Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Range Description

The kinkajou is found throughout the neotropics, from Mexico to Bolivia. Its range extends from Mexico to the east and south of the Sierra Madres, along the central and southern Mexican coasts, southward through Beni, Bolivia (east of the Andes), and deep into Brazil (into the Mato Grosso).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Kinkajous are distributed in neotropical forest regions from southern Tamaulipas, Mexico to southern Brazil.

Biogeographic Regions: neotropical (Native )

  • Eisenburg, J. 1989. Mammals of the Neotropics: The Northern Neotropics, Vol. 1. Chicago: The University of Chicago Press, Ltd.
  • Kortlucke, S. 1973. Morphological variation in the kinkajou, Potos flavus (Mammalia: Procyonidae), in Middle America. Lawrence, Kansas: The University of Kansas Museum of Natural History.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Potos flavus is in the carnivoran family Procyonidae (raccoons, coatis, and their relatives). Kinkajous have distinctive features that at one time were used to place them in the order Primates as Lemur flavus. Kinkajous are arboreal and possess many adaptations common to arboreal species, such as a long, fully prehensile tail, nimble clawed fingers, and fully reversible hind feet. During terrestrial locomotion, captive kinkajous exhibit a variety of unpredictable footfall patterns yet remain graceful and feline-like when moving. Kinkajous are considered “adept yet deliberate climbers” (McClearn 1992, p. 254). They utilize their extreme spinal flexibility to maneuver among the tree limbs and obtain food at terminal branches. This flexibility, which allows for a rotation of 180º between the pelvis and head, is a unique trait that distinguishes kinkajous from their close relatives, the coatis and raccoons (McClearn 1992).

Kinkajous are medium-sized (2.0 to 4.6 kg) with a thick and woolly, honey-brown pelage, though different color morphs have been observed in some regions (Ford and Hoffmann 1989). They have elongated bodies with short legs, a rounded head with large eyes, a small muzzle, and round ears. A recent study on the basal metabolic rate (BMR) of carnivores, reported a BMR for kinkajous of 447.71 kJ/day (Munoz-Garcia and Williams 2005). Kinkajous are particularly well known for hanging upside-down while feeding, using their prehensile tail and hind legs for support while holding small fruits in a one-handed grasp (McClearn 1992). Little sexual dimorphism exists between males and females; however, males are known to have slightly larger canines and minor differences in skull morphology (Ford and Hoffmann 1988).

Range mass: 2.0 to 4.6 kg.

Range length: 820 to 1,330 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Average basal metabolic rate: 4.294 W.

  • McClearn, D. 1992. Locomotion, posture, and feeding behavior of kinkajous, coatis, and raccoons. Journal of Mammalogy, 73(2): 245-261.
  • Munoz-Garcia, A., J. Williams. 2005. Basal Metabolic Rate in Carnivores Is Associated with Diet after Controlling for Phylogeny. Physiological and Biochemical Zoology, 78(6): 1039-1056.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The kinkajou (Potos flavus) is a medium-sized procyonid common throughout most neotropical forests (Ford and Hoffmann, 1988). It has nocturnal and arboreal habits and requires closed-canopy forest such as that found in Central America and the Amazon basin. Kinkajous are found in rain forests in Surinam, Mexico, and Peru (Estrada and Coates-Estrada, 1985; Husson, 1978; Janson et al., 1981), tropical evergreen forests in Mexico and Venezuela (Handley, 1976; Leopold, 1959), tropical dry forest in Guatemala (Walker and Cant, 1977), forests of the savanna region in Surinam (Husson, 1978), secondary forest in French Guiana (Charles-Dominique et al. 1981), and the Amazonian rain forest, Atlantic coastal forest, and evergreen gallery forests of the Cerrado in Brazil (Redford and Fonseca, 1986). Further to the south and east of its range the habitat becomes much drier and more open. Kinkajous are not found in these regions.

The species is found at altitudes from sea level to as high as 2500 m (Grzimek, 1975). Many studies (Bisbal, 1986; Charles-Dominique et al. 1981; Julien-Laferrière, 1999; Kays, 1999) on kinkajou's diet reveal that kinkajous eat primarily fruit, and supplement their diet with flowers and leaves. Charles-Dominique and colleagues (1981) state that kinkajous play an important role in dispersing the seeds of some plant species. Their social behavior has been little studied. Kinkajou social organization has been defined as 'solitary group-life' (Kays and Gittleman, 2001). Although kinkajous spent most of their active time alone, individuals regularly associated in groups of up to five individuals (Kays and Gittleman, 2001) while feeding fruit trees. Camera-trap avoidance behaviour has been documented for kinkajou in Costa Rica (Schipper, 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Kinkajous live in a variety of forest habitats including tropical dry forest, secondary forest, Amazonian rainforest, Atlantic coastal forest, tropical evergreen forest and forests of the savannah region in Suriname. They are rarely found in palm jungle, cloud forests or thorn forests (Ford and Hoffmann 1988). Habitat requirements have not been fully investigated.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Ford, L., R. Hoffmann. 1988. Potos flavus. Mammalian species, 321: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Potos flavus is a primarily opportunistic frugivore that feeds on a variety of plant species in several families according to seasonal abundance (Julien-Laferrière, 2001). Fruit selection seems to be based on abundance and accessibility to edible parts rather than color, size, nutritional value, seed content, or general morphology of the fruits (Julien-Laferrière, 2001). Fruits are mostly ingested when ripe, but some observations show that kinkajous will also consume unripe fruits of particular species. Several studies have suggested that figs are an important part of the kinkajou diet and can make up as much as half of the diet. Figs are important to many frugivores throughout the tropics because of abundance and year-round availability (Janzen, 1979). Fig preference may also be attributed to a high nutrient content, especially calcium, relative to other tropical fruiting species (Kays, 1999).

Kinkajous spend much of the night foraging solitarily in fruit trees. However, occasional feeding pairs have been observed and contain mainly male pairs or females with offspring (Kays 1999). Kinkajous may use known trail systems to return to familiar fruit trees (Ford and Hoffmann, 1988).

Kinkajous possess a curiously long, extensible tongue that has lead many to believe they also feed on small insects or nectar. Some studies have shown that, in certain populations and during particular seasons, insects can account for a significant portion of their diet. Ants are especially well represented and have led some to believe that kinkajous should also be considered myrmecophagous (Redford 1989). Most data seem to support the idea that kinkajous are primarily frugivorous but will supplement their diet with insects, flowers, and nectar depending on seasonal availability.

Animal Foods: insects

Plant Foods: fruit; nectar; flowers

Primary Diet: herbivore (Frugivore )

  • Janzen, D. 1979. How to be a fig. Annual Review of Ecology and Systematics, 10: 13-51.
  • Kays, R. 1999. Food preferences of kinkajous (Potos flavus): A frugivorous carnivore. Journal of Mammalogy, 80(2): 589-599.
  • Redford, K., A. MacLean Stearman, J. Trager. 1989. The kinkajou (Potos flavus) as a myrmecophage. Mammalia, 53(1): 132-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Kinkajous are active seed dispersers and possibly pollinators as well. Their frugivorous diet means that they consume large quantities of seeds, and most seeds seem to pass through their digestive system intact (Julien-Laferrière, 2001). In one study, seeds that were defecated by kinkajous germinated faster than those that were cleaned or intact (Julien-Laferrière, 2001). Kinkajous may also act as plant pollinators. Field observations have found that kinkajous will occasionally feed on nectar using their long tongues, and in the process collect a face-load of pollen that they disperse to other plants (Kays 1999).

Ecosystem Impact: disperses seeds; pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation threats for kinkajous are relatively low because of their arboreality and nocturnal feeding strategy. Most predation probably occurs during the day when kinkajous are sleeping in their dens. Aerial raptors like Isidor’s eagles (Oroaetus isidori) and harpy eagles (Harpia harpyja) have been observed consuming kinkajous. Jaguars (Panthera onca) are also known to occasionally eat kinkajous. However, the primary kinkajou predator is humans. Kinkajous make good pets and their thick, soft fur makes them a valued commodity in commerce (Ford and Hoffmann, 1988). Also, kinkajou meat is supposedly delicious and hundreds are exported dead or alive from South America each year (Ford and Hoffmann, 1988).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The functions of kinkajou vocalizations have been poorly studied, yet there are a wide variety of vocalizations attributed to them (Ford and Hoffmann 1988). Kinkajous in social situations vocalize for less than 30 seconds upon first meeting a fellow group member (Kays and Gittleman 2001). Hissing and screaming are thought to occur during aggressive situations, as was described in a captive population (Kays and Gittleman 2001). The most common call is explained as a two-part snort-weedle consisting of a “quick snort sound, followed by a variable number of weedle vocalizations” (Kays and Gittleman 2001, pp. 497). That call has been observed in both solitary and social situations. Other recorded vocalizations have included barks, chirps, squeaks, nasal grunts, whistles, and clicking (in the case of a captive female during oestrus) (Ford and Hoffmann 1988).

Scent marking is important for sexual, territorial and social communication. These often involve marking tree branches using mandibular, throat, and abdominal glands. Kinkajous seem to rely on auditory and olfactory cues to communicate with one another.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Very little in known about the average life span in the wild, but they appear to be quite long-lived based on their low reproductive rates, low predation risks, and evidence from captive animals.

Range lifespan

Status: captivity:
40 (high) years.

Typical lifespan

Status: captivity:
20 to 40 years.

Average lifespan

Status: wild:
29.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38.4 years (captivity) Observations: These animals may live up to 38.4 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Originally, kinkajous were thought to be a solitary species that rarely exhibited sociality, but behavioral studies have revealed complex social interactions and an unusual mating system (Kays and Gittleman 2001). Kinkajous exhibit both a polygamous and polyandrous mating system. Two males, a single female, and offspring often comprise a typical social group. The system is considered polygamous because dominant males mate with the female of their home group, as well as any other females living on the periphery of the home territory and unrelated to another group (Kays 2003). Most copulation is done by the dominant male, but occasionally the subordinate male is allowed to copulate with the home group female (Kays and Gittleman 2001; Kays 2003). Genetic analysis of paternity supports the hypothesis that the dominant male monopolizes fertilizations (Kays, Gittleman, and Wayne 2000).

During observed copulatory events, male kinkajous spent several hours following the female in oestrus, zigzagging over multiple hectares. Scent glands seem to be used for sexual stimulation (Ford and Hoffmann 1988) and territorial marking. The subordinate male often follows closely, vocalizing and picking fights with the dominant male. Other observations have shown that both males occasionally copulate with the group female without displays of aggression. After copulation, the male and female disperse to different areas, probably to feed (Kays and Gittleman 2001).

Mating System: polygynandrous (promiscuous)

Females are in oestrus for up to 17 days, with a peak breeding season that varies among geographic groups. Kinkajous are able to breed year-round, but seem to be roughly synchronized into a localized breeding season that is probably tied to local fruit production (Kays, personal communication).

Breeding interval: Oestrus length is approximately 17 days, females receptive for 2 days.

Breeding season: Polyoestrus, geographically variable breeding season.

Range number of offspring: 1 to 2.

Range gestation period: 98 to 120 days.

Average weaning age: 8 weeks.

Average time to independence: 4 months.

Average age at sexual or reproductive maturity (female): 820 days.

Average age at sexual or reproductive maturity (male): 550 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 175 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
550 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
820 days.

Female kinkajous are the primary providers of parental care. The males do not provide any direct care but are not aggressive toward young and have been found to regularly share fruiting trees and day dens, and will occasionally play with the pups. Parental investment is mostly associated with the unusually long gestation and lactation periods. Gestation and lactation last for a total of about eight months. Litters typically contain one pup, and, once weaned, females will often ‘park’ their offspring in a nearby tree while feeding (Kays and Gittleman 2001; Kays 2003). Females are especially voracious feeders when reproductively active due to the high costs of lactation and gestation. The high energy demands mean that it may be difficult for females to maintain total caloric intake, as well as satisfy specific nutrient requirements (Kays 2003).

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female); pre-independence (Provisioning: Female); post-independence association with parents; inherits maternal/paternal territory

  • Kays, R., J. Gittleman, R. Wayne. 2000. Microsatellite analysis of kinkajou social organization. Molecular Ecology, 9(6): 743-751.
  • Ford, L., R. Hoffmann. 1988. Potos flavus. Mammalian species, 321: 1-9.
  • Kays, R. 2003. Social polyandry and promiscuous mating in a primate-like carnivore: the kinkajou (Potos flavus). Pp. 125-137 in U Reichard, C Boesch, eds. Monogamy: mating strategies and partnerships in birds, humans and other mammals. Cambridge, New York: Cambridge University Press.
  • Kays, R., J. Gittleman. 2001. The social organization of the kinkajou Potos flavus (Procyonidae). Journal of Zoology, 253: 491-504.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Potos flavus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA843-07|DQ533936|Potos flavus| CATCGATGACTATTCTCCACAAATCATAAGGACATTGGCACTCTCTATCTTTTGTTCGGTGCCTGAGCTGGAATAGTAGGAACTGCCCTC---AGCCTACTAATCCGTGCCGAACTGGGCCAACCAGGTACTTTATTAGGGGAC---GATCAGATCTACAATGTAATTGTTACTGCCCACGCATTCGTAATAATCTTCTTTATAGTGATGCCAATTATAATTGGGGGCTTCGGTAACTGGCTGGTCCCACTAATA---ATCGGTGCACCCGATATGGCGTTCCCACGAATAAATAATATAAGCTTCTGACTTTTGCCCCCATCTTTCCTTCTACTCCTAGCTTCCTCAATAGTAGAAGCAGGCGCAGGCACCGGATGAACCGTCTACCCTCCTCTAGCAGGCAACCTAGCTCATGCTGGAGCATCCGTGGACCTA---ACAATCTTTTCCTTACACTTAGCAGGTGTCTCATCCATTCTGGGTGCTATTAACTTCATTACCACTATCATTAATATGAAACCCCCTGCCATATCACAATATCAAACCCCCTTATTTGTATGATCAGTATTAATCACGGCAGTGCTCTTACTGCTATCCTTACCAGTACTAGCAGCT---GGAATTACTATATTGTTAACAGACCGAAATCTAAACACTACCTTCTTTGACCCAGCCGGAGGAGGAGATCCCATTTTGTACCAACACTTGTTCTGATTTTTCGGACATCCTGAAGTATATATCTTAATTCTACCCGGATTCGGAATAATCTCCCACATTGTAACATACTATTCAGGGAAAAAA---GAGCCTTTTGGCTATATGGGGATGGTTTGAGCAATAATATCTATTGGTTTCCTAGGTTTCATTGTATGAGCCCACCATATATTCACAGTAGGTATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Potos flavus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kays, R., Reid, F., Schipper, J. & Helgen, K.

Reviewer/s
Duckworth, J.W. & Belant, J. (Small Carnivore Red List Authority)

Justification
This species is listed as Least Concern since it has a wide distribution range, is adaptable to a degree of human land-use change and there is no evidence that it is declining at a rate sufficient to warrant listing at this time.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Habitat destruction caused by humans has decreased the range and population size of kinkajous. Deforestation probably accounts for the majority of the habitat destruction. Kinkajous are also harvested for their soft pelts and flavorful meat, which can make them susceptible to over-harvest. They are difficult to study so population estimates are probably inaccurate.

US Federal List: no special status

CITES: appendix iii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population density for kinkajous has been estimated at 12.5 individuals/km2 in Veracruz, Mexico (Estrada and Coates-Estrada, 1985), and 20 to 30/km2 in French Guiana (Charles-Dominique et al., 1981).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
As this is a highly arboreal species, even though we have no evidence that it is becoming threatened, it must be presumed that its numbers decrease with extensive human disturbance. Threats include extensive human disturbance, deforestation, pet trade and hunting for its meat and pelt (Glatston, 1994; Husson, 1978).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Kinkajous are found in numerous protected areas throughout their range and it is protected under CITES Appendix III in Honduras.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Kinkajous do not seem to seriously impact humans and are rarely seen because of their nocturnal habits, but they have been known to be a nuisance on coconut plantations where they eat immature fruits (Kays, personal communication).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Kinkajous are economically important in the pet and fur trades. Hundreds of live animals and skins are exported each year from Peru (Ford and Hoffmann 1988). They also provide meat for local people. Ecologically, kinkajous contribute to the health of forest ecosystems through seed dispersal and pollination.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kinkajou

The kinkajou (Potos flavus), also known as the 'honey bear' (a name it shares with the sun bear), is a rainforest mammal of the family Procyonidae related to olingos, coatis, raccoons, and the ringtail and cacomistle. It is the only member of the genus Potos. Kinkajous may be mistaken for ferrets or monkeys, but are not closely related. Native to Central America and South America, this arboreal mammal is not an endangered species, though it is seldom seen by people because of its strict nocturnal habits. However, they are hunted for the pet trade, for their fur (to make wallets and horse saddles) and for their meat. The species has been included in Appendix III of CITES by Honduras, which means that exports from Honduras require an export permit and exports from other countries require a certificate of origin or re-export.[2] They may live up to 40 years in captivity.

Contents

Size and appearance

An adult kinkajou weighs 1.4–4.6 kg (3–10 lb). The adult body length is 40–60 cm (16–24 in); in addition to body length, the tail length is 40–60 cm (16–24 in).[3] The kinkajou's woolly fur consists of an outer coat of gold (or brownish-gray) overlapping a gray undercoat. It has large eyes and small ears. It also has short legs with five toes on each foot and sharp claws.[4][5]

Range and habitat

Kinkajous range from east and south of the Sierra Madres in Mexico, throughout Central American to Bolivia east of the Andes and the Atlantic Forest of southeastern Brazil. Their altitudinal range is from sea level to 2500 m. They are found in closed-canopy tropical forests, including lowland rainforest, montane forest, dry forest, gallery forest and secondary forest. Deforestation is thus a potential threat to the species.[1]

Diet

Kinkajou skull

Although the kinkajou is classified in the order Carnivora and has sharp teeth, its omnivorous diet consists mainly of fruit. Kinkajous particularly enjoy figs. Studies have shown that 90% of their diet consists of (primarily ripe) fruit. To eat softer fruits they hold it with their forepaws, then scoop out the succulent pulp with their tongue. They may play an important role in seed dispersal. Leaves and flowers make up much of the other 10% of their diet.[6] They sometimes eat insects, particularly ants. It has been suggested, without direct evidence, that they may occasionally eat bird eggs and small vertebrates.[6] Their frugivorous habits are actually convergent with those of (diurnal) spider monkeys.[6]

The kinkajou's slender five-inch extrudable tongue helps the animal to obtain fruit and to lick nectar from flowers, so that it sometimes acts as a pollinator. (Nectar is also sometimes obtained by eating entire flowers.) Although captive specimens will avidly eat honey (hence the name "honey bear"), honey has not yet been observed in the diet of wild kinkajous.

Phylogeny

Olingos are similar to the kinkajou in morphology and habits. However, genetic studies have shown that kinkajous were an early offshoot of the ancestral procyonid line and are not closely related to any of the other extant procyonids.[7] The similarities between the kinkajou and olingos are thus an example of parallel evolution; the closest relatives of the olingos are actually the coatis.[7] The kinkajou is distinguished from olingos by its prehensile tail, its foreshortened muzzle, its extrudable tongue, and its lack of anal scent glands.[8] The only other carnivoran with a prehensile tail is the binturong of Southeast Asia.

Kinkajous evolved in Central America and invaded the formerly isolated continent of South America several million years ago, as part of the Great American Interchange, when formation of the Isthmus of Panama made it possible to do so.[7]

Behavior

Kinkajou skeleton on display at the Museum of Osteology

Like raccoons, kinkajous' remarkable manipulatory abilities rival those of primates. The kinkajou has a short-haired, fully prehensile tail (like some New World monkeys), which it uses as a "fifth hand" in climbing. It does not use its tail for grasping food. Scent glands near the mouth, on the throat, and on the belly allow kinkajous to mark their territory and their travel routes. Kinkajous sleep in family units and groom one another. While they are usually solitary when foraging, they occasionally forage in small groups, and sometimes associate with olingos (which are also frugivorous).[9]

A nocturnal animal, the kinkajou's peak activity is usually between about 7:00 PM and midnight, and again an hour before dawn. During daylight hours, kinkajous sleep in tree hollows or in shaded tangles of leaves, avoiding direct sunlight.

Kinkajous breed throughout the year, giving birth to one or occasionally two small babies after a gestation period of 112 to 118 days.

As pets

Yawning kinkajou in a Costa Rican animal shelter

Kinkajous are sometimes kept as exotic pets. They are playful, generally quiet, docile, and have little odor. However, they can occasionally be aggressive. Kinkajous dislike sudden movements, noise, and being awake during the day. An agitated kinkajou may emit a scream and attack, usually clawing its victim and sometimes biting deeply. It has recently been discovered that pet kinkajous in the United States can be carriers of the roundworm Baylisascaris procyonis, which is capable of causing severe morbidity and even death in the owner, if infected.[10]

In El Salvador, Guatemala and Honduras pet kinkajous are commonly called micoleón, meaning "lion monkey". In Peru pet kinkajous are commonly referred to as "lirón". The lirón is often described as a "bear-monkey" or "bear-monkey hybrid".

They live an average of about 23 years in captivity, with a maximum recorded life span of 41 years.[11]

Subspecies

There are seven subspecies of kinkajou:[12]

References

  1. ^ a b Kays, R., Reid, F., Schipper, J. & Helgen, K. (2008). Potos flavus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 January 2009.
  2. ^ "Appendices I, II and III: The CITES Appendices". http://www.cites.org/eng/app/appendices.shtml. Retrieved 2010-08-30. 
  3. ^ Eisenberg, J. F.; Redford, K. H. (2000-05-15). Mammals of the Neotropics: The central neotropics: Ecuador, Peru, Bolivia, Brazil. University of Chicago Press. pp. 624 (see p. 289). ISBN 978-0-226-19542-1. http://books.google.com/?id=p2MDAzCeQQoC&dq&printsec=frontcover. 
  4. ^ [1] (2011).
  5. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  6. ^ a b c Kays, Roland W. (May 1999). "Food preferences of kinkajous (Potos flavus): a frugivorous carnivore". Journal of Mammalogy (American Society of Mammalogists) 80 (2): 589–599. doi:10.2307/1383303. JSTOR 1383303. 
  7. ^ a b c K.-P. Koepfli, M. E. Gompper, E. Eizirik, C.-C. Ho, L. Linden, J. E. Maldonado, R. K. Wayne (2007). "Phylogeny of the Procyonidae (Mammalia: Carvnivora): Molecules, morphology and the Great American Interchange". Molecular Phylogenetics and Evolution 43 (3): 1076–1095. doi:10.1016/j.ympev.2006.10.003. PMID 17174109. 
  8. ^ Ford, L. S.; Hoffman, R. S. (1988-12-27). "Potos flavus". Mammalian Species (American Society of Mammalogists) 321: 1–9. JSTOR 10.2307/3504086. 
  9. ^ Glatston, A. R. (October 1994). The red panda, olingos, coatis, raccoons, and their relatives: status survey. IUCN. pp. 103 (see p. 5). ISBN 978-2-8317-0046-5. http://www.carnivoreconservation.org/files/actionplans/procyonids_en.pdf. 
  10. ^ Kazacos, K. R.; et al. (2011-03-11). "Raccoon Roundworms in Pet Kinkajous --- Three States, 1999 and 2010". MMWR (CDC) 60 (10): 302–305. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm6010a2.htm. 
  11. ^ "Kinkajou". Honolulu Zoo web site. http://www.honoluluzoo.org/kinkajou.htm. Retrieved 2009-09-12. 
  12. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 626. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001650. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!