Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Pocket gophers dig with their front claws and with their teeth. A pocket gopher can close its mouth behind its front teeth, so it can dig without getting a mouthful of dirt. Its ""pockets"" are fur-lined, external cheek pouches, one on each side of its mouth, which it uses to transport food. Botta's Pocket Gopher has an extremely broad geographic range, and individuals vary widely in appearance: they can be nearly white, gray, brown, or blackish-brown. They vary in size, too. Males are larger than females. Males grow throughout their lives, whereas females stop growing after their first pregnancy, so older males can be much larger than females. Pocket gophers live in small, local populations, spending almost their entire lives underground in their network of burrows."

Links:
Mammal Species of the World
  • Original description: Eydoux and Gervais, 1836.  in Magasin de Zoologie, Paris, 6:23.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southwestern Oregon, northern Nevada, northern Utah, and central Colorado south though California, Arizona, and New Mexico to Baja California, Sinaloa, Chihuahua, southwestern Texas, Coahuila, northern Zacatecas, and Nuevo Leon (Patton and Smith 1990, which see for ranges of subspecies; Jones and Baxter 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the western United States and northern Mexico, from southern Oregon through Baja California, eastward through the central Great Basin, and southward to the lowlands of northern Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Thomomys bottae ranges from southern Oregon and central Colorado to southern Baja California and central Mexico (Nowak 1991).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Valley pocket gophers have a body length of 11.5 to 30 cm, and a tail length of 4 to 9.5 cm. Males are considerably larger than females. One study showed that average male weight was 141 g, while females weighed 90 g ( Daly 1986). The fur is short, smooth, and soft. The underside fur is only somewhat paler than the dorsal. Many of the 185 subspecies aredistinguished by color, which varies from grey, to brown, to tan to almost black. Thomomys bottae has a robust body and has short legs with long front claws. It has small eyes and ears and a tail that is naked at the tip (Grzimek 1990). Pocket gophers are characterized by deep fur-lined cheek pouches, and the genus Thomomys is characterized by upper incisors that lack frontal grooves (Grzimek 1990).

Average mass: 115.5 g.

Average basal metabolic rate: 0.67 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 27 cm

Weight: 250 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 170-280 mm males; 150-240 mm females

Weight:
Range: 110-250 g males; 80-160 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

California Montane Chaparral and Woodlands Habitat

This taxon can be found in the California montane chaparral and woodlands, a near coastal ecoregion in Central and Southern California, USA. This ecoregion is disjunctive, with a major element in Southern California and another along the Monterey County coast. The ecoregion encompasses most of the Transverse Range that includes the San Bernardino Mountains; San Gabriel Mountains; portions of the Santa Ynez and San Rafael Mountains; Topatopa Mountains; San Jacinto Mountains; the Tehachapi, Greenhorn, Piute, and Kiavah Mountains that extend roughly northeast-southwest from the southern Sierra Nevada; and the Santa Lucia Range that parallels the coast southward from Monterey Bay to Morro Bay.

The California montane chaparral and woodland ecoregion consists of a complex mosaic of coastal sage scrub, lower chaparral dominated by chamise, upper chaparral dominated by manzanita, desert chaparral, Piñon-juniper woodland, oak woodlands, closed-cone pine forests, yellow pine forests, sugar pine-white fir forests, lodgepole pine forests, and alpine habitats. The prevalence of drought-adapted scrub species in the flora of this ecoregion helps distinguish it from similar communities in the Sierras and other portions of northern California. Many of the shared Sierra Nevadan species typically are adapted to drier habitats in that ecoregion, Jeffrey Pine (Pinus jeffreyi) being a good example.

Oak species are an important component of many chaparral and forest communities throughout the ecoregion. Canyon Live Oak, Interior Live Oak, Tanbark Oak (not a true Quercus species), Engelmann Oak, Golden-cup Oak, and Scrub Oak are some examples. Mixed-conifer forests are found between 1371 to 2896 meters elevation with various combinations and dominance of incense cedar, sugar pine, and white fir, Jeffrey Pine, Ponderosa Pine, and mountain juniper. Subalpine forests consist of groves of Limber Pine (Pinus flexilis), Lodgepole Pine, and Jeffrey Pine. Very old individual trees are commonly observed in these relict subalpine forests. Within this zone are subalpine wet meadows, talus slope herbaceous communities, krumholz woodlands, and a few small aspen groves.

In addition to these general vegetation patterns, this ecoregion is noted for a variety of ecologic islands, communities with specialized conditions that are widely scattered and isolated and typically harbor endemic and relict species. Examples include two localities of Knobcone Pine (Pinus attenuata) on serpentine soils, scattered vernal pools with a number of endemic and relict species, and isolated populations of one of North America’s most diverse cypress floras, including the rare Gowen Cypress (Cupressus goveniana goveniana) restricted to two sites on acidic soils in the northern Santa Lucia Range, Monterey Cypress (Cupressus macrocarpa) found only at two coastal localities near Monterey Bay, and Sargent Cypress (Callitropsis sargentii LR/LC) restricted to serpentine outcrops. Monterey Pine (Pinus radiata) is also restricted to three coastal sites near Monterey Bay.

The ecoregion is also home to a few endemic or near-endemic mammalian vertebrates, such as the White-eared Pocket Mouse (Perognathus alticolus EN), a mammal known only to two disjunct mountain ranges in southern California: San Bernardino Mountains in San Bernardino County (ssp. alticolus), and the Tehachapi Mountains, in Kern, Ventura, and Los Angeles counties. The near-endemic fossorial Agile Kangaroo Rat (Dipodomys agilis) is found in the southern disjunctive unit of the ecoregion, and is known only to the Los Angeles Basin and foothills of San Gabriel and San Bernardino mountains in Ventura, Los Angeles, and Riverside counties north to Santa Barbara County and through the southern Sierra Nevada, including Mount Pinos, Tehachapi and San Gabriel mountains, and northern San Fernando Valley. Non-endemic mammals found in the ecoregion include Botta's Pocket Gopher (Thomomys bottae) and Trowbridge's Shrew (Sorex trowbridgii). Some larger vertebrate predators can be found in the ecoregion, including Puma (Puma concolor), Bobcat (Lynx rufus), Coyote (Canis latrans), and Ringtails (Bassariscus astutus).

The ecoregion boasts five endemic and near-endemic amphibians, largely Plethodontid salamanders. Some specific salamander taxa found here are the endemic Tehachapi Slender Salamander (Batrachoseps stebbinsi VU), known from isolated sites in the Caliente Creek drainage, Piute Mountains, and Kern County, California along with scattered populations in the Tehachapi Mountains to Fort Tejon, Kern County; the near-endemic Blackbelly Slender Salamander (Batrachoseps nigriventris); the Monterey Ensatina (Ensatina eschscholtzii); the Channel Islands Slender Salamander (Batrachoseps pacificus), endemic to a narrow range restricted solely on Anacapa, Santa Cruz, Santa Rosa, and San Miguel islands; and the Arboreal Salamander (Aneides lugubris), found only in California and Baja California. A newt found here is the Coast Range Newt (Taricha torosa). Anuran taxa in the ecoregion include the Foothill Yellow-legged Frog (Rana boylii NT); the Southern Mountain Yellow-legged Frog (Rana muscosa EN), a California endemic occurring in several disjunctive populations; and the Northern Red-legged Frog (Rana aurora).

The California montane chaparral and woodlands ecoregions contains a number of reptiles such as the Coast Horned Lizard (Phrynosoma coronatum), who ranges from Northern California to Baja California. Also found here is the Sagebrush Lizard (Sceloporus graciosus); the Western Fence Lizard (Sceloporus occidentalis); the Southern Alligator Lizard (Elgaria multicarinata); and the Side-blotched Lizard (Uta stansburiana). The Two-striped Garter Snake (Thamnophis hammondii) is a restricted range reptile found near-coastally from Monterey County, California southward to Baja California.

The California Condor once inhabited much of the ecoregion, with the western Transverse Range acting today as a refuge for some of the last wild populations, after considerable conservation efforts, especially in the Los Padres National Forest. The Heermann's Gull (Larus heermanni NT) is found in coastal areas of the ecoregion.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Found in a wide variety of habitats from valleys to high mountain meadows. Usually not in forested areas. Inhabits a wide variety of soils from soft sands to friable loams to hard clays. Grazed areas of annual grassland in California had significantly lower abundance of pocket gophers than did ungrazed areas (Hunter 1991). Fossorial but commonly active above ground. Young are born in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in a range of habitats, from desert scrub to high elevation coniferous forests. Within these habitats it occurs in open areas with deep soils. This species is also found in agricultural areas.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Valley pocket gophers are primarily fossorial. They burrow in various habitats including high mountain valleys, deserts, and sometimes in agricultural areas with artificial irrigation in the milder climate areas (Grzimek 1990).

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats roots, bulbs, tubers, and other vegetable matter. In southern coastal California, forb shoots appeared to be preferred, particularly during reproduction; grass shoots, corms, and roots increased in importance during plant dormancy (Hunt 1992). May feed underground, pulling plants into burrows by roots. Forages above ground at night or on overcast days. May store food in burrows. May tunnel through snow to reach above ground vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Valley pocket gophers generally eat roots, bulbs, tubers, and occasionally above ground plant parts. When in areas inhabited by humans, valley pocket gophers eat cultivated crops. Thomomys bottae do not drink water and get their needs for moisture from "juicy" vegetable matter. Valley pocket gophers may eat plants above ground, but often times they burrow under the plant, bite off the roots and pull the stem into the burrow for further preparation. Once in the burrow, they cut the vegetation into smaller pieces and push it into the cheek-pouches with their front claws. When placed in the deep cheek-pouches, a large quantity can be carried to a storage or eating place.

Pocket gophers have large stomachs and caeca, and the amount of food that can be contained in the digestive tract at one time can exceed 21% of the animals total weight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Primarily solitary.

Characteristically of low vagility, philopatric, and with small effective population sizes (Daly and Patton 1990).

Among six populations in California, average adult density per hectare ranged from 3-5 in deserts to 60 in valley grassland to 74-80 in alfalfa monocultures (Patton and Smith 1990). In California, most activity occurred within an area of 48 sq m (Gettinger 1984).

Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout the year. Active intermittently day and night; activity in summer peaked at 1600-2000 h in California (Gettinger 1984). See Cox and Hunt (1992, J. Mamm. 73:123-134) for information on the effects of various factors on seasonal activity patterns in southern California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: wild:
4.8 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.1 years (captivity) Observations: These animals may live up to 4.8 years in the wild (Howard and Childs 1959). One captive specimen lived 6.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Polygamous. May breed two or more times per year in southern part of range (Schmidly 1977); 4-8 altricial young/litter (average 4.1-5.6 in six California populations; Patton and Smith 1990). Gestation lasts about 19 days. Among six California populations, 0-46% of the females bred in the season of their birth (Patton and Smith 1990). In another California population, females commonly bred by age of 3 months; males not until age of 6-9 months (Daly and Patton 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female valley pocket gophers are monestrous, producing only one litter per year, after a gestation period of 19 days. The litter size ranges from 3-7, but the average is 5.7 for the species. The young are small at birth, weighing between 2.8 and 4 g. Once born, the young are weaned between the 36th and 40th day. Cheek pouches open after 24 days, and eyes and ears open after 26 days (Grzimek 1990). The young do not leave their mother until after 60 days, and young valley pocket gophers grow the coat of adults after 100 days. They reach an adult weight between 5 and 6 months, and reach sexual maturity the following breeding season, usually at 9 to 12 months of age (Daly 1896). Thomomys bottae live an average of 2.5 years.

Average birth mass: 3.3 g.

Average gestation period: 19 days.

Average number of offspring: 5.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
319 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
319 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thomomys bottae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATCGTTGATTATTCTCCACTAACCATAAAGACATCGGAACATTGTACATAATCTTCGGTGCCTGAGCTGGTATAGTAGGTACAGGCCTAAGCATCCTAATTCGAGCGGAGCTTGGACAACCTGGAACATTACTCGGAGAT---GATCAAATTTACAATGTTGTTGTTACAGCCCACGCTTTTGTCATAATTTTCTTCATGGTAATACCTATTATAATTGGGGGCTTTGGTAATTGATTGGTACCTCTAATGATTGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGATTACTTCCACCTTCCTTCTTACTCCTATTAGCTTCATCTATAGTAGAAGCAGGAGCTGGAACAGGCTGAACAGTATATCCCCCATTAGCTGGTAATCTAGCCCACGCAGGGGCTTCCGTTGATTTAACTATTTTTTCACTTCACCTAGCAGGGGTATCTTCTATCTTAGGAGCTATTAATTTTATTACTACTATTATCAATATAAAACCACCCGCAATTACACAATATCAAACACCCTTATTTGTATGATCAGTATTAATTACTGCAGTACTTCTACTCTTATCACTACCAGTATTAGCTGCAGGTATCACTATATTACTGACTGACCGAAATCTAAATACAACTTTCTTTGATCCTGCTGGAGGTGGGGATCCTATTCTTTATCAACATCTTTTCTGATTCTTTGGTCACCCTGAGGTATACATTCTAATTCTTCCAGGATTTGGTATAATCTCCCATATCGTAACCTATTATTCAGGCAAAAAAGAACCTTTCGGTTATATAGGTATAGTATGAGCTATAATATCCATTGGATTTCTAGGATTTATTGTATGAGCACATCATATATTTACAGTTGGGATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thomomys bottae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, and because it does not appear to be under threat and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Thomomys bottae are not endangered.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common. Densities have been reported up to 29.6 individuals/acre (natural habitat) and 62 individuals/acre (alfalfa fields) (Jones and Baxter 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats. However, it is considered an agricultural pest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although valley pocket gophers, along with other pocket gophers, are accused of damaging grasslands, overgrazing by domestic livestock does most of the damage. The gopher population is attracted by the conditions the livestock create (Grzimek 1990). Also, pocket gophers are considered pests in agricultural areas where they eat crops and cut the roots of young trees (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Valley pocket gophers are valuable to humans in many ways. The burrowing that the species does helps to keep the earth porous and (friable). The burying of vegetation enriches the soil. In mountain meadows, their holes allow runoff from snow to sink deep into then earth, conserving water and soil (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Botta's pocket gopher

Botta's pocket gopher (Thomomys bottae) is a pocket gopher native to western North America. It is also known in some sources as valley pocket gopher, particularly in California. Both the specific and common names of this species honor Paul-Émile Botta, a naturalist and archaeologist who collected mammals in California in the 1820s and 1830s.

Description[edit]

Botta's pocket gopher is a medium-sized gopher, with adults reaching a length of 18 to 27 centimetres (7.1 to 10.6 in), including a 5 to 6 centimetres (2.0 to 2.4 in) tail.[2] Males are larger, with a weight of 160–250 grams (5.6–8.8 oz), compared with 120–200 grams (4.2–7.1 oz) in the females.[3] Coloration is highly variable, and has been used to help distinguish some of the many subspecies; it may also change over the course of a year as the animals molt.[4] Both albino and melanistic individuals have also been reported. However, Botta's gopher generally lacks the black stripe down the middle of the back found in the closely related southern pocket gopher, a feature that may be used to tell the two species apart where they live in the same area.[2]

Distribution[edit]

Botta's pocket gophers are found from California east to Texas, and from Utah and southern Colorado south to Mexico. Within this geographical area, they inhabit a range of habitats, including woodlands, chaparral, scrubland, and agricultural land, being limited only by rocky terrain, barren deserts, and major rivers.[2] They are found at elevations up to at least 4,200 metres (13,800 ft).[5] Skeletal remains of Botta's pocket gophers, dating back 31,000 years, have been identified from Oklahoma.[6]

Around 195 subspecies have been described, mostly on the basis of geographical distribution. Some of these have previously been described as distinct species in their own right. The distribution of the type localities of these subspecies is as follows:[2]

Ecology[edit]

Botta's pocket gopher is strictly herbivorous, feeding on a variety of plant matter. Shoots and grasses are particularly important, supplemented by roots, tubers, and bulbs during the winter.[2] An individual will often pull plants into the ground by the roots to consume them in the safety of its burrow, where it spends 90% of its life.

Main predators of this species include American badgers, coyotes, long-tailed weasels, and snakes, but other predators include skunks, owls, bobcats, and hawks. This species is considered a pest in urban and agricultural areas due to its burrowing habit and its predilection for alfalfa; however, it is also considered beneficial as its burrows are a key source of aeration for soils in the region.

Digging by Botta's pocket gophers is estimated to aerate the soil to a depth of about 20 centimetres (7.9 in),[2] and to be responsible for the creation of Mima mounds up to 2 metres (6 ft 7 in) in height. Populations of the species have been estimated to mine as much as 28 tonnes of soil per hectare per year, much of which is moved below ground, rather than being pushed up into the mounds.[7] On the negative side, the species has been associated with the deaths of aspen in Arizona[8] and creates patches of bare ground that may limit the establishment of new seedlings.[9]

Behavior[edit]

Botta's pocket gopher is highly adaptable, burrowing into a very diverse array of soils from loose sands to tightly packed clays, and from arid deserts to high altitude meadows. They are able to tolerate such a wide range of soils in part because they dig primarily with their teeth, which are larger and with a thicker layer of enamel than in claw-digging gophers. In comparison, gophers digging with their claws are generally only able to dig in softer soils, because their claws wear down more quickly than teeth do in harder materials.[10]

Botta's pocket gophers are active for a total of about nine hours each day, spending most of their time feeding in their burrows, but are not restricted to either daylight or night time.[11] They make little sound, although they do communicate by making clicking noises, soft hisses, and squeaks.[2]

Their burrows include multiple deep chambers for nesting, food storage, and defecation, that be as much as 1.6 metres (5 ft 3 in) below ground. A series of tunnels close to the surface are used for feeding on plant roots, and have shorter side tunnels for disposal of excavated soil. On the surface, the burrows are marked by fan-shaped mounds of excavated soil, with the actual entrance usually kept filled in for protection.[2] Population densities of between 10 and 62 per acre (25 and 153 /ha) have been reported.[2]

Aboveground traces of these burrows are sometimes called "gopher eskers."[citation needed]

Outside of the breeding season, each burrow is inhabited by a single adult, with any young leaving once they are weaned. Male burrows extend over a mean area of 474 square metres (5,100 sq ft), and those of females 286 square metres (3,080 sq ft),[12] but the gophers aggressively defend[13] a larger exclusive area, of 810 square metres (8,700 sq ft) for males and 390 square metres (4,200 sq ft) for females, around the burrow entrance.[2]

Reproduction[edit]

In areas with sufficient food, such as agricultural land, breeding can occur year round, with up to four litters being born each year. In the north, and other, less hospitable, environments, it occurs only during the spring. The local habitat also affects the age at which females begin breeding, with nearly half doing so in their first year in agricultural land, but none at all in desert scrub.[2]

Gestation lasts eighteen days, and results in the birth of a litter of up to twelve pups, although three or four is more typical. The young are born hairless and blind, and measure about 5 centimetres (2.0 in) in length.[2] The first, silky coat of fur is replaced by a coarser coat of grey hair as the pups age, before the full adult coat develops.[4]

Botta's pocket gophers are capable of breeding with southern pocket gophers, and, until the 1980s, were often considered to belong to the same species. However, male hybrids are sterile, and females have greatly reduced fertility and rarely have offspring of their own.[14] Hybridisation with Townsend's pocket gopher has also been reported, and it too appears not to extend much beyond the first generation.[15]

References[edit]

  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T. & Lacher, T. (2008). Thomomys bottae. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 15 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b c d e f g h i j k l Jones, C.A. & Baxter, C.N. (2004). "Thomomys bottae". Mammalian Species: Number 742: pp. 1–14. doi:10.1644/742. 
  3. ^ "Thomomys bottae". Smithsonian Institution. Retrieved 2014-06-05. 
  4. ^ a b Morejohn, G.V. & Howard, W.E. (1956). "Molt in the pocket gopher, Thomomys bottae". Journal of Mammalogy 37 (2): 201–213. doi:10.2307/1376679. 
  5. ^ Bole, B.P., jr. (1938). "Some altitude records for mammals in the Inyo-White Mountains of California". Journal of Mammalogy 19 (2): 245–246. 
  6. ^ Dalquest, W.W., et al. (1990). "Zoogeographic implications of Holocene mammal remains from ancient beaver ponds in Oklahoma and New Mexico". The Southwestern Naturalist 35 (2): 105–110. doi:10.2307/3671529. 
  7. ^ Cox, G.W. (1990). "Soil mining by pocket gophers along topographic gradients in a Mima moundfield". Ecology 71 (3): 837–843. doi:10.2307/1937355. 
  8. ^ Cantor, L.F. & Whitham, T.G. (1989). "Importance of belowground herbivory: pocket gophers may limit aspen to rock outcrop refugia". Ecology 70 (4): 962–970. doi:10.2307/1941363. 
  9. ^ Stromberg, J.C. & Patten, D.T. (1991). "Dynamics of the spruce-fir forests on the Pinaleno Mountains, Graham Co., Arizona". The Southwestern Naturalist 36 (1): 37–48. doi:10.2307/3672114. 
  10. ^ Lessa, E.P. & Thaela, C.S., jr. (1989). "A reassessment of morphological specializations for digging in pocket gophers". Journal of Mammalogy 79 (4): 689–700. 
  11. ^ Gettinger, R.D. (1984). "A field study of activity patterns of Thomomys bottae". Journal of Mammalogy 65 (1): 76–84. doi:10.2307/1381202. 
  12. ^ Bandoli, J.H. (1987). "Activity and plural occupancy of burrows in Botta's pocket gopher Thomomys bottae". American Midland Naturalist 118 (1): 10–14. doi:10.2307/2425623. 
  13. ^ Baker, A.E.M. (1974). "Interspecific aggressive behavior of pocket gophers Thomomys bottae and T. talpoides (Geomyidae: Rodentia)". Ecology 55 (3): 671–673. doi:10.2307/1935160. 
  14. ^ Patton, J.L. (1973). "An analysis of natural hybridization between the pocket gophers, Thomomys bottae and Thomomys umbrinus, in Arizona". Journal of Mammalogy 54 (3): 561–584. doi:10.2307/1378959. 
  15. ^ Patton, J.L., et al. (1984). "Genetics of hybridization between the pocket gophers, Thomomys bottae and Thomomys townsendii in northeastern California". Great Basin Naturalist 44 (3): 431–440. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Treated as conspecific with T. townsendii and T. umbrinus by Hall (1981) (under T. umbrinus). However, no genetic introgression occurs in the bottae-townsendii hybrid zone in southern Arizona, and Patton and Smith (1990) and other authors (e.g., Jones et al. 1992; Baker et al. 2003; Patton, in Wilson and Reeder 1993, 2005) treated bottae, townsendii, and umbrinus as separate species. Patton and Smith (1994) examined mtDNA and electrophoretic data for T. bottae and T. townsendii and found a variation pattern that made "strict adherence to any species concept in the objective recognition of evolutionary units within this complex...difficult at best."

Thomomys bottae comprises many reproductively isolated populations or parapatric, karyotypically distinct populations with little interbreeding; locally, however, dispersal into established populations and gene flow do occur (Daly and Patton 1990).

See Patton (in Wilson and Reeder 2005) for further discussion of taxonomy and for a list of synonyms and currently recognized subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!