar, Naim; Chauhan, N. P. S. (2005). "Characteristics of sloth bear attacks and human casualties in North Bilaspur Forest Division, Chhattisgarh, India". Ursus 16 (2): 263–267. doi:10.2192/1537-6176(2005)016[0263:COSBAA]2.0.CO;2. ISSN 1537-6176. http://www.bearbiology.com/fileadmin/tpl/Downloads/URSUS/Vol_16_2/Bargali_Akhtar_16_2_.pdf. 
  33. ^ "''The living animals of the world; a popular natural history with one thousand illustrations'' Volume 1: Mammals, by Cornish, C. J. (Charles John), 1858–1906; Selous, Frederick Courteney, 1851–1917; Johnston, Harry Hamilton, Sir, 1858–1927; Maxwell, Herbert, Sir, published by New York, Dodd, Mead and Company". Archive.org. http://www.archive.org/stream/livinganimalsofw01cornrich#page/n7/mode/2up. Retrieved 18 April 2011. 
  34. ^ C. E. M. Russell (21 October 2008). Bullet and Shot in Indian Forest, Plain and Hill – With Hints to Beginners in Indian Shooting.. Phillips Press. pp. 197–. ISBN 978-1-4437-6231-1. http://books.google.com/books?id=bWy9B80bA6YC&pg=PA197. Retrieved 26 September 2011. 
  35. ^ 9. The Bond of Love[dead link]
  36. ^ Dancing Bears in India. wildlifesos.org
  37. ^ "Last Indian dancing bear set free". BBC News. 18 December 2009. http://news.bbc.co.uk/2/hi/south_asia/8421867.stm. Retrieved 18 April 2011. 
  38. ^ "Katrick Satyanarayan: How we rescued the "dancing" bears". Ted.com. http://www.ted.com/talks/kartick_satyanarayan_how_we_rescued_the_dancing_bears.html. Retrieved 18 April 2011. 
  39. ^ Rudyard Kipling; Daniel Karlin (1989). The jungle books. Penguin. pp. 350–. ISBN 978-0-14-018316-0. http://books.google.com/books?id=UrJOKXFEPAwC&pg=PA350. Retrieved 26 September 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!