Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Of all North American pocket gophers, the Northern Pocket Gopher has the widest distribution, across most of the western United States and south-central Canada, and it occurs in the greatest variety of habitats. Only habitats with closed canopy and sparse groundcover are avoided. Northern Pocket Gophers are prodigious diggers, using both their front feet and their ever-growing incisors. Their burrow systems are elaborate, and depending on where they are, can be beneficial, aerating the soil, or a real problem for farmers.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Richardson, J., 1828.  Short characters of a few quadrupeds procured on Capt. Franklins late expedition, p. 518.  The Zoological Journal, 3:516-520.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed across central plains and western mountain regions in Canada and the United States, from southern British Columbia to central Alberta and southwestern Manitoba, south to South Dakota and northern New Mexico, northern Arizona, northern Nevada, and northeastern California (Patton, in Wilson and Reeder, 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Thomomys talpoides lives in the dry short-grass prairies, and has the greatest range of any pocket gopher in North America. They occur on both sides of the continental divide, ranging from mid-Manitoba in the north, to New Mexico at the south end. T. talpoides occurs as far west as the east side of the Cascade mountains, and (northern) Sierra Nevada range, and as far east as the Dakota Plains, east of the Black Hills. This area is generally called the North American West and Midwest. (McMahon, 1999)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Central plains and western mountain regions in Canada and the U.S. Southern British Columbia to central Alberta and southwestern Manitoba, south to central South Dakota and northern New Mexico, northern Arizona, northern Nevada, and northeastern California (Patton, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

T. talpoides is highly adapted to a tunneling lifestyle. These pocket gophers have thick, tapering bodies, short limbs with strong claws, loose skin, and reduced eyes and ears. They have sharp and fast growing upper and lower incisors, which are extensively used to help them dig. These rodents have external cheek pouches.

The pelage (fur) of T. talpoides ranges from grayish brown, to brown, and yellowish-brown in color. Complex spring molting patterns create the appearance of waves and bands across the body, from head to tail. The fur is soft and short. It is not as glossy than that of other Thomomys species.

Females are about 10% smaller than males, in both weight and length. The average adult T. talpoides weighs from 60 to 160 grams. Weight varies with respect to elevation. The total body length is 165 to 260 mm, and tail length varies from 40 to 74 mm.

Characteristics that separates T. talpoides from other Thomomys species are: 1) small rounded ears less than 6.9 mm. 2) No sphenoidal fissure in the skull. 3) Smooth anterior surface of the upper incisors.

(McMahon, 1999)

Range mass: 60 to 160 g.

Range length: 165 to 260 mm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.679 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 23 cm

Weight: 130 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 165-260 mm

Weight:
Range: 60-160 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Northern pocket gophers prefer deep soils along streams and in meadows and cultivated fields, but they are also found in rocky soils and clay. They occupy a wide variety of habitats ranging from sagebrush steppe, mountain meadows and tundra, to agricultural fields, grasslands, and suburban gardens and lawns (MacMahon, in Wilson and Ruff, 1999). They are primarily fossorial. Young are born in a grass or leaf-lined nests in a natal chamber within the underground burrow system. Females are monoestrous. Mating usually occurs from March to mid-June, depending on weather and latitude. Gestation lasts about 19-20 days. Litter size is four to seven. Young disperse from the natal burrow at about two months of age (Jones et al., 1983).

They are primarily solitary. Home range may occupy 150-200sq yards. Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye, 1988). They are active throughout the year. They do not hibernate but may be inactive in winter and midsummer for brief periods. Most burrowing activity occurs in spring and fall when soil is loose. Circadian but peaks of activity at dawn and dusk.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

T. talpoides occupies a greater variety of habitats than any other pocket gopher species. They are fossorial, which means they live in tunnels underground. They can be found in mountain meadows, tundra, valley grasslands, sagebrush steppe, and agricultural fields. The uniting feature of these habitats is the absence of significant canopy cover, and abundant ground cover that supplies their nutritional needs. Generally speaking, they prefer deep well drained soils, but are also found in compacted clays and shallow rocky soils. The elevation range of T. talpoides is 915-3750 meters, but they are most common at 1220-2745 meters. (McMahon 1999)

Range elevation: 915 to 3750 m.

Average elevation: 1220-3745 m.

Habitat Regions: temperate

Terrestrial Biomes: tundra ; taiga ; mountains

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers deep soils along streams and in meadows and cultivated fields, but also found in rocky soils and clay. Occupies a wide variety of habitats ranging from sagebrush steppe, mountain meadows and tundra, to agricultural fields, grasslands, and suburban gardens and lawns (MacMahon, in Wilson and Ruff 1999). Fossorial. Young are born in a grass- or leaf-lined nest in a natal chamber within the underground burrow system.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern pocket gophers are best described as generalist herbivores. They primarily consume the roots, corms, rhizomes, and stems, of forbs and herbs. They tend to avoid woody vegetation. Fruits of Opuntia species are a favorite, if available. At certain times of year, grasses may compose up to 50% of their diet, although they prefer agricultural crops, if available. Overall, the diet of T. talpoides is composed of 80% areal plant material. They search under and above ground, and typically pull the entire plant under ground. One northern pocket gopher was witnessed stuffing its pouches so full of alfalfa that the pouches were dragging on the ground! This species is known to eat its feces, and to cache food. (McMahon, 1999; Lacey, 2000)

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore , Frugivore , Granivore ); coprophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Roots of forbs, cacti, and grasses, stems, bulbs, tubers and leaves. Food is often carried in cheek pouches and stored in underground chambers or in or under snow. May feed in vegetable gardens, grainfields, and orchards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Northern pocket gophers serve a critical role in maintaining the bio-diversity, habitat structure, and functionality of the ecosystems they inhabit. They attain population densities of up to 20 per hectare. For this reason alone, they are a significant food source for larger vertebrates.

Even more important is the manner in which T. talpoides improves site productivity. It has been estimated that T. talpoides turns over 8-15.7 Megagrams of soil/hectare. (11.2-85.1 Mg/ha has been reported in extreme cases.) This means several things: Burrowing activities loosen and aerate soils, deliver organic material to the subsoil (thereby improving its fertility), hasten the soil forming processes, deepen the soil profile, expand the plant-available water-holding-capacity of the soil, and generally improve the biological chemical and physical aspects of soils. The result is that relative to unaltered soil, there are more plant species and higher plant densities on soil that has altered by T. talpoides. In several locations, visual evidence of northern pocket gopher activities is present, on up to 40% of the ground surface area. (McMahon, 1999; Lacey, 2000)

Ecosystem Impact: disperses seeds; creates habitat; soil aeration ; keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation upon T. talpoides is best performed by efficient digging carnivores, such as badgers. Other predator species include: coyote, skunk, weasel, great horned owl, bobcat, fox, some snakes, some hawks, etc. Northern pocket gophers are a "keystone species" that many other regional animals depend upon. Specific anti-predator adaptations are not known for this species, although their subterranian existence is probably a way in which they avoid the predatory birds to which so many rodents fall prey. (McMahon, 1999)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. Home range may occupy 150-200 sq yards. Population density varies widely with quality of habitat; from < 1/acre to > 50/acre (Banfield 1974, Jones et al. 1983). Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Vision and hearing are very poor in T. talpoides. Their senses of touch and smell are their primary means of communication. (McMahon, 1999)

Communication Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Does not hibernate but may be inactive in winter and midsummer for brief periods. Most burrowing activity occurs in spring and fall when soil is loose. Circadian but peaks of activity at dawn and dusk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity, T. talpoides lives 5-6 years. In the "real world" their life expectancy is 18-24 months. Total population replacement occurs in roughly 5 years. Because males tend to uniformly die before females, there are certain times in the late summer where the majority of the population is female. (McMahon, 1999)

Range lifespan

Status: wild:
5 (high) years.

Average lifespan

Status: wild:
18-24 years.

Typical lifespan

Status: captivity:
5 to 6 years.

Average lifespan

Status: wild:
1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals do not commonly live for more than two years (Don Wilson and Sue Ruff 1999). They have been reported to live up to 6 years, though (Ernest 2003). Little is known about their longevity in captivity and without more detailed studies their maximum longevity must be classified as unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of these animals has not been described. They are generally solitary, but males are allowed into female tunnels during the breeding season (Nowak, 1999)

Reproduction occurs in the spring, generally occuring later at higher elevations. The gestation periods last 18 to 20 days. Young are usually born from mid-May to mid June, but births occur later at higher elevations. Pocket gophers are not well developed at birth, and are therefore, altricial. Care of young is an exclusively maternal responsibility, as these are very anti-social animals. Birth weight averages 3 grams. The young are weaned by day 40. Young disperse from the natal burrow around 2 months of age, and reach maturity in 3-6 months. An average mature female T. talpoides will have one litter per year that consists of 4-7 young. (McMahon, 1999)

Breeding season: Breeding occurs in the spring, with births following in late spring or summer.

Range number of offspring: 3 to 7.

Range gestation period: 18 to 20 days.

Average weaning age: 40 days.

Range age at sexual or reproductive maturity (female): 3 to 6 months.

Range age at sexual or reproductive maturity (male): 3 to 6 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 3.175 g.

Average number of offspring: 5.

No male parental care has been reported for this species. Females care for their young within their tunnels. The young are nursed for about 40 days. They remain with the mother until they disperse around the age of two months (Nowak, 1999)

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females are monoestrous. Mating usually occurs from March to mid-June, depending on weather and latitude. Gestation lasts about 19-20 days. Litter size is 4-7. Young disperse from natal burrow at about 2 months of age (Jones et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thomomys talpoides

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0203-06|AY331091|Thomomys talpoides| AATCGCTGATTATTCTCCACTAATCATAAAGATATTGGAACCTTATACATGATTTTTGGTGCTTGAGCTGGAATAGTAGGAACAGGCTTA---AGCATTTTAATTCGAGCTGAATTGGGTCAACCAGGAACATTATTAGGAGAT---GATCAAATCTACAACGTTATTGTCACAGCCCACGCTTTTGTTATAATTTTCTTCATAGTTATACCTATTTTAATTGGTGGATTTGGTAATTGATTAGTACCTTTAATA---ATTGGAGCACCTGATATAGCATTTCCGCGTATAAATAATATAAGCTTTTGACTACTACCACCTTCTTTTCTACTGCTTCTAGCTTCATCAATAGTGGAGGCAGGGGCTGGAACTGGTTGAACTGTATATCCCCCATTAGCCGGTAATCTAGCCCACGCAGGAGCTTCTGTTGATTTA---ACCATTTTTTCACTACACCTGGCAGGTGTATCATCAATTTTAGGGGCTATTAATTTTATTACTACTATTATTAACATAAAACCACCAGCAATCTCTCAATATCAAACACCTTTATTTGTTTGATCTGTGTTAATTACTGCAGTTCTTCTTCTCCTATCTCTGCCAGTTCTAGCTGCA---GGTATTACTATGTTATTAACAGACCGCAATTTAAACACTACTTTTTTTGACCCTGCCGGAGGTGGAGATCCTATTCTTTATCAACATCTTTTCTGATTTTTTGGTCACCCAGAAGTTTATATCTTAATTTTACCTGGGTTTGGTATAATTTCCCACATTGTTACTTACTACTCAGGCAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCCATAATATCAATCGGGTTTTTAGGGTTTATTGTATGAGCACACCACATGTTTACAGTGGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thomomys talpoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because it is very widespread, common, there are no major threats, and it occurs in several protected areas.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Not a species of concern.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Thomomys talpoides douglassi, the Vancouver pocket gopher, is Vulnerable; T. talpoides limosus, Columbia River pocket gopher, and T. talpoides segregatus, Goat Mountain pocket gopher, are Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widespread and common (NatureServe). Estimated densities of up to 91.6/hectare have been recorded (Verts and Carraway, 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is not of conservation concern, and its range includes many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

According to many farmers T. talpoides is a "bad" species, because they are known to eat up to 245 kg of plant material per year, and because they love agricultural fields. Their mounds can dull the blades of farm machines, and they tend to re-route irrigation water, causing localized flooding. For these reasons, farmers try to control T. talpoides by poisoning and trapping them. Modern techniques of controlling T. talpoides populations include the spreading of predator feces, urine, and scent gland secretions. Another strategy is to inject pepper oil extract (capsicum) into the soil. This irritant is effective in making gophers avoid that area. Gopher contol is expensive, and can also have direct negative effects on crop plants. (McMahon, 1999; Sterner, 1999; Smallwood, 1997)

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the long term, T. talpoides is beneficial to farm fields and pastures because of the soil fertility maintenance roles that are described in the ecology section. Over a 31 year study in central Utah, northern pocket gophers increased soil porosity, organic matter, total nitrogen, and total phosphorous. Another study has shown significant increases in soil calcium, soil potassium, and soil moisture, due to northern pocket gopher activity. Percieved direct-crop herbivory by pocket gophers may not be as costly as prevoiusly estimated, if we quantify how much less productive that land would be without them (in the long term). When looking at multiple scales, researchers have shown that a similar species, T. bottae, may actually increase overall productivity in a California alfalfa field. I love to quote my Soil Science teacher who says: "...although we may not like them while they are there, it's good to have had gophers in your field." (Hauxwell, 1999. Personal communication; Lacey, 2000; Litaor, 1995; Smallwood, 1997)

Positive Impacts: produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Pocket Gopher

The Northern Pocket Gopher, Thomomys talpoides, was first discovered by Lewis and Clark on April 9, 1805 at the mouth of the Knife River, North Dakota. These animals are often rich brown or yellowish brown, but also grayish or closely approaching local soil color and have white markings under chin. They also weigh less than a quarter of a pound (110 grams).

Their habitat consists usually of good soil in meadows or along streams; most often in mountains, but also in lowlands.

A special note about the Northern Pocket Gopher is that it rarely appears above ground; when it does, it rarely ventures more than 2.5 feet from a burrow entrance. Underground, however, they often have tunnels that extend hundreds of feet where they live, store food and mate.[1]

References

  1. ^ Linzey, A.V. & NatureServe (Hammerson, G.) (2008). Thomomys talpoides. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 15 March 2009. Database entry includes a brief justification of why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included T. idahoensis and T. clusius. Considerable chromosomal differentiation in different parts of the range suggests that more than one biological species is currently included under the name T. talpoides (Thaeler 1985; Patton, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!