Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Brassaricyon gabbii is typically found from Nicaragua to Bolivia, where it is locally abundant and it is sparsely distributed in the western Amazon basin.

Biogeographic Regions: neotropical (Native )

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Kays, R. 2000. The behavior and ecology of olingos (Bassaricyon gabbii) and their competition with kinkajous (Potos flavus) in central Panama. Mammalia, 64: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species is distributed in west Colombia, Costa Rica, northern Ecuador, central Nicaragua and Panama.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 This species occurs in the central portion of Central America, in montane and foothill forests, from northern Nicaragua to Costa Rica and into the Chiriqui Mountains in western Panama, possibly also extending north into Honduras and Guatemala (Reid 2009; see below). Northern olingos are recorded at elevations as low as sea level, but are most commonly encountered in forests above 1000 m, and extend elevationally at least as high as 1700 m (USNM 324293), and probably as high as the upper limit of forest on the highest peaks in Costa Rica. Forested areas above 1000 m in Central America can be understood to be the core distribution of this species. Vouchered records are from the north-central mountains of Nicaragua (Allen 1908, AMNH, USNM); the mountains of Costa Rica, including the slopes stretching down to the Atlantic coast (Allen 1877, Allen 1908, Harris 1932, Goodwin 1946, Wilson 1983, Timm et al. 1989, Reid 1997, Timm and LaVal 2000, de la Rosa and Nocke 2000, Wainwright 2007, Reid 2009) and a few records of observations from the Pacific slopes (Puntarenas Province: Daily et al. 2003; Guanacaste Province: González-Maya and Belant 2010); and in the Chiriqui Mountains of western Panama (Enders 1936, ANSP, USNM). Reid (2009) included the Azuero Peninsula of Panama in a distribution map for Bassaricyon, but we can trace no record from this region and the basis of this record is unclear (F. Reid, R. Samudio, J. Pino, in litt., 2012–2013). The eastern limits of occurrence for this species are not yet firmly established, but the boundary of occurrence between Bassaricyon gabbii and Bassaricyon medius orinomus apparently lies between 81 and 80 degrees longitude in central Panama. Ours is the first study to document the marked taxonomic distinction between Bassaricyon gabbii of (especially montane) central Mesoamerica, including western Panama, and Bassaricyon medius orinomus of eastern Panama, the Central American member of a group of closely related lowland taxa that also includes Bassaricyon medius medius (of northern South America west of the Andes) and Bassaricyon alleni (of South America east of the Andes). The nature of the interactions between Bassaricyon gabbii and Bassaricyon medius orinomus at this boundary (whether involving, e.g., parapatry, sympatric overlap, or limited hybridization) is unknown and a priority for field study (see Figures 11–12).  There are unverified records of olingos occurring north of Nicaragua, in Honduras and Guatemala, and these records may represent Bassaricyon gabbii. Ordóñez Garza et al. (1999–2000) reported a night sighting of an olingo in Honduras at “La Picucha, Montaña de Babilonia, 1380 m, Parque Nacional Sierra de Agalta, Departamento de Olancho” and discussed a museum specimen of an olingo (later apparently lost) obtained from hunters in Guatemala near the Honduras border at “Montaña Cerro Negro Norte… Río Bobos… 300–500 m” in the Sierra del Merendón, Departamento de Izabal” (Ordóñez Garza et al. 1999–2000, McCarthy and Pérez 2006). Neither of these localities is immediately adjacent to large contiguous areas of Bassaricyon gabbii occurrence as predicted by our range modeling analyses (Figure 11), but both areas could represent relevant habitats for the Northern Olingo, and verifying the occurrence of olingo populations in Honduras or Guatemala should be considered an important goal in Mesoamerican mammalogy.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristofer M. Helgen, C. Miguel Pinto, Roland Kays, Lauren E. Helgen, Mirian T. N. Tsuchiya, Aleta Quinn, Don E. Wilson, Jesús E. Maldonado

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bassaricyon gabbii measures 350 to 470 mm long, with a tail length of 400 to 480 mm. These animals weigh between 970 and 1,500 g. The pelage can range from grey-brown to yellowish. Faint bands are visible on the tail. It has small rounded ears and a flattened head. Both males and females have similar body size.

Range mass: 970 to 1500 g.

Range length: 750 to 955 mm.

Average length: 850 mm.

Sexual Dimorphism: sexes alike

Other Physical Features: endothermic ; bilateral symmetry

  • Iwokrama International Centre for Rain Forest Conservation and Development. 1999. "Mammals of Iwokrama" (On-line). Iwokrama International Centre for Rain Forest Conservation and Development. Accessed May 13, 2004 at http://www.iwokrama.org/mammals/frame.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Bassaricyon gabbii Allen, 1876
Catalog Number: USNM A14214
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): W. Gabb
Locality: Talamanca, Limon, Costa Rica, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bassaricyon gabbii is found in evergreen forests, and on forest edges. It prefers the upper canopy of the forest and is rarely seen on the ground. Bassaricyon gabbii is found at elevations from sea level to 2,000 m.

Range elevation: 0 to 2000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Pontes, A., D. Chivers. 2002. Abundance, Habitat Use and Conservation of the Olingo Bassaricyon sp. in Maraca Ecological Station, Roraima, Brazilian Amazonia. Studies on Neotropical Fauna and Environment, 37/2: 105-109.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occurs near water in evergreen forests and forest edges, preferring upper canopy than ground from sea levels to 2000 meters (Nowak, 2005; Pontes and Chivers, 2002). Some authorities maintain that it is almost never encountered where there is human development, while other reports indicate the bushy-tailed olingo can adapt, to secondary vegetation or plantations in much the same way as kinkajous (Glatston, 1994). Its primarily frugivore but occasionally feeds on insects and small vertebrates (Kays, 2000; Nowak, 2005; Pontes and Chivers, 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bassaricyon gabbii feeds on fruits, nectar, flowers, insects, and small vertebrates. It is primarily a frugivore and prefers to feed in fruit trees. However, it is reported to consume considerably more meat in captivity than Potos flavus, and actively hunts warm-blooded animals.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; insects; terrestrial non-insect arthropods

Plant Foods: fruit; flowers; sap or other plant fluids

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bassaricyon gabbii is a minor seed disperser. In addition, this species may affect populations of small vertebrates upon which it preys, as well as those of large carnivores which prey upon it. It is a known competitor of Potos flavus, and is probably an indirect competitor with many diurnal primate species which feed on fruits.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The predators of B. gabbii are snakes and large cats like the jaguar (Panthera onca). Humans are known to kill them, but not for food.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Bassaricyon gabbii is prey of:
Homo sapiens
Panthera onca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Bassaricyon gabbii preys on:
Arthropoda
Insecta
Amphibia
Reptilia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

It is thought that B. gabbii communicates with conspecifics using sound. Olingos also have glands on either side of the anus that that are used in scent marking. The function of this scent marking may be to attract members of the opposite sex, or to mark territory. Because they are mammals, it is likely that visual signals, such as body posture, are used in some instances. Tactile communication is undoubtedly of importance between rivals, mates, as well as between mothers and offspring.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Not much is known about longevity in B. gabbii. Captive ones have been recorded living as long as 25 years. The lifespan in the wild is thought to be no more than 10 years.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: wild:
10 years.

Typical lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: wild:
24.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.8 years (captivity) Observations: One captive specimen was still alive at 21.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding system of this species has not been reported. Males are reported to be intollerant of one another in captivity, so it is unlikely that females have multiple mates.

Mating System: polygynandrous (promiscuous)

Breeding in B. gabii is reported to be aseasonal. Gestation lasts approximately 73 to 74 days. At the end of gestation a single offspring is born. Young are altricial, and like most carnivores, are born with their eyes closed. Birth weight is around 55 g. By about 27 days of age, the eyes of the young have opened. Solid food may be consumed as young as 2 months of age. By 21 to 24 months of age, B. gabbii has reached sexual maturity.

Breeding interval: These animals are apparently able to breed at least once per year, and without a definite breeding season may breed more often than that.

Breeding season: Breeding occurs throughout the year.

Average number of offspring: 1.

Range gestation period: 73 to 74 days.

Average weaning age: 2 months.

Range age at sexual or reproductive maturity (female): 21 to 24 months.

Range age at sexual or reproductive maturity (male): 21 to 24 minutes.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Average birth mass: 55 g.

Average number of offspring: 1.

Male parental care has not been reported for these animals. Females, like females of other mammalian species, take care of infants, providing them with milk, grooming, and protection. Young begin to consume solid food by about 2 months of age, and weaning probably occurs shortly thereafter. It is not known how long the young stay with their mothers, but, as with most carnivores, which must learn how to hunt for prey, young B. gabbii probably have some post-weaning association with their mothers.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bassaricyon gabbii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGATTATTCTCTACCAACCACAAGGATATTGGTACCCTTTACCTCCTATTCGGGGCCTGGGCCGGAATGGTAGGTACCGCTCTCAGCCTGCTAATCCGTGCCGAACTAGGACAGCCAGGTACTTTGCTTGGAGAT---GACCAAATTTATAACGTAATCGTAACCGCTCATGCATTCGTAATGATCTTCTTTATAGTAATGCCAATCATAATCGGAGGGTTTGGAAACTGACTAGTGCCTCTTATAATTGGCGCACCAGACATGGCATTCCCGCGAATAAACAACATAAGCTTCTGACTCCTGCCTCCATCATTCCTTTTACTTCTAGCTTCCTCAATAGTGGAAGCAGGAGCGGGAACTGGATGGACCGTGTATCCACCCCTAGCAGGCAACCTAGCACACGCAGGGGCATCCGTAGACCTAACAATCTTTTCTCTCCACTTAGCGGGGGTTTCATCCATCCTAGGCGCTATTAACTTCATTACAACTATCATCAACATAAAACCTCCCGCTATGTCACAGTATCAAACCCCCTTATTCGTATGGTCCGTATTAATCACAGCGGTGCTTTTACTACTATCTTTACCGGTTCTAGCAGCTGGCATCACAATACTACTCACAGATCGAAACTTAAACACCACCTTCTTCGACCCAGCCGGCGGAGGAGATCCAATTTTATATCAACATTTATTCTGATTTTTCGGACACCCCGAGGTATACATTCTAATCCTGCCAGGCTTCGGAATAATTTCCCATATTGTAACGTACTATTCGGGGAAAAAGGAACCTTTCGGCTACATAGGCATGGTTTGGGCGATAATATCTATTGGGTTCCTGGGCTTTATCGTGTGAGCACACCACATATTCACGGTAGGAATAGACGTTGACACACGAGCATACTTTACCTCAGCCACTATAATTATTGCAATTCCAACAGGAGTCAAAGTATTTAGTTGACTAGCCACTTTACACGGTGGT---AAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bassaricyon gabbii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Deforestation of B. gabbii habitat is reducing the population, but no exact numbers are known. The species is listed on Appendix III of CITES in Costa Rica. IUCN lists the species as Lower risk.

CITES: appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as it is wide ranging, occurs in a number of protected areas, and can adapt to secondary vegetation or plantations (Glatston 1994). Deforestation is a threat to some populations, however, the species is not declining at a rate sufficient for a threat category. Further research is needed to resolve issues surrounding taxonomic uncertainly, after which this species need to be reassessed.

History
  • 1994
    Indeterminate
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Generally unknown, possibly rare depending on the authority. Is said to be quite rare in Ecuador (Albuja pers. comm.). Some people maintain that olingos are not threatened but are common throughout western Amazonia (L. Emmons pers. comm.). However, confusion with kinkajous (Potos flavus) makes local anecdotes unreliable (Glatston, 1994).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Deforestation is a threat to populations of this species. Although adult olingos are rarely hunted, the young are caught for pets (Glatston, 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species has no specific protection in Nicaragua or Panama but they are protected under Colombian legislation. The situation in Ecuador is unclear (Glatston 1994). The species' distribution overlap with a number of protected areas in Nicaragua, Costa Rica, Panama, Colombia and Ecuador. In addition, the species is locally protected under Colombian legislation and listed on Appendix III of CITES in Costa Rica.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bassaricyon gabbii can eat fruit being grown commercially, but its population is so sparse that it does not constitute a major threat to crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bassaricyon gabbii is not known to have any direct economic importance to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern olingo

The northern olingo (Bassaricyon gabbii), also known as the bushy-tailed olingo or as simply the olingo (due to it being the most commonly seen of the species),[2] is a tree-dwelling member of the family Procyonidae, which also includes raccoons. It was the first species of olingo to be described, and while it is considered by some authors to be the only genuine olingo species,[3] a recent review of the Bassaricyon genus has shown that there are a total of four olingo species, although two of the former species should now be considered as a part of this species.[2] Its scientific name honors William More Gabb, who collected the first specimen.[4][5] It is native to Central America.[2]

Description[edit]

The northern olingo is a slender arboreal animal, with hind legs distinctly longer than the fore legs, and a long, bushy tail. The face is short and rounded, with relatively large eyes and short round ears. The fur is thick and colored brown or grey-brown over most of the body, becoming slightly darker along the middle of the back, while the underparts are light cream to yellowish. A band of yellowish fur runs around the throat and sides of the head, where it reaches the base of the ears, while the face has greyish fur. The tail is similar in color to the body, but has a number of faint rings of darker fur along its length. The soles of the feet are hairy, and the toes are slightly flattened, ending with short, curved claws. Females have a single pair of teats, located on the rear part of the abdomen, close to the hind legs.[4]

Adults have a head-body length of 37 to 47 centimetres (15 to 19 in), with a 40 to 52 centimetres (16 to 20 in) tail.[2] They weigh around 1.13 to 1.58 kilograms (2.5 to 3.5 lb).[2] The northern olingo possesses a pair of anal scent glands, capable of producing a foul-smelling chemical when the animal is alarmed.[4]

This is the largest of the olingo species.[2] Its pelage is typically less rufous than the other olingos, while its tail bands are a bit more distinct.[2]

Distribution and habitat[edit]

The northern olingo is found from Nicaragua through Costa Rica and western Panama.[2] It has also been reported from Honduras and Guatemala, although its great similarity to other olingos, and to kinkajous, may make such reports suspect, and they are not currently recognised by the IUCN.[1] While some individuals have been found as low as sea level,[2] it typically inhabits montane[2] and tropical moist forests[4] from 1,000 metres (3,300 ft)[2] up to around 2,000 metres (6,600 ft) elevation, although it apparently avoids plantations and areas of secondary forest.[4]

Taxonomy[edit]

Previously, three subspecies (including the nominate) were recognized of this olingo: B. g. gabbii, B. g. richardsoni, and B. g. medius.[3] The recent review of the genus has made several changes to the definition of this species:

  1. The Nicaraguan population B. g. richardsoni may truly be a subspecies, but further review and analysis is needed.[2]
  2. B. g. medius is smaller on average than Bassaricyon gabbii and the morphologic and genetic analysis demonstrated that is a different species: B. medius (western lowland olingo).[2]
  3. Former species B. lasius and B. pauli have been demoted into synonyms for B. gabbii, but may be elevated to subspecies as B. g. lasius and B. g. pauli.[2]

The closest relatives of B. gabbii are the two lowland olingo species of Panama and northwestern South America, B. alleni and B. medius, from which it diverged about 1.8 million years ago.[2]

Diet and behavior[edit]

The northern olingo is a nocturnal herbivore, feeding almost entirely on fruit, especially figs. It has been observed to drink the nectar of balsa trees during the dry season, and, on rare occasions, to pursue and eat small mammals, such as mice and squirrels. During the day, it sleeps in dens located in large trees.[4] It has an estimated home range of around 23 hectares (57 acres).[6]

Although it has been considered to be a solitary animal, it is often encountered in pairs, and may be more sociable than commonly believed. It is arboreal, spending much of its time in trees. Its tail is not prehensile, unlike that of the related kinkajous, although it can act as a balance.[4] The call of the northern olingo has been described as possessing two distinct notes, with a "whey-chuck" or "wey-toll" sound.[6]

The northern olingo has a diet and habitat similar to those of kinkajous, and, when resources are in short supply, the larger animal may drive it away from its preferred trees.[6] Predators known to feed on the northern olingo include the jaguarundi, ocelot, tayra, and several boas. It is believed to breed during the dry season, and to give birth to a single young after a gestation period of around ten weeks. It has lived for up to twenty-five years in captivity.[4]

References[edit]

  1. ^ a b Reid, F. & Helgen, K. (2008). Bassaricyon gabbii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 26 January 2009.
  2. ^ a b c d e f g h i j k l m n o p Helgen, K. M.; Pinto, M.; Kays, R.; Helgen, L.; Tsuchiya, M.; Quinn, A.; Wilson, D.; Maldonado, J. (15 August 2013). "Taxonomic revision of the olingos (Bassaricyon), with description of a new species, the Olinguito". ZooKeys 324: 1–83. doi:10.3897/zookeys.324.5827. 
  3. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 532–628. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ a b c d e f g h Prange, S. & Prange, T.J. (2009). "Bassaricyon gabbii (Carnivora: Procyonidae)". Mammalian Species 826: 1–7. doi:10.1644/826.1. 
  5. ^ Beolens, B.; Watkins, M.; Grayson, M. (2009-09-28). The Eponym Dictionary of Mammals. The Johns Hopkins University Press. p. 145. ISBN 978-0801893049. OCLC 270129903. 
  6. ^ a b c R.W. Kays (2000). "The behavior and ecology of olingos (Bassaricyon gabbii) and their competition with kinkajous (Potos flavus) in central Panama". Mammalia 64 (1): 1–10. doi:10.1515/mamm.2000.64.1.1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!