Overview

Brief Summary

Biology

Although such a familiar species, few people have actually seen this elusive nocturnal mammal in its natural habitat (2). During the day badgers are inactive, and rest in their setts, complex systems of underground tunnels with nests of dry grass, straw and dead leaves (2), which are passed on from generation to generation (7). In certain conditions they may forage during the day, for example during hot summers when food is in short supply (3). Although they do not hibernate, they do spend a lot of time in the sett during cold spells in winter (3). Badgers are omnivorous; their main source of food is earthworms, of which they may eat several hundred a night (7). They also take other invertebrates, nuts, fruit, small vertebrates, bulbs and cereals (3). They are one of the few species able to kill and eat hedgehogs (Erinaceus europaeus), thanks to their thick skin and long claws (7). Badgers tend to live in social groups consisting of a number of adults and young (5). There is usually a dominant male (boar) and one breeding female (sow) in each group (5), but occasionally more than one female breeds (2). The dominant boar marks the range with dung in certain places called 'latrines', and will fiercely defend his range from intruding males (5). Mating tends to occur in the spring, but it can take place throughout the year. Regardless of the time of year of fertilisation of the egg, further development is delayed until December (3). This 'delayed implantation' means that there is an opportunity for cubs to grow sufficiently before winter (5). Litters contain between 1 and 5 playful cubs, which become sexually mature at around 2 years of age (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Badgers have a small head, small eyes, a thick short neck and a long wedge shaped body with a short tail. Males are slightly larger and heavier than females and usually have a broader head with fuller cheeks. Many males have a longer, thinner and whiter tail than females. A badger’s hair is black and white- leading to a grey appearance from a distance. The badger has a black chest and forepaws with a prominent black and white striped head with white tipped ears. However, some badgers may be albino (white), melanistic (black) or erythristic (ginger). These color variations depend on the amount of melanin in the badger’s hair and is controlled genetically.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

With its striking black and white striped head, the badger is one of our most instantly recognisable mammals. The rest of the stocky body appears grey, and the legs, throat, neck, chest and belly are black (5). The tail is a whitish colour, but can be darker (5). Males and females are generally similar in appearance, although females tend to be slightly smaller in size (5). The badger's name is said to derive from the French 'bêcheur', meaning 'digger'; the strong musculature, short legs and long claws of this species reflect its burrowing habits (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

According to Wozencraft (2005) this species is found in “Afghanistan, Albania, Austria, Belgium, Bosnia and Herzegovina, Bulgaria, China (Xinjiang), Crete, Croatia, Czech Republic, Denmark, Estonia, Finland, France, Germany, Great Britain, Greece, Hungary, Iran, Iraq, Ireland, Israel, Italy, Latvia, Lithuania, Luxembourg, Macedonia, Moldova, Netherlands, Norway, Poland, Portugal, Romania, Russia (eastward up to Volga River), Serbia and Montenegro, Slovakia, Slovenia, Spain, Sweden, Switzerland, and the Ukraine.” It occurs from sea level to 3,300 m in Pamir Mountains, up to 2,500 m in the Caucsasus (Abramov pers. comm.).

The boundary between the distribution ranges of the European M. meles and Asian badger M. leucurus is the Volga River (up to the Middle Volga). M. meles is distributed west of the Volga River, M. leucurus is distributed from the Volga River to the east. The European badger M. meles was found in the Nizhnii Novgorod Province (on both sides of Volga River). M. meles is distributed in the west and north districts of Kirov Province, the east and south of Kirov Province are inhabited by M. leucurus. The sympatric zone between these species is the country between the Volga and Kama rivers (Abramov et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Eurasian badgers (Meles meles) are widespread throughout the Palearctic region. They are present from as far west as Ireland and Spain to the eastern edges of Russia, China, and Japan. The northern boundary of the Eurasian badger range extends to the Russian Arctic Circle and Finland, and the southern boundary occurs along the southeastern coast of China.

Biogeographic Regions: palearctic (Native )

  • Delahay, R., G. Wilson, S. Harris, D. Macdonald. 2008. Badger Meles meles. Pp. 425-436 in S Harris, D Yalden, eds. Mammals of the British Isles: Handbook 4th Edition, Vol. 1, 4 Edition. Southampton, UK: The Mammal Society.
  • Lariviere, S., A. Jennings. 2009. Family Mustelidae. Pp. 564-624 in D Wilson, R Mittermeier, eds. Handbook of the Mammals of the World, Vol. 1/Carnivores, 1 Edition. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

1 record (North Sinai). First record in Egypt.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Localized (North Sinai border). AOO=4.2 km². 1 location.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (Europe, eastern Palaearctic, south to Palestine/Israel).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread throughout Europe and Britain, but not as common in northern Scotland and many of the islands around the UK (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eurasian badgers have a stocky body with short robust limbs and a short tail. Female mass ranges from 6.6 to 13.9 kg, and male mass ranges from 9.1 to 16.7 kg. Males and females do not differ in head-body length, which ranges from 56 cm to 90 cm. Tail length ranges from 11.5 cm to 20.2 cm. Eurasian badgers are known for their distinguishing dark stripes that run from their nose, through the eyes and to each ear. These two dark stripes are separated by a white medial stripe. Dorsal pelage is grizzled gray, and each individual hair is white at the base and darker at the tip. Venter pelage tends to be dark gray or black. Their skulls (dorsal view, ventral view, lateral view) are massive and heavy with a prominent sagittal crest and short, triangular paroccipital processes. Eurasian badgers have flattened molars, small incisors, and prominent canines. The teeth of Eurasian badgers are well suited for an omnivorous diet. The dental formula is I3/3, C1/1, P4/4/, M1/2 = 38.

Throughout their geographic range, Eurasian badgers are divided into 24 subspecies, eleven of which can be found in the former Soviet Union. Subspecies generally differ from each other by general color tone and often, general dimensions, skull size, upper molar form, and presence of premolars. However, most of these characteristics are not well-defined.

Range mass: 6.6 to 16.7 kg.

Average mass: 11.7 kg.

Range length: 56 to 90 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 16.647 W.

  • Kruuk, H. 1989. The Social Badger: Ecology and Behaviour of a Group-living Carnivore (Meles meles). New York, NY: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Adult length: 750 mm. Weight: 6 -7 kg in summer. Weight: 12 - 14 kg in autumn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It prefers deciduous woods with clearings, or open pastureland with small patches of woodland. It is also found in mixed and coniferous woodland, scrub, suburban areas and urban parks. It is an opportunistic forager with an omnivorous diet, including fruit, nuts, bulbs, tubers, acorns, and cereal crops. It also consumes a variety of invertebrates (especially earthworms), wasp and bee nests, birds' eggs, carrion, and live vertebrate prey such as hedgehogs, moles, and rabbits. In the northern parts of its range the species hibernates during the winter months. The home ranges of this species in Finland are very large, with a mean of about 15 km² (Kauhala et al. 2006), and their social system is peculiar, with large overlapping home ranges without any communal den (Kauhala in litt. 2006). In Finland, it does not reproduce every year, and the litter size is small (Kauhala et al. 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Eurasian badgers are highly adaptable and live in a wide variety of environments. Ideal habitat includes deciduous, conifer, or mixed woodlands adjacent to open fields. In addition, they may occupy hedges, scrub, and riverine habitats as well as agricultural land, grassland, steppes, and semi-deserts. When searching for a sett location, they prefer tree-, shrub- and rock-covered areas that will cover the entrance to their sett. Other favorable sett conditions include well-drained soils that that are easy to excavate and are relatively free of human disturbance. They also prefer areas with a moderately wet climate and rich pastures, as these are optimal conditions for earthworms, one of their primary prey. Average elevation for Eurasian badgers is 1000 m. Occasionally, they are found in suburban and urban areas of Great Britain, where human population densities are high.

Average elevation: 1000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • 2002. Badger. Pp. 1232-1282 in V Heptner, N Naumov, eds. Mammals of the Soviet Union, Vol. 2/1b, 1 Edition. New Delhi: Amerind Publishing Co..
  • Balestrieri, A., L. Remonti, C. Prigioni. 2009. Exploitation of Food Resources by the Eurasian Badger (Meles meles) at the Altitudinal Limit of Its Alpine Range (NW Italy). Zoological Science (Tokyo), 26/12: 821-827.
  • Gehrt, S., S. Riley, B. Cypher. 2010. Urban Carnivores: Ecology, Conflict, and Conservation. Baltimore: Johns Hopkins University Press. Accessed April 01, 2011 at http://books.google.com/books?id=xYKqluO6c8UC&source=gbs_navlinks_s.
  • da Silva, J., R. Woodroffe, D. Macdonald. 1993. Habitat, food availability and group territoriality in the European badger, Meles meles. Oecologia, 95/4: 558-564.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

There are many factors which effect where a badger can live and these can include geology, altitude, inclination and orientation of slopes, suitable cover and a mosaic of habitat types. Badgers occupy a large range of habitat types and they are often found in woods and copses (deciduous, coniferous and mixed), scrubs, hedgerows, quarries, moorland, open fields and even in housing estates! They are however more abundant in areas where a mosaic of features are present such as deciduous woodland, pasture and arable habitat types.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Although optimal habitat appears to be woods and pasturelands in lowland areas (3), badgers can also be found in urban areas (3), moorlands, and coastal habitats (5). Free-draining banks, natural caves, embankments, and tips are often the site of setts (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Earthworms are one Eurasian badgers' primary food sources and many aspects of badger behavior revolve around attaining them. Eurasian badgers eat multiple species of earthworms. When foraging for earthworms, badgers remain in a relatively small space (roughly one hectare). They grab ahold of their prey using their incisors, and if the earthworm breaks into multiple pieces, Eurasian badgers find and eat the remaining pieces. Eurasian badgers are solitary foragers, regardless of social structure. In addition to earthworms, Eurasian badgers also prey on rabbits, voles, shrews, moles, mice, rats and hedgehogs. They also eat a wide variety of large insects, including beetles, leatherjackets, caterpillars, and wasps. They target wasps, in particular, by eating their nests. Wasps are consumed by badgers seasonally and in larger volumes. Eurasian badgers also eat carrion and occasionally eat birds, frogs, fish, newts, lizards, slugs, and snails. Eurasian badgers also feed on more than 30 different kinds of fruit, including pears, plums, raspberries, cherries, strawberries, acorns, beechmast, and blackberries. Some cereals that they consume include maize, oats, wheat, and occasionally barley. Badgers also eat tubers and occasionally fungi.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; mollusks; terrestrial worms

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: carnivore (Vermivore); omnivore

  • Cleary, G., L. Corner, J. O'Keeffe, N. Marples. 2009. The diet of the badger Meles meles in the Republic of Ireland. Mammalian Biology, 74/6: 438-445.
  • Rosalino, L., M. Santos-Reis. 2009. Fruit consumption by carnivores in Mediterranean Europe. Mammal Review, 39/1: 67-78.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eurasian badgers primarily prey on invertebrates and may help control certain insect pest populations. Because they include a large amount of fruit in their diet, they may serve as seed dispersers throughout their native range, and one study found that only a small proportion of seeds ingested by badgers were damaged beyond the point of germination.  Eurasian badgers are hosts for many parasites, including cestodes, flat worms, round worms, fleas, ticks, and lice.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Apart from humans, adult badgers do not have natural predators. However, wolves, lynxes, and bears overlap geographical ranges with Eurasian badgers and may occasionally prey on them, especially younger badgers. Their fossorial and group lifestyles may help them avoid potential predators. Finally, badgers are notoriously aggressive, which likely plays an important role in predation avoidance.

  • Fedriani, J., F. Palomares, M. Delibes. 1999. Niche Relations among Three Sympatric Mediterranean Carnivores. Oecologia, 121/1: 138-148.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Meles meles preys on:
Anas acuta
Eliomys quercinus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Meles meles
Other: unusual host/prey

Animal / predator
Meles meles is predator of nest of Bombus

Animal / predator
adult of Meles meles is predator of adult of Timarcha tenebricosa

Animal / dung saprobe
fruitbody of Psathyrella scatophila is saprobic in/on dung or excretions of dung of Meles meles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eurasian badgers communicate in many different ways. They frequently use postures and visual stances to indicate aggressive behavior. Tail flicking and scraping the hind legs are signs of aggression when individuals feel threatened. Raising of the tail and piloerection are signs of sexual excitement. Badgers also communicate with each other through vocalizations, some of which may be difficult to distinguish from others. Growls from both males and females signify aggression and defense when animals feel threatened. Higher pitched wailing noises signify being attacked. Gurgle noises are used either in aggressive attack or sexual pursuit. Cubs exhibit "whickering" or "keckering" while playing or in trouble. Alarm calls for signaling danger to the rest of the group have not been observed.

Scent-marking is a key form of communication in Eurasian badgers. Communal latrines as well as subcaudal and anal gland secretions are used to mark group territories. In addition, scent from urine may also indicate the estrus condition of females. Allo-marking of conspecifics using secretions from the sub-caudal gland has also been observed. The purpose of allo-marking may be to create a group-specific odor.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

  • Buesching, C., P. Stopka, D. MacDonald. 2003. The Social Function of Allo-Marking in the European Badger (Meles meles). Behavior, 140/8: 965-980.
  • Wong, J., P. Stewart, D. MacDonald. 1999. Vocal Repertoire in the European Badger (Meles meles): Structure, Context, and Function. Journal of Mammalogy, 80/2: 570-588.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

European badgers live in gregarious groups and display some signs of hierarchy with a dominant boar (usually an older larger individual) and a dominant sow (having the first choice of breeding sites and usually an older animal), heading the group in higher density areas.

Although badgers are members of the order carnivore, they are in fact omnivores, meaning they eat a wide range of plants and animals. They have a varied diet depending on what food is available and on the time of year. The badger is a forager rather than a hunter and as such, badgers are opportunists when it comes to diet – they will take whatever is available, which becomes more apparent when food is scarce. A badger’s diet mainly consists of earthworms, insects, birds, small mammals, fruits and berries, cereals, reptiles and amphibians. The importance of these foods is determined by abundance and season.

Reproduction in badgers is unusual and involves a phenomenon called “delayed implantation”. Badgers mate at any time of the year but the embryo does not implant into the womb and start growing until the winter. This means that all cubs are born at the same time of year – mostly from January to March. Litter sizes usually range from two to three.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild Eurasian badger lived to be 14 years old, however few exceed 6 years of age in the wild. In captivity, badgers may live up to 19 years. Mortality rates of cubs within their first year are high, ranging from 50 to 65%. The mortality rate for adults is 30% for males and 24% for females.

Range lifespan

Status: wild:
14 (high) years.

Range lifespan

Status: captivity:
19 (high) years.

Average lifespan

Status: wild:
6 years.

Average lifespan

Status: captivity:
16.0 years.

Average lifespan

Status: captivity:
16.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.6 years (captivity) Observations: The implantation can be delayed and extend the gestation time up to one year. One captive specimen lived 18.6 years (Richard Weigl 2005). There are also anecdotal reports, which can be true, of one animal living 19.5 years in captivity (http://www.badgers.org.uk/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Eurasian badgers are usually polygynous. For those living in social groups, only the dominant male and female mate. Males do not defend access to estrous females from other males, but expend much more energy protecting mates from potential predators, such as African lions. Extra-group matings occur frequently. Females may advertise estrous to extra-group males through scent marking. Often, males expand territory ranges during breeding season in an attempt to include more females within their territories, and thus increase their number of matings.

Mating System: polygynous ; polygynandrous (promiscuous)

Eurasian badgers breed year-round; however, most breeding occurs during late winter/early spring (February through May) and during late summer/early autumn (August through October). Gestation last 9 to 12 months, and litters range from 1 to 6 cubs, with an average of 3. Average birth-weight for Eurasian badgers is 75 grams. Cubs emerge from their dens around 8 to 10 weeks after birth. On average, cubs are weaned by 2.5 months, and male and female Eurasian badgers reach sexual maturity by about one year after birth.

In areas with low population densities where badgers tend to be solitary, 90 to 95% of adult females successfully produce and implant blastocysts that proceed to full term pregnancy. Only around 40% of females from high population density areas successfully implant blastocysts and proceed to full term pregnancy. Although more than 90% of females in a given social group are capable of reproducing, most do not. Usually, a single dominant female reproduces, and dominant sows are known to kill the cubs of intragroup sows. However, more than one female in the social group may successfully breed depending upon the quality and abundance of available food resources and the number of setts in the group's territory.

Once eggs are fertilized, they may delay implantation into the uterus. This process occurs during the blastocyst stage for Eurasian badgers and is called delayed implantation or embryonic diapause. Implantation of the egg is partially governed by abiotic conditions such as photoperiod and temperature. Delayed implantation in female Eurasian badgers is coupled with superfetation, or the ability to conceive while pregnant. As a result, mixed-paternity litters are not uncommon. This is beneficial to females as it reduces the risk of infanticide by male badgers.

Breeding interval: Once per year

Breeding season: Can breed throughout the year, but breeding peaks from February to May as well as June to September.

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Range gestation period: 9 to 12 months.

Average birth mass: 75 g.

Average weaning age: 2.5 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 80 g.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female Eurasian badgers nurse cubs as well as provide solid food after weaning. Non-breeding females have been observed grooming and guarding young in the absence of their mother, but generally Eurasian badgers are not cooperative. Parental investment in Eurasian badgers is minimal, and males provide no care to cubs. In social Eurasian badgers, offspring often have a post-independence association with their mother.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female); pre-independence (Provisioning: Female); post-independence association with parents

  • 2002. Badger. Pp. 1232-1282 in V Heptner, N Naumov, eds. Mammals of the Soviet Union, Vol. 2/1b, 1 Edition. New Delhi: Amerind Publishing Co..
  • Cresswell, W., S. Harris, C. Cheeseman, P. Mallinson. 1992. To Breed or not to Breed: An Analysis of the Social and Density-Dependent Constraints on the Fecundity of Female Badgers (Meles meles). Philosophical Transactions: Biological Sciences, 338/1286: 393-407.
  • Delahay, R., G. Wilson, S. Harris, D. Macdonald. 2008. Badger Meles meles. Pp. 425-436 in S Harris, D Yalden, eds. Mammals of the British Isles: Handbook 4th Edition, Vol. 1, 4 Edition. Southampton, UK: The Mammal Society.
  • Kruuk, H. 1989. The Social Badger: Ecology and Behaviour of a Group-living Carnivore (Meles meles). New York, NY: Oxford University Press.
  • Lariviere, S., A. Jennings. 2009. Family Mustelidae. Pp. 564-624 in D Wilson, R Mittermeier, eds. Handbook of the Mammals of the World, Vol. 1/Carnivores, 1 Edition. Barcelona: Lynx Edicions.
  • Revilla, E., F. Palomares. 2002. Spatial Organization, Group Living and Ecological Correlates in Low-Density Populations of Eurasian Badgers, Meles meles. British Ecological Society, 71/2: 497-512.
  • Yamaguchi, N., H. Dugdale, D. MacDonald. 2006. Female Receptivity, Embryonic Diapause, and Superfetation in the European Badger (Meles meles): Implications for the Reproductive Tactics of Males and Females. The Quarterly Review of Biology, 81/1: 33-48.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Meles meles

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2947-10|GU167278|Meles meles| AATCGATGATTATTTTCCACAAACCATAAAGATATTGGTACCCTTTACCTTCTATTTGGTGCATGAGCTGGGATAGTAGGTACTGCTCTT---AGTCTACTAATTCGTGCTGAATTAGGTCAACCCGGCACTTTATTGGGAGAC---GATCAGATCTACAATGTAGTCGTGACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTTATACCCATCATAATTGGAGGCTTTGGAAACTGATTAGTCCCCCTAATA---ATTGGCGCACCCGACATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGACTCCTGCCTCCCTCCTTTCTTCTTCTCTTAGCCTCCTCCATAGTAGAAGCAGGTGCAGGAACAGGATGGACTGTATACCCTCCTCTAGCAGGAAACTTAGCACATGCAGGAGCATCTGTAGATTTA---ACAATTTTCTCTCTTCACCTAGCAGGTGTCTCATCTATCCTAGGAGCCATTAATTTTATCACTACCATTATTAACATGAAACCACCTGCAATATCACAATACCAAACTCCCCTATTCGTATGATCCGTACTAGTTACAGCCGTACTCTTACTTCTATCTCTACCAGTATTAGCGGCT---GGTATTACTATACTACTAACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCTGGAGGAGGGGATCCCATTCTTTACCAACATTTATTCTGATTTTTCGGACATCCTGAAGTATACATCTTAATCCTACCAGGATTTGGAATCATTTCACATGTTGTCACCTATTACTCAGGGAAAAAA---GAACCATTCGGCTATATAGGAATAGTCTGAGCAATAATATCCATCGGTTTCTTAGGGTTCATTGTGTGAGCCCACCACATGTTCACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Meles meles

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kranz, A., Tikhonov, A., Conroy, J., Cavallini, P., Herrero, J., Stubbe, M., Maran, T., Fernandes, M., Abramov, A. & Wozencraft, C.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, relatively large population, it occurs in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Meles meles is classified as a species of "least concern" on the IUCN's Red List of Threatened Species. It is widespread and abundant throughout the Palearctic region and densities have increased in Europe over the last decade. Despite this, changing climate patterns, especially during the climatically variable fall and spring seasons, may hinder badger survival. Warmer springs may cause badgers to end their extended torpor early, thus driving them to search for food during months when little sustenance is available.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • MacDonald, D., C. Newman, C. Buesching, P. Nouvellet. 2010. Are badgers 'Under The Weather'? Direct and indirect impacts of climate variation on European badger (Meles meles) populaiton dynamics. Global Change Biology, 16: 2913-2922.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident in Egypt).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Fully protected in the UK by the Protection of Badgers Act, 1992 (4), and by Schedule 6 of the Wildlife and Countryside Act, 1981. Classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species. Listed under Appendix III of the Bern Convention (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The species is common in European Russia. 30,000 individuals were recorded in Russia in 1990 (Abramov pers. comm.). Densities of this species have increased in Europe during recent decades (Holmala and Kauhala 2006). The population density of this species in Finland, near the northern limit of its distribution, is low, at about 2 to 2.5 individuals per 10 km² (Kauhala in litt. 2006).

The species is abundant throughout its range. In central Europe the population is increasing due to the reduction of rabies. In western Ukraine the population has increased. In the United Kingdom (1980s-1990s) there was a 77% increase in the total population size. There are large differences in population densities across its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Its decline in some agricultural areas has been attributed to land-use changes causing a loss of suitable habitat (Mitchell-Jones et al. 1999). It is sometimes persecuted as a pest. In central Europe the population was formerly severely reduced by rabies, but that threat has now decreased with rabies controls. In the United Kingdom the species is associated with bovine TB, which is used as an excuse to eradicate the species (there is no evidence of this). During hunting for foxes or raccoons the badger is often killed as bycatch. In the Russian Federation the species is sometimes hunted for its meat and fat which is used as a medicine. The species is sensitive to habitat fragmentation and the size of the remaining patch is important for the continued survival of the species. In Germany, the species is hunted annually. It is possible that the introduced raccoon dog (Nyctereutes procyonoides) competes with badgers, and a project in Finland is looking into this possible threat, initiated by the Finnish Game and Fisheries Research Institute, started this 2006 and continuing for about 4 years (Kauhala in litt. 2006). Badgers are heavily hunted in Finland, the annual harvest has increased in recent years, being about 10,000 badgers now (Kauhala in litt. 2006). The hunting season in Finland is the whole year, with the exception of females with young being protected in May, June, and July (Kauhala in litt. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Badgers can damage crops and cause subsidence problems; they are therefore considered a pest in some circumstances (3). Badgers are known to carry bovine tuberculosis, and have been culled for this reason, which has sparked considerable debate and protest, and further research is required (3). Historically, badgers have been severely persecuted in a number of ways, including badger baiting (in which badgers are pitted against dogs and forced to fight to the death), digging, setting snares, shooting, and having their sett holes blocked (4). Road accidents are a major cause of mortality, and habitat loss and fragmentation are also thought to be causes for concern (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention (Mitchell-Jones et al. 1999). It is also listed on Schedule 6 of the United Kingdom Wildlife and Countryside Act and listed under the Protection of Badgers Act. In Albania it is considered Endangered. The species is found in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Badgers have an extremely high level of legal protection under the Protection of Badgers Act, 1992 (4). It is illegal to intentionally kill, persecute, or trap a badger except by applying for a license (4). Inhumane means of control are banned, and it is also illegal to damage, destroy, and obstruct setts (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Eurasian badgers may damage agricultural crops as well as fruit gardens in populated areas. They are also known to damage buildings, fences, and gardens due to burrowing. They occasionally kill poultry. Eurasian badgers are vectors for tuberculosis and may occasionally transmit the disease to cattle, which is particularly costly to farmers.

Negative Impacts: crop pest; causes or carries domestic animal disease

  • Moore, N., A. Whiterow, P. Kelly, D. Garthwaite, J. Bishop, S. Langton, C. Cheeseman. 1999. Survey of Badger Meles meles Damage to Agriculture in England and Wales. Journal of Applied Ecology, 36/6: 974-988.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eurasian badgers may control hedgehog and wasp populations locally. In addition, their hair is frequently used in commercially produced brushes and their skin is often used to make rugs.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European badger

The European badger (Meles meles) is a species of badger of the genus Meles, native to almost all of Europe. It is classed as Least Concern for extinction by the IUCN, due to its wide distribution and large population.

The European badger is a social, burrowing animal which lives on a wide variety of plant and animal foods. It is very fussy over the cleanliness of its burrow, and defecates in latrines. Cases are known of European badgers burying their dead family members. Although ferocious when provoked, a trait which was once exploited for the blood sport of badger-baiting, the European badger is generally a peaceful animal, having been known to share its burrows with other species such as rabbits, red foxes and raccoon dogs. Although it does not usually prey on domestic stock, the species is nonetheless alleged to damage livestock through spreading bovine tuberculosis.

Contents

Nomenclature

Until the mid-18th century, European badgers were variously known in Britain as brock, pate, grey and bawson. "Brock" still persists in some areas, the root word likely being the Danish word brok, which also means badger. For example, in Irish Gaelic, the word for badger is broc. The name "bawson" is derived from "bawsened", which refers to something striped with white. "Pate" is a local name which was once popular in northern England. The name "badget" was once common, but restricted to Norfolk, while "earth dog" was used in southern Ireland.[2]

Origin

The species likely evolved from the Chinese Meles thorali of the early Pleistocene. The modern species originated during the early Middle Pleistocene, with fossil sites occurring in Episcopia, Grombasek, Süssenborn, Hundsheim, Erpfingen, Koneprusy, Mosbach 2, and Stránská Skála. A comparison between fossil and living specimens shows a marked progressive adaptation to omnivory, namely in the increase in the molars' surface areas and the modification of the carnassials. Occasionally, badger bones may be discovered in strata from much earlier dates, due to the species' burrowing habit.[3][4]

Subspecies

As of 2005,[5] eight subspecies are recognised.

SubspeciesTrinomial authorityDescriptionRangeSynonyms
Common badger
Meles meles meles

Badger Cornwall 3.jpg

Linnaeus, 1758A large subspecies with a strongly developed sagittal crest, it has a soft pelage and relatively dense underfur. The back has a relatively pure silvery-grey tone, while the main tone of the head is pure white. The dark stripes are wide and black, while the white fields fully extend along the upper and lateral parts of the neck. It can weigh up to 20–24 kg in autumn, with some specimens attaining even larger sizes.[6]All Europe, save for Rhodes, Crete and Spain. Its eastern range encompasses the European area of the former Soviet Union eastward to the Volga, Crimea, Ciscaucasia, and the northern Caucasusalba (Gmelin, 1788)

britannicus (Satunin, 1905)
caninus (Billberg, 1827)
caucasicus (Ognev, 1926)
communis (Billberg, 1827)
danicus (Degerbøl, 1933)
europaeus (Desmarest, 1816)
maculata (Gmelin, 1788)
tauricus (Ognev, 1926)
taxus (Boddaert, 1785)
typicus (Barrett-Hamilton, 1899)
vulgaris (Tiedemann, 1808)

Cretan badger
Meles meles arcalus

Badger Crete.jpg

Miller, 1907Crete
Trans-Caucasian badger
Meles meles canascens

MelesCanescens.jpg

Blanford, 1875A small subspecies with a dirty-greyish back with brown highlights, its head is identical to Meles m. meles, though with weaker crests, and its upper molars are elongated in a similar way to the Asian badger[7]Transcaucasia, Kopet Dag, Turkmenia, Iran, Afghanistan and possibly Asia Minorminor (Satunin, 1905)

ponticus (Blackler, 1916)

Kizlyar badger
Meles meles heptneri
Ognev, 1931A large subspecies, it exhibits several traits of the Asian badger, namely its very pale, dull, dirty-greyish-ocherous colour and narrow head stripes.[7]Steppe region of northeastern Ciscaucasia, the Kalmytsk steppes and the Volga delta
Iberian badger
Meles meles marianensis
Graells, 1897Iberian Peninsulamediterraneus (Barrett-Hamilton, 1899)
Norwegian badger
Meles meles milleri

Meles meles norway 1.JPG

Baryshnikov, Puzachenko and Abramov, 2003A small subspeciesSouth-west Norway
Rhodes badger
Meles meles rhodius
Festa, 1914Rhodes
Fergana badger
Meles meles severzovi
Heptner, 1940A small subspecies with a relatively pure, its back is silvery-grey with no yellow sheen. The head stripes are wide and occupy the whole ear. Its skull exhibits several features which are transitory between the Asian and European badger[7]Right tributary region of the Panj River, the upper Amu Darya, Pamiro-Alay system, the Fergana Valley and its adjoining southern and mountainsbokharensis (Petrov,1953)

Physical description

Build

Skeleton
Dentition
Skull

European badgers are powerfully built animals with small heads, thick, short necks, stocky, wedge-shaped bodies and short tails. Their feet are digitigrade and short, with five toes on each foot.[8] The limbs are short and massive, with naked lower surfaces on the feet. The claws are strong, elongated and have an obtuse end, which assists in digging.[9] The claws are not retractable, and the hind claws wear with age. Old badgers are sometimes found with their hind claws nearly completely worn away from constant digging.[10] Their snouts, which are used for digging and probing, are muscular and flexible. The eyes are small and the ears short and tipped with white. Whiskers are present on the snout and above the eyes. Boars typically have broader heads, thicker necks and relatively pointed and narrow tails than sows, which are sleeker, have narrower, less domed heads and fluffier tails. Their guts are longer than those of red foxes. The small intestine has a mean length of 5.36 metres, and lacks a cecum. Both sexes have three pairs of nipples, which are more developed in females.[8] European badgers cannot flex their backs as martens, polecats and wolverines can, nor can they stand fully erect like honey badgers, though they can move quickly at full gallop.[9] Adults measure 25–30 cm (10–12 in) in shoulder height,[11] 60–90 cm (24–36 in) in body length, 12–24 cm (4.7-9.5 in) in tail length, 7.5–13 cm (3–5 in) in hind foot length and 3.5–7 cm (1.4-2.8 in) in ear height. Males (or boars) slightly exceed females (or sows) in measurements, but can weigh considerably more. Their weights vary seasonally, growing from spring to autumn and reach peaks during the onset of hibernation. During the summer, they weigh 7–13 kg (15-27 lb) and 15–17 kg (33-38 lb) in autumn. Sows can attain a top weight of around 17.2 kg (38 lb), while exceptionally large boars have been reported in autumn. The heaviest verified was 27.2 kg (60 lb), though unverified specimens have been reported to 30.8 kg (68 lb).[12][13] Although their sense of smell is acute, their eyesight is monochromatic, as they have been known not to react to red lanterns. Only moving objects attract their attention. Their hearing is no higher than that of humans.[14]

Badger skin - the contrasting markings of the fur serve to warn off attackers rather than camouflage, as they are conspicuous at night.[15]

European badger skulls are quite massive, heavy and elongated. Their braincases are oval in outline, while the facial part of their skulls is elongated and narrow.[16] Adults have prominent sagittal crests which can reach 15 mm tall in old males,[17] and are more strongly developed than those of honey badgers.[18] Aside from anchoring the jaw muscles, the thickness of the crests protect their skulls from hard blows.[19] Similar to martens,[20] the dentition of European badgers is well-suited for their omnivorous diets. Their incisors are small and chisel-shaped, their canine teeth are prominent and their carnassials are not overly specialised. Their molars are flattened and adapted for grinding.[17] Their jaws are powerful enough to crush most bones; a provoked badger was reported as biting down on a man's wrist so severely, it had to be amputated.[21] The dental formula is:

Dentition
3.1.3.3
3.1.4.2

Scent glands are present below the base of the tail and on the anus. The subcaudal gland secretes a musky-smelling, cream-coloured fatty substance, while the anal glands secrete a stronger-smelling, yellowish-brown fluid.[17]

Fur

Mounted erythristic badger

In winter, the fur on the back and flanks is long and coarse, consisting of coarse and bristly guard hairs with a sparse, soft undercoat. The belly fur consists of short, sparse hairs, with skin being visible in the inguinal region. Guard hair length on the middle of the back is 75–80 mm (3.0–3.1 in) in winter. Prior to hibernation, the throat, lower neck, chest and legs are black. The belly is of a lighter, brownish tint, while the inguinal region is brownish-grey. The general colour of the back and sides is light silvery-grey, with straw-coloured highlights on the sides. The tail has long and coarse hairs, and is generally the same colour as the back. Two black bands pass along the head, starting from the upper lip and passing upwards to the whole base of the ears. The bands sometimes extend along the neck and merge with the colour of the upper body. The front parts of the bands are 15 mm (0.59 in), and widen to 45–55 mm (1.8–2.2 in) in the ear region. A wide, white band extends from the nose tip through the forehead and crown. White markings occur on the lower part of the head, and extend backwards to a great part of the neck's length. The summer fur is much coarser, shorter and sparser, and is much darker in colour, with the black tones becoming brownish and the yellowish tinges.[9] Partial melanism in badgers is known, and albinos are not uncommon. Albino badgers can be pure white or yellowish with pink eyes. Erythristic badgers are more common than the former, being characterised by having a sandy-red colour on the usually black parts of the body. Yellow badgers are also known.[22]

Behaviour

Social and territorial behaviours

Badger scratching tree

European badgers are the most social of badgers,[23] forming groups of six adults on average, though groups of 23 are known. Group size may be related to habitat composition. In optimal habitat, badger territories can be as small as 30 ha, and large as 150 ha in marginal areas. Badger territories can be identified by the presence of communal latrines and well-worn paths. Dominance hierarchy is not evident, with animals within and outside a group showing considerable tolerance of each other. Boars tend to mark their territories more actively than sows, with their territorial activity increasing during the mating season in early spring.[24] Badgers groom each other very thoroughly with their claws and teeth. Grooming may have a social function.[25] They are crepuscular and nocturnal in habits.[25] Aggression among badgers is largely associated with territorial defence and mating. When fighting, they bite each other on the neck and rump, while running and chasing. Injuries incurred in such fights can be severe and sometimes fatal.[26] When attacked by dogs or sexually excited, badgers may raise their tails and fluff up their bodies. European badgers have an extensive vocal repertoire; when threatened, they emit deep growls. They bark when surprised, and whicker when playing or are distressed. When fighting, they emit low kekkering noises.[26]

Reproduction and development

Estrus in European badgers lasts four to six days, and may occur throughout the year, though there is a peak in spring. Sexual maturity in boars occurs in varying periods; on average, it is attained at the age of 12–15 months, while in others it is attained as early as eight to 9 months or as late as two years. They are normally fecund during January–May, with spermatogenesis declining in summer. Sows usually begin ovulating in their second year, though some exceptionally begin at 9 months. They can mate at any time of the year, though the main peak occurs in February–May, when mature sows are in postpartal estrus and young animals experience their first estrus. Matings occurring outside this period typically occur in sows which either failed to mate early or matured slowly.[27] Badgers are usually monogamous; boars typically mate with one female for life, whereas sows have been known to mate with more than one male.[28] Mating lasts 15–60 minutes, though they may briefly copulate for two minutes when the sow is not in estrus. A delay of two to 9 months precedes the fertilised eggs implanting into the uterus' walls, though matings in December can result in immediate implantation. Ordinarily, implantation happens in December, with a gestation period lasting seven weeks. Cubs are usually born in mid-January to mid-March within underground chambers containing bedding. In areas where the countryside is waterlogged, cubs may be born above ground in buildings. Typically, only dominant sows can breed, as they suppress the reproduction of subordinate females.[27]

The average litter consists of one yo five cubs.[27] Although many cubs are sired by resident males, up to 54% can be fathered by boars from different groups.[24] Dominant sows may kill the cubs of subordinates.[26] Cubs are born pink, with greyish, silvery fur and fused eyelids. Neonatal badgers are 12 cm in body length on average and weigh 75-132 grams, with cubs from large litters being smaller.[27] By three to five days, their claws become pigmented, and individual dark hairs begin to appear.[28] Their eyes open at four to five weeks of age, and their milk teeth erupt after four to six weeks. They emerge from their setts at eight weeks of age, and begin to be weaned at 12 weeks, though they may still suckle until they are four to five months old. Subordinate females assist the mother in guarding, feeding and grooming the cubs.[27] Cubs fully develop their adult coats at 41–68 days.[28] In areas with medium-high badger populations, dispersal from the natal group is uncommon, though badgers may temporarily visit other groups.[25]

Denning behaviours

Entrance to a badger sett

Like other badger species, European badgers are burrowing animals. However, the dens they construct (called setts) are the most complex, and are passed on from generation to generation.[29] The number of exits in one sett can vary from a few to 44-50. These setts can be vast, and can sometimes accommodate multiple families. In the latter case, several isolated passages and nesting chambers occur. Some setts may have exits which are only used in times of danger or play. A typical sett has a 22–63 cm (8.7–25 in) wide base and a 14–32 cm (5.5–13 in) height. Three nesting chambers occur in setts, some of which are open both ends. The nesting chamber is located 5–10 m (5.5–11 yd) from the opening, and is situated more than a 1 m (1 yd) underground, in some cases 2.3 m (2.5 yd). Generally, the passages are 35–81 m (38–89 yd) long. The nesting chamber is on average 74 × 76 cm (29 × 30 in), and are 38 cm (15 in) high.[30] Badgers dig and collect bedding throughout the year, particularly in autumn and spring. Sett maintenance is usually carried out by subordinate sows and dominant boars. The sett chambers are frequently lined with bedding, which is brought in on dry nights, consisting of grass, bracken, straw, leaves or moss. Up to 30 bundles can be carried to the sett on a single night. They are fastidiously clean animals, which regularly discard old bedding. During the winter, they may take their bedding outside on sunny mornings and retrieve it later.[24] Spring cleaning is connected to the birth of cubs, and may occur several times during the summer to prevent parasite infestations.[30] If a badger dies within a sett chamber, its conspecifics will seal off the chamber and dig a new one. Some badgers will drag their dead out of the sett and bury them outside.[31] A sett is almost invariably located near a tree, which is used by badgers for stretching or claw scraping.[32] Badgers defecate in latrines, which are located near the sett and at strategic locations on territorial boundraries or near places with abundant food.[25] In extreme cases, when there is a lack of suitable burrowing grounds, badgers will move into haystacks in winter.[30] They may share their earths with red foxes or European rabbits. Rabbits may benefit from the presence of badgers as protection against other predators, and usually avoid predation from the badgers themselves by burrowing in smaller, hard to reach chambers.[33]

Winter sleep

As with bears, winter sleep in badgers is not accompanied by the lowering of body temperature or bodily functions. Badgers begin to prepare for winter sleep during late summer by accumulating fat reserves, which reach a peak in October. During this period, the sett is cleaned and the nesting chamber is filled with bedding. They typically stop leaving their setts once snow falls. In Russia, badgers retire for their winter sleep from late October to mid-November. In areas such as England and Transcaucasia, where winters are less harsh, badgers either forgo winter sleep entirely or do so with repeated interruptions. Upon retiring to sleep, badgers block their sett entrances with dry leaves and earth. They emerge from their setts in March and early April.[14]

Diet

Along with brown bears, European badgers are among the least carnivorous members of the Carnivora;[34] they are highly adaptable and opportunistic omnivores, whose diet encompasses a wide range of animals and plants. Earthworms are their most important food source, followed by large insects, small or young mammals, carrion, cereals, fruit and underground storage organs. Mammals preyed on by badgers include rabbits, rats, mice, voles, shrews, moles and hedgehogs. Insect prey includes chafers, dung and ground beetles, caterpillars, leatherjackets, and the nests of wasps and bumblebees. Cereal food includes wheat, oats, maize and occasionally barley. Fruits include windfall apples, pears, plums, blackberries, bilberries, raspberries, strawberries, acorns, beechmast, pignuts and wild arum corms. Occasionally, they feed on ground-nesting and roosting birds, frogs, toads, newts, snakes, lizards, snails, slugs, fungi, and green food such as clover and grass, particularly in winter and during droughts.[25] Badgers characteristically capture large numbers of one food type in each hunt. Generally, they do not eat more than 0.5 kg (1.1 lb) of food per day, with young specimens yet to attain one year of age eating more than adults. An adult badger weighing 15 kg (33 lb) eats a quantity of food equal to 3.4% of its body weight.[34] Badgers typically eat prey on the spot, and rarely transport it to their setts. Surplus killing has been observed in chicken coops.[25]

Badgers prey on rabbits throughout the year, especially during times when their young are available. They catch young rabbits by locating their position in their nest by scent, then dig vertically downwards to it. In mountainous or hilly districts, where vegetable food is scarce, badgers rely on rabbits as a principal food source. Adult rabbits are usually avoided, unless they are wounded or caught in traps.[35] They consume them by turning them inside out and eating the meat, leaving the inverted skin uneaten.[36] Hedgehogs are eaten in a similar manner.[35] In areas where badgers are common, hedgehogs are scarce.[23] Some rogue badgers may kill lambs, though this is very rare; they may be erroneously implicated in lamb killings through the presence of discarded wool and bones near their setts, though foxes, which occasionally live alongside badgers, are often the culprits, as badgers do not transport food to their earths. They typically kill lambs by biting them behind the shoulder. Poultry and game birds are also taken only rarely. Some badgers may build their setts in close proximity to poultry or game farms without ever causing damage. In the rare instances in which badgers do kill reared birds, the killings usually occur in February–March, when food is scarce due to harsh weather and increases in badger populations. Badgers can easily breach bee hives with their jaws, and are mostly indifferent to bee stings, even when set upon by swarms.[35]

Relationships with other predators

European badgers have few natural enemies. wolves, lynxes and dogs can pose a threat to badgers, though deaths caused by them are rare. They may live alongside red foxes in isolated sections of large burrows.[31] The two species possibly tolerate each other out of commensalism; foxes provide badgers with food scraps, while badgers maintain the shared burrow's cleanliness.[37] However, cases are known of badgers driving vixens from their dens and destroying their litters without eating them.[31] Raccoon dogs may extensively use badger setts for shelter. There are many known cases of badgers and raccoon dogs wintering in the same hole, possibly because badgers enter hibernation two weeks earlier than the latter, and leave two weeks later. In exceptional cases, badger and raccoon dog cubs may coexist in the same burrow. Badgers may drive out or kill raccoon dogs if they overstay their welcome.[38]

Range

The distributional boundary between the ranges of European and Asian badgers is the Volga River, the European species being situated on the western bank. They are common in European Russia, with 30,000 individuals having been recorded there in 1990. They are abundant and increasing throughout their range due to a reduction in rabies. In the UK, badgers experienced a 77% increase in population during the 1980s-1990s.[1] The current badger population in Great Britain is estimated at 250,000 (190,000 in England, 25,000 in Scotland and 35,000 in Wales).[27]

Diseases and parasites

Tuberculosis is a major mortality factor in badgers, though infected badgers can live and successfully breed for years before succumbing. Badgers are vulnerable to the mustelid herpesvirus-1, as well as rabies and canine distemper, though the latter two are absent in Great Britain. Badgers have been implicated in spreading bovine tuberculosis to cattle. Other diseases carried by European badgers include arteriosclerosis, pneumonia, pleurisy, nephritis, enteritis, polyarthritis and lymphosarcoma. Ectoparasites carried by badgers include the fleas Paraceras melis, Chaetopsylla trichosa and Pulex irritans, the lice Trichodectes melis, the ticks Ixodes ricinus, I. canisuga, I. hexagonus, I. reduvius, I. melicula. Mange is also carried by them. Helminths carried by badgers include trematodes such as Itygonimus lorum, nematodes such as Molineus patens, Uncinaria stenocephala, Capilara erinacei, Aelurostrongylus falciformis and tapeworms such as Mesocestoides lineatus and Dilepis undula.[39]

Relationships with humans

In folklore and literature

Mr. Badger, as portrayed in an illustrated edition of Kenneth Graham's The Wind in the Willows
Tommy Brock, as illustrated by Beatrix Potter in The Tale of Mr. Tod

In Irish mythology, badgers are portrayed as shape-shifters and kinsmen to Tadg, the king of Tara and foster father of Cormac mac Airt. In one story, Tadg berates his adopted son for having killed and prepared some badgers for dinner.[40] In German folklore, the badger is portrayed as a cautious, peace-loving Philistine, who loves more than anything his home, family and comfort, though he can become aggressive if surprised. He is a cousin of Reynard the Fox, whom he uselessly tries to convince to return to the path of righteousness.[2]

In Kenneth Graham's The Wind in the Willows, Mr. Badger is depicted as a gruff, solitary figure who "simply hates society", yet is a good friend to Mole and Ratty. A friend of Toad's now-deceased father, he is often firm and serious with Toad, but at the same time generally patient and well-meaning towards him. He can be seen as a wise hermit, a good leader and gentleman, embodying common sense. He is also brave and a skilled fighter, and helps clear the Wild Wooders from Toad Hall. A villainous badger named Tommy Brock appears in Beatrix Potter's 1912 book The Tale of Mr. Tod, where he is shown kidnapping the children of Benjamin Bunny and his wife Flopsy, and hides them in an oven in the home of Mr. Tod the fox, with whom he fights in the book's conclusion. The book's portrayal of the badger as a filthy animal which appropriates fox dens was criticised from a naturalistic viewpoint, though the inconsistencies are few and employed to create individual characters rather than evoke an archetypical fox and badger.[41] A wise old badger named Trufflehunter appears in C. S. Lewis' Prince Caspian, where he aids Caspian X in his struggle against King Miraz. A badger takes a prominent role in Colin Dann's The Animals of Farthing Wood series as second in command to Fox. The badger is also the house symbol for Hufflepuff in the "Harry Potter" book series. The Redwall series also has the Badger Lords, who rule the extinct volcano fortress of Salamandastron and are renowned as fierce warriors. The children's television series Bodger and Badger was a popular on CBBC during the 1990s, set around the mishaps of a mashed potato loving badger and his human companion.

Hunting

Illustration of a badger brought to bay by a Dachshund (Dachshund is German for "badger-dog")

European badgers are of little significance to hunting economies, though they may be actively hunted locally. Methods used for hunting badgers include catching them in jaw traps, ambushing them at their setts with guns, smoking them out of their earths and through the use of specially bred dogs such as Fox Terriers and Dachshunds to dig them out.[42] Badgers are, however, notoriously durable animals; their skins are thick, loose and covered in long hair which acts as protection, and their heavily ossified skulls allow them to shrug off most blunt traumas, as well as shotgun pellets.[43]

Some badger products have been used for medical purposes; badger expert Ernest Neal, quoting from an 1810 edition of The Sporting Magazine, wrote ;

'The flesh, blood and grease of the badger are very useful for oils, ointments, salves and powders, for shortness of breath, the cough of the lungs, for the stone, sprained sinews, collachs etc. The skin being well dressed is very warm and comfortable for ancient people who are troubled with paralytic disorders.'

[44]

Their hairs are used for making shaving brushes and sporrans[44] and the skin is sometimes used to make shagreen. Badger meat is eaten in some districts of the former Soviet Union, though in most cases it is discarded.[42] Smoked hams made from badgers were once highly esteemed in England, Wales and Ireland.[44]

Badger-baiting

Badger-baiting was once a popular blood sport, in which badgers were captured alive, placed in boxes and forced to fight dogs.

Badger-baiting was outlawed in the United Kingdom as early as 1835, with the Cruelty to Animals Act. The practice of baiting of animals is now specifically forbidden under the Protection of Animals Act 1911.[45] Moreover, the cruelty towards and death of the badger constitute offences under the Protection of Badgers Act 1992, and further offences under this act are inevitably committed to facilitate badger-baiting (such as interfering with a sett, or the taking or the very possession of a badger for purposes other than nursing an injured animal to health). If convicted, badger-baiters may face a sentence of up to six months in jail, a fine of up to £5000, and other punitive measures, such as community service or a ban from owning dogs.[46]

Tameability

There are several accounts of European badgers being tamed. Tame badgers can be affectionate pets, and can be trained to come to their owners when their names are called. They are easily fed, as they are not fussy eaters, and will instinctively unearth rats, moles and young rabbits without training, though they do have a weakness for pork. Although there is one record of a tame badger befriending a fox, they generally do not tolerate the presence of cats and dogs, and will chase them.[47]

References

Notes

  1. ^ a b Kranz, A., Tikhonov, A., Conroy, J., Cavallini, P., Herrero, J., Stubbe, M., Maran, T., Fernades, M., Abramov, A. & Wozencraft, C. (2008). Meles meles. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b Neal 1958, pp. 150–152
  3. ^ Kurtén 1968, pp. 103–105
  4. ^ Spagnesi & De Marina Marinis 2002, pp. 226–227
  5. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001283. 
  6. ^ Heptner & Sludskii 2002, pp. 1253–1254
  7. ^ a b c Heptner & Sludskii 2002, pp. 1254–1255
  8. ^ a b Harris & Yalden 2008, p. 427
  9. ^ a b c Heptner & Sludskii 2002, pp. 1234–1237
  10. ^ Neal 1958, p. 23
  11. ^ Pease 1898, p. 24
  12. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  13. ^ Heptner & Sludskii 2002, pp. 1241–1242
  14. ^ a b Heptner & Sludskii 2002, p. 1272
  15. ^ Neal 1958, p. 25
  16. ^ Heptner & Sludskii 2002, p. 1238
  17. ^ a b c Harris & Yalden 2008, p. 428
  18. ^ Heptner & Sludskii 2002, p. 1214
  19. ^ Neal 1958, p. 29
  20. ^ Pease 1898, p. 29
  21. ^ Pease 1898, p. 35
  22. ^ Neal 1958, p. 27
  23. ^ a b Macdonald 2001, p. 117
  24. ^ a b c Harris & Yalden 2008, pp. 430–431
  25. ^ a b c d e f Harris & Yalden 2008, p. 432
  26. ^ a b c Harris & Yalden 2008, p. 431
  27. ^ a b c d e f Harris & Yalden 2008, pp. 433–434
  28. ^ a b c Heptner & Sludskii 2002, pp. 1278–1279
  29. ^ Macdonald 2001, p. 116
  30. ^ a b c Heptner & Sludskii 2002, pp. 1269–1272
  31. ^ a b c Heptner & Sludskii 2002, pp. 1279–1281
  32. ^ Neal 1958, p. 83
  33. ^ Pease 1898, p. 45
  34. ^ a b Heptner & Sludskii 2002, pp. 1265–1268
  35. ^ a b c Neal 1958, pp. 70–80
  36. ^ Pease 1898, p. 62
  37. ^ Dale, Thomas Francis, The fox, Longmans, Green, and Co., 1906
  38. ^ Heptner, V. G. ; Naumov, N. P., Mammals of the Soviet Union Vol.II Part 1a, Sirenia AND Carnivora (Sea cows; Wolves and Bears), p. 107, Science Publishers, Inc. USA. 1998, ISBN 1-886106-81-9
  39. ^ Harris & Yalden 2008, p. 435
  40. ^ Monaghan, Patricia, The encyclopedia of Celtic mythology and folklore, p.436, Infobase Publishing, 2004, ISBN 0-8160-4524-0
  41. ^ MacDonald, Ruth K., Beatrix Potter, p.47, Twayne Publishers, 1986, ISBN 0-8057-6917-X
  42. ^ a b Heptner & Sludskii 2002, pp. 1281–1282
  43. ^ Pease 1898, p. 36
  44. ^ a b c Neal 1958, pp. 152–154
  45. ^ "Protection of Animals Act 1911 (revised)". OPSI website. http://www.opsi.gov.uk/RevisedStatutes/Acts/ukpga/1911/cukpga_19110027_en_1. Retrieved 2009-06-16. 
  46. ^ "Protection of Badgers Act 1992". OPSI website. http://www.opsi.gov.uk/ACTS/acts1992/ukpga_19920051_en_1. Retrieved 2009-06-16. 
  47. ^ Pease 1898, pp. 58–61

Bibliography

Further reading

  • Ernest Neal & Chris Cheeseman. Badgers (Poyser, 2002)
  • Richard Meyer. The Fate of the Badger (Batsford 1986)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!