Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

"As is the case with a number of pocket gopher species, most aspects of the Western Pocket Gopher's life have not yet been studied. This Pocket Gopher lives in rich volcanic soils of alpine meadows and small glacial prairies, west of the Cascade Mountains in northern California, Oregon, and Washington. When Western Pocket Gophers are caught, they are always alone in their burrows."

Links:
Mammal Species of the World
  • Original description: Merriam, C.H., 1897.  Proceedings of the Biological Society of Washington, 11:214.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species has a relatively limited distribution along the Pacific coast of the United States from Washington to northern California (Hafner et al., 1998). The overall range is comprised of multiple disjunct population segments (Verts and Carraway, 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Thomomys mazama is found in the Pacific Northwest of the United States. Populations occur in Washington, Oregon, and California (Verts and Carraway, 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Northwestern Washington through western and central Oregon to northern California (Verts and Carraway 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Thomomys mazama is highly fossorial. It is adapted for this mode of life with heavily muscled shoulders and head tapering to relatively narrow hips. It has short limbs with five toes on each of the four feet. The toes on the front limbs have much longer curved claws than the hind limbs. The eyes and ears are small. The skull is flattened dorso-ventrally and has wide spreading zygomatic arches. The mandibles are heavy (Verts and Carraway, 2000).

The dorsal pelage of T. mazama exhibits a large range of colors in various subspecies. It is a shiny iridescent black in the subspecies T. m. niger. In T. m. tumuli and T. m. pugetensis it is blackish brown. The fur is dark brown in T. m. fuscus and T. m. louiei; reddish brown in T. m. hesperus, T. m. mazama, T. m. helleri, and T. m. melanops; reddish tan in T. m. couchi and T. m. tacomensis; light yellowish brown in T. m. nasicus, T. m. premaxillaris, and T. m. glacialis; and light brown in T. m. oregonus and T. m. yelmensis. The nose and face are dusky or black. The chest often has white splotches. The tip of the tail is lighter colored, usually buff, white, or light gray and may be almost naked.

Male T. mazama are generally larger than females. The total average length of T. mazama is 204 mm for females and 213 mm for males. The average tail length is 62 mm for females and 64.5 mm for males. The baculum is commonly used to differentiate between juveniles and adults. It is long and slender. The minimum length to be classified as an adult is 21-22 mm, but it can reach a length of about 26 mm. The dental formula for T. mazama is i 1/1 c 0/0 p 1/1 m 3/3 with a total of 20 teeth. The premolars are figure eight shaped. Chewing is propalinal (Verts and Carraway, 2000).

Range length: 204 to 213 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Verts, B., L. Carraway. 2000. Thomomys mazama. Mammalian Species, 641: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 24 cm

Weight: 96 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 191-233 mm

Weight:
Range: 75-125 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in open grassy areas, including pastures, prairies, savannas, and open early seral woodlands and forests (Verts and Carraway, 2000, Stinson 2005). This species is fossorial, inhabiting deep, humic volcanic soils (Patton, in Wilson and Ruff 1999). In this species, gestation lasts about 28 days. Females produce one litter of four to six young each year. Young are born in March-June. Pocket gophers are primarily solitary. Predators include owls, coyotes, and bobcats. Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye, 1988). Diet includes roots, tubers, bulbs and some surface vegetation. Forages from underground burrows. May also forage on the surface of the ground at night or on overcast days. Collects food in cheek pouches and stores it in underground storage chamber.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Thomomys mazama usually occupies a narrower array of niches than other species of Thomomys. Thomomys mazama is found in a variety of soil types in prairies, meadows, orchards, and abandoned farms. They are not frequently found in dense forest. Common vegetation in the habitats of T. mazama includes bracken fern, Douglas fir, perennial grasses, red sorrel, and western strawberry.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: This fossorial rodent inhabits open grassy areas, including subalpine meadows, pastures, glacial outwash prairies, savannas, and open early seral woodlands and forests (Johnson and Cassidy 1997, Verts and Carraway 2000, Stinson 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Grasses compose the largest portion of the diet of T. mazama annually. Woody plants such as Ponderosa pine were consumed mostly in the winter. Roots were eaten mostly in the autumn and spring and compose a large portion of the diet during these periods. Forbs are preferred when many food sources are available. In general, consumption of various species of plants corresponded to their abundance (Verts and Carraway, 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats roots, tubers, bulbs and some surface vegetation. Forages from underground burrows. May also forage on the surface of the ground at night or on overcast days. Collects food in cheek pouches and stores it in underground storage chamber.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Thomomys mazama may play an important role in the aeration, mixing, and drainage of soil. They also contribute to the distribution and succession of plant species and communities. They are a source of food to many mammals and birds. Their burrows are used and inhabited by many other species. Their ecological importance is suggested by the fact that there is an ecological equivalent to the gopher on almost every continent (Witmer, 1996).

Ecosystem Impact: disperses seeds; creates habitat; soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Anti-predator adaptations are primarily behavioral. Thomamys mazama lives underground and emerges only briefly at night to forage. If threatened it retreats underground (Verts and Carraway, 2000).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Based on 1,394 specimens, Verts and Carraway (1998) mapped roughly 200 collection sites in the central portion of the range in Oregon. About 28 populations remain in Washington (Stinson 2005; D. Stinson, in litt., 2007, cited by USFWS 2007; G. J. Kenagy, in litt. 2007, cited by USFWS 2007).

Subspecies yelmensis (south Puget Sound prairies) (includes tacomensis, glacialis, tumuli, and pugetensis): Stinson (2005) mapped a few dozen extant populations that represent about 14 distinct areas. He mapped 13 historical locations in which the species recently has not been found.

Subspecies melanops (Olympic Mountains): Stinson (2005) mapped 6 extant populations and 3 historical localities.

Subspecies louiei (southwestern Washington): Stinson (2005) mapped one historical locality and no known extant populations.

Subspecies couchi: Stinson (2005) mapped several (about 7) extant populations representing a few distinct population clusters and one historical location.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 100,000, with the great majority in Oregon.

In Washington, most surviving populations are small (<100) and appear to be isolated from other populations (Stinson 2005). Total population for all subspecies in Washington may be approximately 2,000 to substantially more than 5,000 individuals (Stinson 2005; D. Stinson, in litt., 2007, cited by USFWS 2007; G. J. Kenagy, in litt. 2007, cited by USFWS 2007). The largest populations occur on Fort Lewis, at the Olympia and Shelton airports, and possibly in the Olympic National Park (USFWS 2007). The Olympia Airport population includes an estimated 2,000-7,000 individuals (The Nature Conservancy and Washington State Department of Fish and Wildlife 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. Predators include owls, coyotes, and bobcats. Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: In the wild, these animals are expected to live up to 5 years (Bernhard Grzimek 1990). Little is known about their longevity in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is little information on the mating behavior of T. mazama. Individuals seem to rely on encountering each other through normal daily movement (Scheffer, 1938).

Mating has not been observed in captivity for T. mazama, but reproductive behavior can be inferred from individuals taken in from the wild. The females produce one litter per year during the October to June breeding season. The average litter size is five. The period of gestation is about one month and depends on environmental factors. Under extreme stress, one or more embryos may be reabsorbed (Scheffer, 1938).

Average number of offspring: 5.

Average gestation period: 30 days.

Average age at sexual or reproductive maturity (female): 1 months.

Average age at sexual or reproductive maturity (male): 1 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal )

Average gestation period: 30 days.

Average number of offspring: 5.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts about 28 days. Females produce 1 litter of 4-6 young each year. Young are born in March-June.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thomomys mazama

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0204-06|AY331092|Thomomys mazama| AACCGCTGACTATTTTCCACTAATCATAAGGATATTGGAACTCTGTATATAATTTTTGGCGCTTGGGCTGGAATAGTAGGAACCGGTCTA---AGTATTTTAATTCGAGCTGAGCTTGGTCAACCTGGAACATTACTGGGTGAT---GATCAAATTTATAATGTCATTGTTACAGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCGATCTTAATTGGTGGATTTGGTAACTGATTAGTGCCTTTAATA---ATCGGGGCTCCTGATATGGCATTTCCACGAATAAATAATATAAGTTTTTGATTACTTCCCCCTTCTTTCTTACTACTTTTAGCTTCCTCTATAGTAGAAGCAGGGGCCGGTACCGGTTGAACAGTTTATCCCCCACTAGCCGGTAACTTAGCTCATGCAGGAGCTTCTGTAGACTTA---ACTATTTTTTCACTGCACTTAGCAGGTGTATCATCAATTTTAGGGGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCAATTTCTCAATATCAAACACCACTATTTGTATGATCAGTCTTAATCACTGCTGTTCTACTGCTTCTATCTTTACCAGTTCTAGCTGCA---GGTATTACTATATTACTAACAGACCGCAATTTAAATACTACTTTCTTTGATCCTGCCGGTGGGGGAGACCCAATTCTTTATCAACATCTTTTCTGATTCTTTGGTCACCCGGAAGTTTACATCTTGATCTTACCCGGTTTTGGTATAATCTCACATATCGTCACTTATTATTCTGGTAAAAAA---GAGCCTTTTGGTTACATAGGTATAGTATGGGCTATAATATCCATTGGGTTTTTAGGATTTATTGTTTGGGCTCACCATATATTTACAGTAGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thomomys mazama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because its range is much greater than 20,000 km², it occurs in several protected areas, and its population is unlikely to be declining fast enough to qualify for listing in a more threatened category. There are major threats identified for this species, and its range is fragmented so it may become threatened in the future if threats continue.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As of 1998 T. mazama was listed as a candidate species by the Washington Department of Fish and Wildlife and as a species of concern by the U.S. Fish and Wildlife Service but was not included in lists of threatened species from the Oregon Department of Fish and Wildlife or the California Department of Fish and Game (Verts and Carraway, 2000).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Common in some areas of the range (Washington, Oregon, northern California); somewhat restricted, spotty distribution; significant declines have occurred in areas where forest has expanded and in urbanized regions of Washington; subspecies melanops appears to be secure in Olympic National Park.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Candidate
Date Listed:
Lead Region:   Pacific Region (Region 1) 
Where Listed:


For most current information and documents related to the conservation status and management of Thomomys mazama, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

#The Tacoma Pocket Gopher, T. mazama tacomensis, is Extinct. T. mazama louiei, the Cathlamet Pocket Gopher, is Critically Endangered. Five other subspecies are Vulnerable: T. m. couchi (Puget Sound pocket gopher), T. m. glacialis (Roy Prairie), T. m. pugetensis (Olympia), T. m. tumuli (Rocky Prairie), and T. m. yelmensis (Yelm Prairie). The parent species and three subspecies, T. m. helleri (Rogue River) and T. m. melanops (Olympic Mountains), and T.m. pugetensis (Olympia Pocket Gopher) are Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total adult population size is unknown but likely exceeds 100,000, with the great majority in Oregon. In Washington, most surviving populations are small (<100) and appear to be isolated from other populations (Stinson, 2005). The total of all remaining populations of T. mazama in Washington may be between two thousand and five thousand individuals.

Based on 1,394 specimens, Verts and Carraway (1998) mapped roughly 200 collection sites in the central portion of the range in Oregon. About 27 populations remain in Washington (Stinson, 2005). In Washington, additional surveys are needed to document remnant populations in the rapidly developing areas on historical prairies of Thurston and Pierce counties, as well as in other regions of the state (Stinson, 2005).

Densities of up to 60/hectare have been reported (Verts and Carraway, 2000) for this species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In Washington, habitat loss to succession, agriculture, and development has eliminated most of the prairie habitat of this species in the south Puget Sound region, and habitat continues to be lost to residential development and other human uses (Stinson, 2005). Existing habitat is being degraded by heavy grazing of pastures and the invasion of Scotch broom and other weedy non-native plants (Stinson, 2005).

Stinson (2005) reported the following additional information for Washington populations of Thomomys mazama. Pocket gophers may not persist in residential areas due to persecution by trapping, poisoning, and predation by cats and dogs. Gravel mining affects gopher habitat on some private lands. Most occupied habitat on public lands is affected by non conservation uses including military training and recreation. Gopher populations at airports can be affected by the development of airport-related facilities and businesses, and the management of airport grassland. The small size and isolation of most remaining populations of Mazama pocket gopher put them at risk of local extinction, and without increased protection, all but T. m. melanops in Olympic National Park could go extinct. Historically, local gopher populations probably exchanged genetic material by individuals occasionally dispersing through intervening oak woodlands and forest; prairie patches where gophers went extinct would eventually be recolonized. Today, these prairie patches are increasingly surrounded by roads and suburbs that are inhospitable to dispersing gophers. Populations that become extinct are unlikely to be recolonized without reintroductions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primary threats to the Mazama pocket gopher include landowner intolerance, residential
and commercial development of their habitat, invasive plants and plant succession, and the vulnerabilities of small, isolated populations (McAllister 2006).

In Washington, habitat loss to succession, agriculture, and development has eliminated most of the prairie habitat of this species in the south Puget Sound region, and habitat continues to be lost to residential development and other human uses (Stinson 2005). Existing habitat is being degraded by heavy grazing of pastures (Stinson 2005). The basic ecological processes that maintain prairies have disappeared from, or have been altered on, the few protected prairie sites. Fire regimes have been altered, and prairie habitat has been invaded by nonnative plant species (Dunn and Ewing 1997).

Stinson (2005) reported the following additional information for Washington populations of Thomomys mazama. Pocket gophers may not persist in residential areas due to persecution by trapping, poisoning, and predation by cats and dogs. Gravel mining affects gopher habitat on some private lands. Most occupied habitat on public lands is affected by nonconservation uses including military training and recreation. Gopher populations at airports can be affected by development of airport-related facilities and businesses, and management of airport grassland. The small size and isolation of most remaining populations of Mazama pocket gopher put them at risk of local extinction, and without increased protection, all but T. m. melanops in Olympic National Park could go extinct. Historically, local gopher populations probably exchanged genetic material by individuals occasionally dispersing through intervening oak woodlands and forest; prairie patches where gophers went extinct would eventually be recolonized. Today, these prairie patches are increasingly surrounded by roads and suburbs that are inhospitable to dispersing gophers. Populations that become extinct are unlikely to be recolonized without reintroductions.

Verts and Carraway (1998) did not comment on conservation concerns in Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
At least several occurrences of the western pocket gopher are in national parks and other protected habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Protected prairies that lack gophers and where they might be introduced include: Mima Mounds Natural Area Preserve, Glacial Heritage County Park, West Rocky Prairie, and Wolf Haven (McAllister 2006).

Management Requirements: Little management has occurred to benefit this species specifically, although removal of Douglas-fir and Scotch broom, and other prairie restoration activities, likely have benefited gophers (Stinson 2005).

Management Research Needs: Moderate disturbance in the form of grazing, mowing, or fire appears to benefit gophers, perhaps by maintaining plant vigor and postponing or preventing plant senescence, but further research is needed, including consideration of plant community composition and secondary effects like soil compaction (McAllister 2006).

Biological Research Needs: See TNC and WDFW (2006) for research needs in Washington.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Several to many (4-40) occurrences appropriately protected and managed

Comments: At least several occurrences are in national parks and other protected habitats. Relatively secure pocket gopher populations are found at Scatter Creek Wildlife Area, Fort Lewis' Rainier Training Area and the TNC Morgan Preserve, portions of Fort Lewis in Pierce County, Rocky Prairie Natural Area Preserve, the Colvin Ranch (Grassland Reserve Program enrollment), the Olympia Airport, the Shelton Airport, and Olympic National Park (McAllister 2006).

Needs: Large areas capable of supporting populations that are likely to remain viable into the distant future need to be proected (McAllister 2006). Small set-asides in residential and commercial developments may not support gopher populations over the long term (McAllister 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Thomomys mazama can cause the failure of forest plantings because they eat the roots, leaves, and stems of the seedlings. This has led to efforts to control and eliminate gopher populations with repellents and toxins (Witmer, 2000).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: "Often contributes significantly to failure of forest plantings, especially in the ponderosa pine zone" (Verts and Carraway 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: USFWS (2007) summarized planned or implemented conservation measures as follows.

Fort Lewis has identified several grassland management goals for its ownership, and is currently working with USFWS on a Candidate Conservation Agreement with Assurances, in partnership with Port of Olympia, The Nature Conservancy (TNC), Thurston County, WDFW, and WDNR. These include no net reduction in the quantity or quality of moderate- and high-quality prairie; and, viable populations of all prairie-dependent and prairie-associated species. A draft Agreement is anticipated during the Fiscal Year 2007. TNC has been working with Fort Lewis on prairie habitat enhancement, and with help from USFWS purchased 125 acres of prairie habitat adjacent to Fort Lewis in 2005.

TNC is also involved in habitat restoration with Thurston County on Black River-Mima Prairie Glacial Heritage Preserve. WDFW has initiated restoration work on Scatter Creek Wildlife Area, although the initial focus has been on Scot's broom control. WDNR removed Douglas-fir and planted native prairie plants on the Rocky Prairie Natural Area Preserve with a grant from USFWS. They also conducted prescribed burning on Mima Mounds Natural Area Preserve. Restoration and maintenance for native prairie, where it exists, means it will be protected from loss or destruction, although other risks (e.g., predation) may still exist. Restoration efforts are in place on prairies throughout western Washington, not all of which are known to be occupied by Mazama pocket gophers. Ft. Lewis, Scatter Creek Wildlife Area, and Rocky Prairie Natural Area Preserve are all known to have Mazama pocket gophers. Gophers should benefit from the improved vegetation quality on these sites. It is unknown if the Black River-Mima Prairie Glacial Heritage Preserve contains Mazama pocket gophers.

WDFW recently added land to the Scatter Creek Wildlife Area. WDFW has recently acquired 800 acres of land in the area informally known as "West Rocky Prairie," 300 acres of which was the largest and best remaining south Puget Sound prairie in private hands. WDFW has acquired 130 acres of prairie habitat in Thurston County for the management of prairie-dependent species. This property is being managed by The Nature Conservancy. These purchases will protect Mazama pocket gopher populations from future development. WDFW has prepared a status review of the Mazama pocket gopher (Stinson 2005).

An experimental translocation of gophers to some land owned byWolf Haven took place in 2005. As of early summer 2006, at least some of the gophers had persisted. The long-term success of this endeavor is unknown. There is some concern for genetic mixing of subpopulations if translocated populations aren't isolated from "natural" populations. Gopher food may need to be supplemented (The Nature Conservancy and WDFW 2006). Still, if areas are being developed and populations that would otherwise be lost can be translocated instead, the idea has potential merit.

USFWS (2007) recommended the following conservation measures: preserve existing Mazama pocket gopher habitat; restore historical and existing Mazama pocket gopher habitat where it has been invaded by woody vegetation, especially in areas where Mazama pocket gophers still occur; protect Mazama pocket gophers from trapping and predation; develop a Mazama pocket gopher fact sheet with information about gophers, non-lethal means of protecting plants, and including information on protecting gophers from domestic pets; target outreach and education to private landowners with property(ies) that might provide connectivity between occupied and potential sites; highlight the status of the gopher as well as the possibilities for co-existence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mazama Pocket Gopher

The Mazama Pocket Gopher, Thomomys mazama, is a smooth-toothed pocket gopher restricted to the Pacific Northwest. The species ranges from coastal Washington, through Oregon, and into north-central California.

Subspecies

Subspecies of the Mazama Pocket Gopher include:

References

  1. ^ Linzey, A.V. & NatureServe (Hammerson, G.) (2008). Thomomys mazama. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 15 March 2009. Database entry includes a brief justification of why this species is of least concern
  • Nowak, R. M. 1999. Walker's Mammals of the World, Vol. 2. Johns Hopkins University Press, London.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Thomomys mazama was regarded as a subspecies of T. monticola in some older literature. Fifteen subspecies were recognized by Hall (1981). These subspecies were named several decades ago and were based on fur color, body size, and skull characteristics. Sample sizes upon which the subspecies were based were small. For example, in a morphological study of pocket gopher subspecies in Washington, Dalquest and Scheffer (1944) stated that they "did not have sufficiently large series of individuals of the same age and sex from single localities to compare populations by means of standard errors." Furthermore, morphological characteristics such as those that served as the original basis for the subspecies descriptions are now known to be highly variable traits that may be affected by environmental factors such as diet (Patton and Brylski 1987, Smith and Patton 1988, Steinberg and Heller 1997, Baker et al. 2003).

Steinberg (1995, 1999) addressed taxonomic questions regarding the validity of the described T. mazama subspecies. She used cytochrome b variation to examine relationships among five T. mazama subspecies in Washington and determined that the subspecies glacialis, pugetensis, and yelmensis, which occupy closely adjacent ranges in the south Puget Sound area, exhibited no differences. She was unable to find extant populations of tumuli, tacomensis, or louiei. However, based on the results for the other south Puget Sound subspecies, it may be safe to assume that subspecies tumuli and tacomensis would not exibit significant differences from glacialis, pugetensis, and yelmensis. In fact, Steinberg and Heller (1997) anticipated that glacialis, pugetensis, tumuli, and tacomensis would become synonyms of yelmensis. This would leave four disjunct subspecies, T. m. melanops, T. m. couchi, T. m. louiei, and T. m. yelmensis, in Washington.

Based on recent genetic analyses, T. m. melanops may warrant consideration as a distinct species (Welch and Kenagy 2006). Further study is needed.

Genetic data indicate that Thomomys talpoides douglasii (Hall 1981), known from Clark County, Washington, actually is a subspecies of T. mazama (Welch and Kenagy 2006; Kenagy data, cited by USFWS 2007). Furthermore, T. mazama oregonus may not be distinguishable from T. m. douglasii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!