Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Pocket gophers dig with their front claws and with their teeth. A pocket gopher can close its mouth behind its front teeth, so it can dig without getting a mouthful of dirt. Its ""pockets"" are fur-lined, external cheek pouches, one on each side of its mouth, which it uses to transport food. Botta's Pocket Gopher has an extremely broad geographic range, and individuals vary widely in appearance: they can be nearly white, gray, brown, or blackish-brown. They vary in size, too. Males are larger than females. Males grow throughout their lives, whereas females stop growing after their first pregnancy, so older males can be much larger than females. Pocket gophers live in small, local populations, spending almost their entire lives underground in their network of burrows."

Links:
Mammal Species of the World
  • Original description: Eydoux and Gervais, 1836.  in Magasin de Zoologie, Paris, 6:23.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the western United States and northern Mexico, from southern Oregon through Baja California, eastward through the central Great Basin, and southward to the lowlands of northern Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Thomomys bottae ranges from southern Oregon and central Colorado to southern Baja California and central Mexico (Nowak 1991).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southwestern Oregon, northern Nevada, northern Utah, and central Colorado south though California, Arizona, and New Mexico to Baja California, Sinaloa, Chihuahua, southwestern Texas, Coahuila, northern Zacatecas, and Nuevo Leon (Patton and Smith 1990, which see for ranges of subspecies; Jones and Baxter 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Valley pocket gophers have a body length of 11.5 to 30 cm, and a tail length of 4 to 9.5 cm. Males are considerably larger than females. One study showed that average male weight was 141 g, while females weighed 90 g ( Daly 1986). The fur is short, smooth, and soft. The underside fur is only somewhat paler than the dorsal. Many of the 185 subspecies aredistinguished by color, which varies from grey, to brown, to tan to almost black. Thomomys bottae has a robust body and has short legs with long front claws. It has small eyes and ears and a tail that is naked at the tip (Grzimek 1990). Pocket gophers are characterized by deep fur-lined cheek pouches, and the genus Thomomys is characterized by upper incisors that lack frontal grooves (Grzimek 1990).

Average mass: 115.5 g.

Average basal metabolic rate: 0.67 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 27 cm

Weight: 250 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 170-280 mm males; 150-240 mm females

Weight:
Range: 110-250 g males; 80-160 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in a range of habitats, from desert scrub to high elevation coniferous forests. Within these habitats it occurs in open areas with deep soils. This species is also found in agricultural areas.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Valley pocket gophers are primarily fossorial. They burrow in various habitats including high mountain valleys, deserts, and sometimes in agricultural areas with artificial irrigation in the milder climate areas (Grzimek 1990).

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Found in a wide variety of habitats from valleys to high mountain meadows. Usually not in forested areas. Inhabits a wide variety of soils from soft sands to friable loams to hard clays. Grazed areas of annual grassland in California had significantly lower abundance of pocket gophers than did ungrazed areas (Hunter 1991). Fossorial but commonly active above ground. Young are born in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Valley pocket gophers generally eat roots, bulbs, tubers, and occasionally above ground plant parts. When in areas inhabited by humans, valley pocket gophers eat cultivated crops. Thomomys bottae do not drink water and get their needs for moisture from "juicy" vegetable matter. Valley pocket gophers may eat plants above ground, but often times they burrow under the plant, bite off the roots and pull the stem into the burrow for further preparation. Once in the burrow, they cut the vegetation into smaller pieces and push it into the cheek-pouches with their front claws. When placed in the deep cheek-pouches, a large quantity can be carried to a storage or eating place.

Pocket gophers have large stomachs and caeca, and the amount of food that can be contained in the digestive tract at one time can exceed 21% of the animals total weight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats roots, bulbs, tubers, and other vegetable matter. In southern coastal California, forb shoots appeared to be preferred, particularly during reproduction; grass shoots, corms, and roots increased in importance during plant dormancy (Hunt 1992). May feed underground, pulling plants into burrows by roots. Forages above ground at night or on overcast days. May store food in burrows. May tunnel through snow to reach above ground vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary.

Characteristically of low vagility, philopatric, and with small effective population sizes (Daly and Patton 1990).

Among six populations in California, average adult density per hectare ranged from 3-5 in deserts to 60 in valley grassland to 74-80 in alfalfa monocultures (Patton and Smith 1990). In California, most activity occurred within an area of 48 sq m (Gettinger 1984).

Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout the year. Active intermittently day and night; activity in summer peaked at 1600-2000 h in California (Gettinger 1984). See Cox and Hunt (1992, J. Mamm. 73:123-134) for information on the effects of various factors on seasonal activity patterns in southern California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: wild:
4.8 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.1 years (captivity) Observations: These animals may live up to 4.8 years in the wild (Howard and Childs 1959). One captive specimen lived 6.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Female valley pocket gophers are monestrous, producing only one litter per year, after a gestation period of 19 days. The litter size ranges from 3-7, but the average is 5.7 for the species. The young are small at birth, weighing between 2.8 and 4 g. Once born, the young are weaned between the 36th and 40th day. Cheek pouches open after 24 days, and eyes and ears open after 26 days (Grzimek 1990). The young do not leave their mother until after 60 days, and young valley pocket gophers grow the coat of adults after 100 days. They reach an adult weight between 5 and 6 months, and reach sexual maturity the following breeding season, usually at 9 to 12 months of age (Daly 1896). Thomomys bottae live an average of 2.5 years.

Average birth mass: 3.3 g.

Average gestation period: 19 days.

Average number of offspring: 5.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
319 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
319 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Polygamous. May breed two or more times per year in southern part of range (Schmidly 1977); 4-8 altricial young/litter (average 4.1-5.6 in six California populations; Patton and Smith 1990). Gestation lasts about 19 days. Among six California populations, 0-46% of the females bred in the season of their birth (Patton and Smith 1990). In another California population, females commonly bred by age of 3 months; males not until age of 6-9 months (Daly and Patton 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thomomys bottae

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0200-06|AY331088|Thomomys bottae| AATCGTTGATTATTCTCCACTAACCATAAAGACATCGGAACATTGTACATAATCTTCGGTGCCTGAGCTGGTATAGTAGGTACAGGCCTA---AGCATCCTAATTCGAGCGGAGCTTGGACAACCTGGAACATTACTCGGAGAT---GATCAAATTTACAATGTTGTTGTTACAGCCCACGCTTTTGTCATAATTTTCTTCATGGTAATACCTATTATAATTGGGGGCTTTGGTAATTGATTGGTACCTCTAATG---ATTGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGATTACTTCCACCTTCCTTCTTACTCCTATTAGCTTCATCTATAGTAGAAGCAGGAGCTGGAACAGGCTGAACAGTATATCCCCCATTAGCTGGTAATCTAGCCCACGCAGGGGCTTCCGTTGATTTA---ACTATTTTTTCACTTCACCTAGCAGGGGTATCTTCTATCTTAGGAGCTATTAATTTTATTACTACTATTATCAATATAAAACCACCCGCAATTACACAATATCAAACACCCTTATTTGTATGATCAGTATTAATTACTGCAGTACTTCTACTCTTATCACTACCAGTATTAGCTGCA---GGTATCACTATATTACTGACTGACCGAAATCTAAATACAACTTTCTTTGATCCTGCTGGAGGTGGGGATCCTATTCTTTATCAACATCTTTTCTGATTCTTTGGTCACCCTGAGGTATACATTCTAATTCTTCCAGGATTTGGTATAATCTCCCATATCGTAACCTATTATTCAGGCAAAAAA---GAACCTTTCGGTTATATAGGTATAGTATGAGCTATAATATCCATTGGATTTCTAGGATTTATTGTATGAGCACATCATATATTTACAGTTGGGATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thomomys bottae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 34
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, and because it does not appear to be under threat and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Thomomys bottae are not endangered.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common. Densities have been reported up to 29.6 individuals/acre (natural habitat) and 62 individuals/acre (alfalfa fields) (Jones and Baxter 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats. However, it is considered an agricultural pest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although valley pocket gophers, along with other pocket gophers, are accused of damaging grasslands, overgrazing by domestic livestock does most of the damage. The gopher population is attracted by the conditions the livestock create (Grzimek 1990). Also, pocket gophers are considered pests in agricultural areas where they eat crops and cut the roots of young trees (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Valley pocket gophers are valuable to humans in many ways. The burrowing that the species does helps to keep the earth porous and (friable). The burying of vegetation enriches the soil. In mountain meadows, their holes allow runoff from snow to sink deep into then earth, conserving water and soil (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Botta's pocket gopher

Botta's pocket gopher (Thomomys bottae) is a pocket gopher native to western North America, from California east to Texas and from southern Utah and Colorado south to Mexico. It is also known in some sources as valley pocket gopher, particularly in California.

This species is medium-sized, with males reaching a length of approximately 25–26 centimetres (9.8–10 in) and a weight of 160–250 grams (5.6–8.8 oz), and females averaging about 22 centimetres (8.7 in) in length and a weight of 120–200 grams (4.2–7.1 oz). This species is highly adaptable, burrowing into a very diverse array of soils from loose sands to tightly packed clays, and from arid deserts to high altitude meadows. It is strictly herbivorous, and will often pull plants into the ground by the roots to consume them in the safety of its burrow, where it spends 90% of its life. The burrows of this species may reach lengths of more than 150 m, and only extend above ground in times of snowfall. Traces of these aboveground burrows are sometimes called "gopher eskers."

Main predators of this species include American Badgers, Coyotes, Long-tailed Weasels, and Snakes, but other predators include Skunks, Owls, Bobcats, and Hawks. This species is considered a pest in urban and agricultural areas due to its burrowing habit and its predilection for alfalfa; however, it is also considered beneficial as its burrows are a key source of aeration for soils in the region.

At least 185 subspecies have been described for this animal, mostly on the basis of geographical distribution.

Both the specific and common names of this species honor Paul-Émile Botta, a naturalist and archaeologist who collected mammals in California in the 1820s and 1830s.

References

  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T. & Lacher, T. (2008). Thomomys bottae. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 15 March 2009. Database entry includes a brief justification of why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Treated as conspecific with T. townsendii and T. umbrinus by Hall (1981) (under T. umbrinus). However, no genetic introgression occurs in the bottae-townsendii hybrid zone in southern Arizona, and Patton and Smith (1990) and other authors (e.g., Jones et al. 1992; Baker et al. 2003; Patton, in Wilson and Reeder 1993, 2005) treated bottae, townsendii, and umbrinus as separate species. Patton and Smith (1994) examined mtDNA and electrophoretic data for T. bottae and T. townsendii and found a variation pattern that made "strict adherence to any species concept in the objective recognition of evolutionary units within this complex...difficult at best."

Thomomys bottae comprises many reproductively isolated populations or parapatric, karyotypically distinct populations with little interbreeding; locally, however, dispersal into established populations and gene flow do occur (Daly and Patton 1990).

See Patton (in Wilson and Reeder 2005) for further discussion of taxonomy and for a list of synonyms and currently recognized subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!