Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The Yellow-faced Pocket Gopher feeds on starchy, tuberous roots of desert shrubs and on the roots and leaves of low-growing forbs. Like other pocket gophers, this species is considered an agricultural pest, doing extensive damage in orchards, gardens, potato patches, and other croplands. It digs long burrow systems, preferring deep sandy or silty soil. Burrow systems seem to contain only one nesting chamber, and except when breeding or raising young, these animals live alone. Yellow-faced Pocket Gophers live from less than one year (males), to a little more than one year (females). Females may reproduce within the same season as their birth and can have up to three litters in a season. Litter size averages 2-3, and ranges from 1-5.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Baird, S.F., 1852.  Mammals.  In Exploration and survey of the valley of the Great Salt Lake of Utah, including reconnaissance of a new route through the Rocky Mountains (by H. Stansbury), p. 313.  Lippincott, Grambo and Co., Philadelphia, 2 vols.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from the south-central USA and north-eastern Mexico. It occurs from the Arkansas River drainage in south-eastern Colorado and western Kansas southward to south of the Rio Grande in eastern Chihuahua and north-eastern Durango.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Southeastern Colorado and southwest Kansas, westernmost Oklahoma, to central San Luis Potosi (Mexico) (Wilson and Reeder, 1993)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: In U.S.: Arkansas River drainage in southeastern Colorado and western Kansas south through Oklahoma Panhandle, western Texas, and eastern New Mexico to the Rio Grande; also immediately east of Rio Grande in central New Mexico; known from one area in Cameron County, Texas, in lower Rio Grande Valley. In Mexico: distributional status questionable due to presence of two cytotypes that may represent distinct species; occurs south of Rio Grande in eastern Chihuahua and northeastern Durango, probably to southern Coahuila and northern Zacatecas, in parts of Nuevo Leon, and eastward along Rio Grande to Gulf Coast in Tamaulipas (Davidow-Henry et al. 1989), to San Luis Potosi (Patton, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The fur of Cratogeomys castanops varies from a light yellowish color to a reddish brown dorsally. The feet are dark. The tail has little or no hair. The length of the body is 226-320mm, and the tail length ranges from 70-105mm. Pappogeomys can be distinguished from other pocket gopher genera by the single groove on their incisors (Thomomys have no grooves on incisors; Geomys have two grooves on incisors.)

Range mass: 213 to 330 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Whitaker, J. 1997. National Audubon Society Field Guide to North American Mammals. New York: Alfred Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 32 cm

Weight: 330 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 220-315 mm

Weight:
Range: 385-410 g males; 225-290 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Yellow-faced Pocket Gophers are found in light soils such as the sandy/silty soils of valleys and river bottoms. When forced to inhabit rocky or dense soil areas this species does poorly and has lower population densities. Throughout its range, these areas of suitable soil correspond with mesquite and cactus communities in the west, and grassland communities in the east.

The burrow system of this species may be up to 76 m long, including a main shaft with several shorter tunnels branching off to serve as foraging routes, as well as a deeper tunnel area with the nest and food storage areas. These burrows are occupied by one individual, except during the mating season when a pair may inhabit a burrow.
The diet consists mainly of the underground portions of plants and low-growing green vegetation. Females typically have two litters per year, one in early spring and the other in late summer, with 1-3 young in each litter (Davidow-Henry 1989).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Cratogeomys castanops favors deep sandy or clayey soils for burrowing. Mounds of dirt excavated from burrows can often be found under bushes or cacti. When Pappogeomys is in a area that is also occupied by other species of pocket gopher (/Thomomys/ or Geomys) it tends to be restricted to shallower, rockier soils. It also appears to do better in drier habitats, with more desert plants (Davis and Schmidly, 1994; Paradiso, 1975; Whitaker, 1997).

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Fossorial, usually in deep sandy or silty soils that are relatively free of rocks, but restricted to denser, shallower, sometimes rocky soils when Geomys is present. Prefers deep firm soils; rich soils of river valleys and streams, agricultural land (orchards, gardens, potato fields and other croplands; Patton, in Wilson and Ruff 1999), and meadows. In Kansas, found in deep upland soils and in roadside ditches having loamy soils and calcareous deposits. Also in mesquite-creosotebush habitat (Schmidly 1977). Constructs shallow foraging burrows and deeper ones between nest and food cache.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Like other pocket gophers, Cratogeomys castanops is herbivorous. It will eat stalks and roots of many different plants, including stalks and joints of prickly pear. However, most foraging is done from underground. While foraging, C. castanops will store food in its cheek pouches. Most water is derived from the diet, so they drink very little water (Paradiso, 1975; Whitaker, 1997).

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on tubers, roots, and bulbs while foraging in underground burrow. Also feeds on green vegetation above ground. Food is collected in cheek pouches and carried to an underground chamber where it is stored.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. In Texas, longevity of females averaged about 1 year, males about 8 months (see Davidow-Henry et al. 1989). Predators include weasels, badgers, owls, etc. See Davidow-Henry et al. (1989) for discussion of interactions with other gopher species. Pocket gophers are ecologically important as prey items and in influencing soils, microtopography, habitat heterogeneity, diversity of plant species, and primary productivity (Huntly and Inouye 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active throughout year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: male

Status: wild:
2.6 years.

Average lifespan

Sex: female

Status: wild:
4.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one wild captured animal reportedly lived 4.7 years (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Cratogeomys castanops will often have multiple litters in a single year, and there are generally two young per litter. The sex ratio is skewed, with up to four times as many males as females. Mating begins in spring. Females will become reproductive in the year of their birth, but males will not mate until the following spring. (MacDonald, 1984; Paradiso, 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pregnant females have been recorded in every month of year in Texas; in Kansas, may produce a litter in late March or early April and another in late summer or early fall; reportedly two distinct breeding seasons (December-March and June-August) in Coahuila. Litter size is 1-5 (averages 2 in Texas and Coahuila, reportedly 3.8 in New Mexico). In Kansas, probably only 1 litter/year (Bee et al. 1981); multiple litters annually in Texas and probably New Mexico. In Texas, females captured as immatures December-March were pregnant and lactating by July.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cratogeomys castanops

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0188-06|AY331076|Cratogeomys castanops| AATCGTTGGCTGTTTTCAACCAACCATAAAGATATTGGTACCCTTTATATAATCTTCGGTGCCTGAGCTGGAATAGTTGGGACAGGATTA---AGTATCCTAATCCGAGCAGAACTAGGTCAACCAGGATCCCTGCTAGGTGAT---GACCAGATCTACAACGTTGTGGTCACAGCCCATGCTTTCGTCATGATTTTCTTCATAGTAATGCCTATTATAATTGGCGGGTTTGGTAATTGATTAGTGCCACTAATA---ATTGGGGCACCAGATATAGCATTCCCTCGCATGAATAACATAAGCTTCTGACTCTTGCCACCATCTTTTCTCCTCTTACTTGCCTCATCAATAGTGGAAGCAGGAGCCGGGACAGGTTGAACAGTATACCCACCACTAGCTGGTAACCTAGCCCATGCTGGAGCTTCCGTAGACTTA---ACTATTTTTTCCCTCCACTTAGCAGGAGTATCCTCAATTCTTGGAGCTATTAATTTCATCACTACTATTATTAATATAAAACCACCTGCAATCACACAATACCAAACTCCACTATTTGTATGATCAGTCATAATTACTGCAGTTCTCTTATTACTATCACTTCCAGTATTAGCAGCA---GGCATTACAATACTACTTACAGACCGGAACTTAAACACAACCTTTTTTGACCCAGCTGGAGGAGGTGATCCTATCCTCTATCAACATTTATTCTGATTCTTTGGTCATCCAGAGGTTTATATCTTAATTCTTCCTGGATTTGGTATGATTTCACACATCGTCACTTATTATTCAGGTAAAAAA---GAACCATTTGGCTATATAGGTATAGTTTGGGCCATAATATCAATTGGCTTTTTGGGATTCATCGTGTGAGCTCATCATATGTTTACGGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cratogeomys castanops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Species: 22
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

This species is relatively common within it's range.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. However, like many other gophers, this species is considered an agricultural pest and may cause damage to orchards and crops. As a result populations are often reduced by trapping and use of rodenticide (Davidow-Henry 1989). Populations may also be controlled by managing for the presence of large predatory birds including hawks and owls.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are several protected areas within this species' range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Cratogeomys castanops is considered an agricultural pest because of it's burrows and the fact that it will eat the root systems of crop plants (Whitaker, 1997).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: May damage cultivated plants; often occupies soils suited for farming (Davidow-Henry et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-faced Pocket Gopher

The yellow-faced pocket gopher (Cratogeomys castanops) is a species of pocket gopher that is native to shortgrass prairies in the Southwestern United States and Northern Mexico. It is the species that lives north of the Southern Coahuila Filter-Barrier (SCFB). [2] Among the different species, the yellow-faced pocket gopher has a small to medium sized skull. [3] The fossil of this genus was recorded from the pre-Pleistocene Benson Beds of Arizona.[4]

The yellow-faced pocket gopher has a yellowish-brown coat, a short tail, and one deep groove down the anterior middle of each incisor.

Contents

Form and Function

Adults of C. castanops in Texas begin to molt in August and continue through March. The new pelage was found to be thicker, but had no change in color [5] In Kansas, semiannual molts in adults have been reported: 1. Molt from winter to summer early in the spring and 2. Molt in autumn in September and October [6]

There is sexual dimorphism in the yellow-faced pocket gophers; the males are larger than the females. The males of all genera of pocket gophers continue to grow after attaining sexual maturity, but females grow little after reaching sexual maturity. [7]

Ontogeny and Reproduction

The reproductive activity of yellow-faced pocket gophers start in November and increases to a peak in March and/or April [8] During mating and copulation, the males emits low gutteral squeaks throughout exploratory activities, then the male bites the female when body contact is made. [9] When young animals are old enough to leave the nest, they travel about maternal burrows. Then, when the young are nearly full grown, they disperse from the parental burrow. [10]

Behavior

Researchers have seen a swimming ability in yellow-faced pocket gophers. [11] However, this genus of pocket gophers are less durable than other genera in water, perhaps because of the greater bulk (of its body) that inhibits its endurance.

Most of the foraging is done from the burrow system the yellow-faced pocket gophers create, pulling plants into the burrow by their roots. [12] The burrow system consists of tunnels dug by the gophers averaging 75.8m in length and 10 to 132 cm in depth. [13]

Ecology

Yellow-faced pocket gophers usually inhabit deep sandy or silty soils that are relatively free from rocks.[14] However, where Geomys (another genus of pocket gophers) is present, Cratogeomys is restricted to "denser, shallower, sometimes rocket soils." [15] [16] Research in Kansas showed that tracts that had no gophers occupying it consisted largely of areas with fine-textured soils that are planted with crops. The crops (corn, wheat, and grain sorghum) were harvested and disked annually along with the roadside ditches adjacent to the cropland. It was concluded that pocket gophers are not able to inhabit these lands because land-use practices have destabilized the habitats, eliminating both refuge and dispersal corridors.[17]

Yellow-faced pocket gophers are preyed on by small carnivorous mammals and large hawks and owls. [18] [19]



Subspecies

There are currently 19 identified subspecies[20] of Cratogeomys castanops:

  • C. c. angusticeps
  • C. c. bullatus
  • C. c. castanops
  • C. c. clarkii
  • C. c. consitus
  • C. c. dalquesti
  • C. c. excelsus
  • C. c. goldmani[21][22]
  • C. c. hirtus
  • C. c. jucundus
  • C. c. parviceps
  • C. c. perexiguus
  • C. c. perplanus
  • C. c. pratensi
  • C. c. sordidulus
  • C. c. subsimus
  • C. c. surculus
  • C. c. tamaulipensis
  • C. c. ustulatus

References

  1. ^ Linzey, A.V. (2008). Cratogeomys castanops. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 25 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ http://www.bioone.org/doi/abs/10.1644/07-MAMM-A-001.1
  3. ^ Russell, R. J. , 1968b. Revision of pocket gophers of the genus Pappogeomys. Univ. Kansas Publ., Mus. Nat. Hist., 16:581-776
  4. ^ Russell, R. J., 1969. Intraspecific population structure of the species Pappogeomys castanops. Pp. 337-371, in Contributions in mammalogy (J. K. Jones, Jr., ed.). Misc. Publ. Mus. Nat. Hist., Univ. Kansas, 51:1-428
  5. ^ Ikenberry, R. D. 1964. Reproductive studies of the Mexican pocket gopher, Cratogeomys castanops perplanus. Unpubl. M.S. thesis, Texas Tech Univ., Lubbock, v + 47pp.
  6. ^ Birney, E. C., J.K. Jones, Jr., and D. M. Mortimer. 1971. The yellow-faced pocket gopher, Pappogeomys castanops, in Kansas. Trans. Kansas Acad. Sci., 73:368-375
  7. ^ Chase, J. D., W.E. Howard, and J. T. Rosenberry. 1982. Pocket gophers, Geomyidae. Pp. 239-255, in Wild mammals of North America: biology, management, and economics (J.A. Chapman and G.A. Feldhamer, eds.). Johns Hopkins Univ. Press, Blatimore, xiii + 1147 pp.
  8. ^ Smolen, M. J., J. J. Genoways, and R. J. Baker. 1980. demographic and reproductive parameters of the yellow-cheeked pocket gopher (Pappogeomys castanops). J. Mamm., 61:224-236
  9. ^ Ikenberry, R. D. 1964. Reproductive studies of the Mexican pocket gopher, Cratogeomys castanops perplanus. Unpubl. M.S. thesis, Texas Tech Univ., Lubbock, v + 47pp.
  10. ^ Bailey, V. 1932. Mammals of New Mexico. N. Amer. Fauna, 53:1-412, 22 pls.
  11. ^ Hickman, G. C. 1977b. Swimming behavior in representative species of the three genera of North American geomyids. Southweatern Nat., 21:531-538.
  12. ^ Bailey, V. 1932. Mammals of New Mexico. N. Amer. Fauna, 53:1-412, 22 pls.
  13. ^ Hickman, G. C. 1977a. Burrow system structure of Pappogeomys castanops (Geomyidae) in Lubbock County, Texas. Amer. Midland Nat., 97:50-58
  14. ^ Bailey, V. 1932. Mammals of New Mexico. N. Amer. Fauna, 53:1-412, 22 pls.
  15. ^ Birney, E. C., J.K. Jones, Jr., and D. M. Mortimer. 1971. The yellow-faced pocket gopher, Pappogeomys castanops, in Kansas. Trans. Kansas Acad. Sci., 73:368-375
  16. ^ Findley, J. S. 1987. The natural history of New Mexican mammals. Univ. New Mexico Press, Albuquerque, xii + 164 ppl, 16 unnumbered pls.
  17. ^ http://www.bioone.org/doi/abs/10.1894/0038-4909(2007)52%5B296:EOLUAS%5D2.0.CO%3B2
  18. ^ Chase, J. D., W.E. Howard, and J. T. Rosenberry. 1982. Pocket gophers, Geomyidae. Pp. 239-255, in Wild mammals of North America: biology, management, and economics (J.A. Chapman and G.A. Feldhamer, eds.). Johns Hopkins Univ. Press, Blatimore, xiii + 1147 pp.
  19. ^ Jones, J. K., Jr., D.M. Armstrong, and J. R. Choate. 1985. Guide to mammals of the plains states. Univ. Nebraska Press, Lincoln, xix + 371 pp.
  20. ^ Patton, James L. (16 November 2005). "Family Geomyidae (pp. 859-870)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 859. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12800003. 
  21. ^ http://www.organismnames.com/details.htm?lsid=3860606
  22. ^ http://data.gbif.org/species/browse/taxon/14859750
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly, Cratogeomys was regarded as a subgenus of Pappogeomys. See Patton (in Wilson and Reeder 2005) for a discussion of taxonomy. Southernmost populations in Mexico were regarded as a distinct species (C. goldmani or C. subnubilis) by Lee and Baker (1987), based on chromosome differences. Patton (in Wilson and Reeder 2005) recognized C. goldmani as a distinct species (including subnubilis as a subspecies).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!