Overview

Brief Summary

Biology

Common otters feed mainly on fish, and the occasional water bird or frog may be taken (3). Up to 15 % of an individual's body weight in fish may be consumed daily (2). Common otters mark their large territories by depositing faeces ('spraints') in various prominent places (3). Breeding can occur throughout the year; two or three cubs are usually born in a den known as a holt, and 10 weeks later the cubs emerge above ground with their mother (3). Common otter mothers care for their offspring for about a year; it may take the cubs up to 18 months to learn to fish, and the mother helps this learning process by releasing live fish for the cubs to re-catch (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Comprehensive Description

Description

The elusive common otter has sleek brown fur, which is often paler on the underside, and a long lithe body with a thick tail and short legs (3). Adaptations for an aquatic lifestyle include webbed feet (3), the ability to close the small ears and the nose when under water, and very dense, short fur which traps a layer of air to insulate the animal. Many sensitive hairs ('vibrissae') frame the snout; these help the otter to locate prey (2). Vocalisations include a high-pitched whistle between a mother and her cubs, twittering noises produced during play-fighting and cat-like noises when fighting (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 3.25 of 5

Distribution

Range Description

The Eurasian otter has one of the widest distributions of all Palaearctic mammals (Corbet, 1966). Its range covers parts of three continents: Europe, Asia and Africa. Its current distribution in Europe is marked by a large corridor, reaching from Central Denmark, via the Western parts of Germany, the Netherlands, Belgium, Luxembourg, the Eastern parts of France, Switzerland, the Western pmts of Austria to Central Italy, where the otter is extinct or reduced to small and sometimes isolated populations. Information for Russia, which forms a link between Europe and Asia, is fragmented. It seems that the otter is distributed throughout the country with the exception of the tundra and the northern regions with permanent frost. The southern border of the Eurasian otter's range in the Near and Middle East is formed by Israel, Jordan, Iraq and Iran. It is also reported from Morocco, Algeria and Tunisia in Africa in the north of Sahara. In south Asia the species has been reported from all most all the countries especially from Himalayan River systems of Pakistan, Afghanistan, India, Nepal, Bhutan and Myanmar and eastward throughout South East Asia up to Japan where it believed to be extinct.

There are several open questions for the Southeast Asian region. It seems that the Eurasian otter reached the island of Sumatra but, did not reach the island of Java. Conroy et al. (1998) are not sure if the evidence of otters on the island of Borneo really relates to the Eurasian otter. Its occurrence has been confirmed from South Korea, Southern China, Viet Nam, Cambodia, Lao PDR, Myanmar and Bangladesh (Lekagul and McNeely, 1988, Hussain 1999). In India it occurs in Northern, North East and from Southern India. Formerly widely distributed in Japan, it is now believed to be extinct (Ando et al. 2007). Once widespread in the rivers of northern Mongolia (Mallon 1985), along the rivers of Mongol Altai Mountain Range, and along the Halh River in Ikh Hyangan Mountain Range (Bannikov 1954; Dulamtseren 1970; Sokolov and Orlov 1980). It has also been reported from downstream of the Tengis River in northern parts of Hövsgöl Mountain Range (Tsagaan 1975; 1977) and around the Eröö River Basin in western Hentii Mountain Range (Tsendjav 2005). The Eurasian otter can also be found occasionally along the Tes River in northern Hangai.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Global distribution

Coastal habitat is suitable over large portions of the European continent, including perimeters of the Celtic Sea, English Channel, Bay of Biscay, Irish Sea, Sea of the Hebrides, North Sea, Norwegian Sea, Baltic Sea, Gulf of Riga and Mediterranean Sea. Furthermore, some European countries offer suitable otter habitat hundreds of kilometres inland from the nearest sea. For example, in Romania, not only are European otter found within the Danube Delta, but far inland within the Carpathian Mountains. In Poland and Bulgaria, otters are found far inland in the rivers that have sufficiently high water quality and have a minimum of hydroelectric installations. The European otter, in fact, can be found in mountain valleys as high as 1400 metres in places such as Bulgaria, including numerous small watersheds in West Rhodopy Mountain, Bulgaria. In Turkey, however, overgrazing of riparian terrestrial cover, human hunting and water pollution have almost extirpated L. lutra from inland areas, except for parts of the Coruh River. In Soain L .lutra is found along parts of the coastline but also in interior riparian zones in such ecosystems as the Iberian sclerophyllus forests, where populations may be considered relicts of broader prehistoric distributions.
  • * C.Michael Hogan. 2011. ''European otter". Encyclopedia of Earth. Topic ed. P.Saundry. ed.-in-chief C.J.Cleveland. Encyclopedia of Earth http://www.eoearth.org/article/European_otter?topic=49540
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© c michael hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Geographic Range

Lutra lutra inhabits most of Eurasia south of the tundra line and North Africa. (MacDonald, 1984)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once widespread throughout the UK the otter is now largely restricted to Wales, south-west England, Scotland and Northern Ireland (5), is scarce in the east and south-east and absent from central England (6). It occurs throughout most of Eurasia, to the south of the tundra line, as well as in North Africa (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East North Atlantic, European waters (ERMS scope), Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Average mass: 6750 g.

Average basal metabolic rate: 25.104 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Eurasian otter live in a wide variety of aquatic habitats, including highland and lowland lakes, rivers, streams, marshes, swamp forests and coastal areas independent of their size, origin or latitude (Mason and Macdonald 1986). In Europe they are found in the brackish waters from the sea level up to 1,000 m in the Alps (Ruiz-Olmo and Gosalbez 1997) and above 3,500 m in the Himalayas (Prater 1971) or 4,120 m in Tibet (Mason and Macdonald 1986). In the Indian sub-continent, the Eurasian otters occur in cold hill and mountain streams. During summer (April - June) in the Himalayas they may ascend up to 3,660 m. These upward movements probably coincide with the upward migration of the carp and other fish for spawning. With the advent of winter the otters come down to lower altitudes (Prater 1971). In a study conducted in Thailand in Huai Kha Khaeng where the Eurasian, smooth-coated and small-clawed otters live sympatrically, Kruuk et al. (1994) found that the Eurasian otters used rapidly flowing upper parts of the river. In Sri Lanka the Eurasian otter was live in the headwaters of all the five river systems but not in the estuaries (de Silva 1996).

In most parts of its range, its occurrence is correlated with bank side vegetation showing importance of vegetation to otters (Mason and Macdonald 1986). Otters in different regions may depend upon differing features of the habitat, but to breed, they need holes in the river bank, cavities among tree roots, piles of rock, wood or debris. The Eurasian otters are closely connected to a linear living space. Most portion of their activity is concentrated to a narrow strip on either side of the interface between water and land (Kruuk 1995). Otter distribution in coastal areas especially the location of holts, is strongly correlated with the presence of freshwater (Kruuk et al. 1989, Beja 1992).

Within the group home range, shared by resident adult females, each had her own core area. Resident males had larger home ranges in more exposed parts of the coast which overlapped with other males and with at least two female group ranges. Male and female transients moved through group ranges, relegated to less favoured holts, habitat and food. In freshwater home ranges are longer for both sexes (Kruuk 1995). Erlinge (1969) suggested that males were hierarchical and territorial, influenced by sexual factors, while female ranges were influenced by food and shelter requirements of the family group. Green et al. (1984) and Kruuk (1995) found that adult males spent most of their time along the main rivers, whereas adult females occupied tributaries or lakes, as they did in Austria (Kranz 1995). Rosoux (1995) found no sexual differences in habitat utilization and considerable overlaps in range. Young animals usually occupied peripheral habitat, but Green and Green (1983) found differences between immature and mature young males, the later having access to all available habitat and the other restricted to marginal habitat, supplemented by visits to the main river when vacant, temporally or spatially. While males generally have larger ranges than females in the same habitat, sizes vary according to the type and productivity of the habitat, and methods of measuring ranges vary from study to study.

Like most Lutra species, fish is the major prey of Eurasian otters sometimes exceeding more than 80% of their diet (Erlinge 1969, Webb 1975, Ruiz-Olmo and Palazon 1997). In addition to fish a whole range of other prey items have been recorded in their diet in variable proportions. These include aquatic insects, reptiles, amphibians, birds, small mammals, and crustaceans (Jenkins et al. 1980, Adrian and Delibes 1987, Skaren 1993). In a study conducted in Sri Lanka, Silva (1996) reported that the overall diet of the Eurasian otters consisted of 81.2% of crab, 37.5% fish and 8.7% frog. In addition to these the diet also included small quantities of water snakes, birds, small mammals and insects.

The percentage of crab in the diet of the Eurasian otters in Sri Lanka varied from 72% to 85%, and fish from 25-31%. There was significant seasonal variation in the diet in different habitats. The relative importance of fish in the diet was significantly higher in the reservoirs and lakes than the rivers and streams. Crabs were more important to otters inhabiting streams than those inhabiting rivers and lakes. Crabs were eaten more than fish during the monsoon (de Silva, 1997). However, in Huai Kha Kheng, Thailand 76% of the spraint had fish, 64% amphibians and 7% crab (Kruuk et al. 1994). The Eurasian otter is capable of taking fish as large as 9 kg (Chanin 1985), however, many studies in Europe have revealed that the fish consumed by the Eurasian otters are relatively small with a median length of 13 cm (Kruuk 1995).

The Eurasian otter is largely solitary and the adult otters tend not to associate with other adults except for reproduction. The family group of mother and offspring is the most important unit of otter society. In Shetland, where several adult animals used the same stretch of coast, encounters between adults were rare (Kruuk 1995) and the species was strikingly non-social. Kranz (1995) found evidence of social group formation beyond the occasional associations of two or more family groups, which suggests that under some circumstances otters of all ages and sexes may form temporary mutually tolerant gatherings.

In most of its range the Eurasian otter is predominantly nocturnal (Green et al. 1984). The exception is Shetland, where otters were entirely diurnal (Kruuk 1995). Green et al. (1984) found that activity was largely circumscribed by the solar rhythm so that the duration of activity varied through the year with night length. The reverse situation was found in Shetland with activity restricted by the day length (Kruuk 1995). Some workers have found a break in activity in the middle of longer nights or days and single peak around midnight or midday in shorter nights or days, although up to four activity periods per night has been recorded. Kruuk (1995) links otter activity to that of prey species, with the favoured marine species more vulnerable in daylight and those in freshwater easier to catch at night. In coastal habitats, tidal patterns influence otter activity, with significant preference shown for feeding at low tide, both in Shetland and on the Scottish west coast (Kruuk 1995).

The Eurasian otter attains sexual maturity at around 18 months in males and 24 months in the case of females, but in captivity it is usually 3 to 4 years (Reuther 1991). They are non-seasonally polyoestrous (Trowbridge 1983), mating in captivity has been observed at all times of the year (Reuther 1999). The gestation period is approximately 63-65 days, the litter size varies from 1 to 5, and the life expectancy is around 17 years (Acharjyo and Mishra 1983).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lutra lutra forage in water and nest on land. They inhabit rivers, lakes, streams, freshwater and peat swamp forests, ricefields, ocean shores, fjords, caves, and terrestrial habitats adjacent to waterways. Covered dens and dry resting sites are found in earth tunnnels, tree roots, boulder piles, shrubs, and banks. In its territory of 1 to 4 miles, each river otter has fixed locations for getting into and out of the water, rolling, sunbathing, and sliding on "otter stairways". (Grzimek 1990, Sivasothi 1994)

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

coastal waters (but mostly in fresh water)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found by clean rivers, lakes and along coasts. Otters living on the coast also require a source of fresh water with which to clean their fur (3) in order to retain its insulating properties (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Lutra lutra individuals eat fish, crustaceans, clams, small mammals and amphibians, birds, eggs, insects, worms, and a small amount of vegetation. They use their vibrissae (whiskers) as sensing organs underwater to monitor the movements of fishes and other prey. River otters hunt and feed several times a day, consuming about 1kg of food daily. (Grzimek 1990, MacDonald 1984, Heggberget 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Lutra lutra (Lutra lutra otter) preys on:
Actinopterygii
Anguilla anguilla
Pholis gunnellus
Zoarces viviparus
Myxocephalus scorpius
Platichthys flesus
Salmo trutta

Based on studies in:
UK: Yorkshire, Aire, Nidd & Wharfe Rivers (River)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
22.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.2 years (captivity) Observations: Although it has been claimed that these animals live up to 22 years in captivity (Bernhard Grzimek 1990), this is unverified. The longevity record in captivity belongs to a female that was 18.2 years of age when she died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Lutra lutra has a continuous breeding cycle and female otters have a continuous estrus cycle. Mating can take place either in water or on land. The main mating season is from February to March and July. Gestation lasts 60 to 70 days and weaning occurs at 3 months. Each female river otter usually gives birth to 2 or 3 cubs which are 99 to 122gm at birth. The cubs' eyes open after one month and they begin to leave the nest after two months. The young stay with their mothers for up to 14 months and reach sexual maturity after 2 or 3 years. (Heggberget 1994, Grzimek 1990)

Average birth mass: 110.5 g.

Average gestation period: 61 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
548 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutra lutra

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1953-09|NC_011358|Lutra lutra| GACCGATGATTATTCTCCACGAACCATAAAGATATTGGCACCCTTTACCTTCTATTCGGTGCATGAGCCGGAATGGTAGGCACCGCCCTC---AGCCTACTAATCCGTGCAGAATTAGGCCAACCCGGCGCCCTGCTAGGAGAT---GACCAAATTTACAATGTTATTGTCACCGCCCATGCATTTGTAATAATTTTCTTTATGGTAATACCAATTATAATCGGAGGGTTTGGAAACTGACTGGTGCCCTTAATA---ATTGGCGCGCCTGATATAGCATTCCCACGAATAAATAATATGAGCTTTTGACTCCTGCCTCCATCCTTCCTTCTCCTTCTGACCTCATCTATGGTAGAAGCGGGTGCAGGGACAGGATGAACTGTGTATCCTCCTCTGGCAGGTAACCTAGCGCATGCAGGAGCATCAGTAGACCTGACAACC---TTTTCCCTGCACTTAGCAGGTGTATCATCCATTCTGGGAGCCATTAACTTTATTACTACCATTATCAACATAAAACCCCCCGCAATATCACAATACCAGACCCCATTGTTCGTATGATCCGTCCTAATTACAGCCGTACTCCTGCTCCTATCTCTACCAGTCCTAGCAGCC---GGTATTACCATGCTACTCACAGACCGAAACCTGAATACCACTTTCTTTGACCCGGCCGGAGGAGGAGACCCCGTCCTATACCAACATCTATTCTGGTTCTTCGGACATCCGGAGGTATACATCCTAATTTTACCTGGGTTCGGAATTATCTCACACGTCGTAACGTACTATTCAGGAAAAAAA---GAACCATTTGGCTATATGGGAATAGTGTGGGCGATAATATCTATCGGTTTCCTAGGCTTTATTGTATGAGCCCACCATATATTTACTGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutra lutra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ruiz-Olmo, J., Loy, A., Cianfrani, C., Yoxon, P., Yoxon, G., de Silva, P.K., Roos, A., Bisther, M., Hajkova, P. & Zemanova, B.

Reviewer/s
Hussain, S.A. & Conroy, J. (Otter Red List Authority)

Justification
This species is considered to be Near Threatened due to an ongoing population decline, but at a rate no longer exceeding 30% over the past 3 generation (criterion A2). In recent years, there is ample evidence that its population is recovering in western Europe and that the viable populations occur in the former USSR and many parts of south and southeast Asia. Given the lack of information from many parts of its range, the past declines and the sensitivity of the species to sudden changes in threats, the species was listed as Near Threatened in 2004. The concerns were also taken into account about the status of populations in the far east - China and Indo-China, because of possible over-exploitation. The Near Threatened listing was more of a precautionary approach, as it indicates that the recovery in western Europe is genuine and that the conservation actions for this species need to be sustained. Besides, there is concern about what is happening in parts of its range in Asia due increasing habitat loss and poaching. This justifies the Near Threatened of the species as this species nearly qualifies for Vulnerable under A2acd.

History
  • 2004
    Near Threatened
  • 2000
    Vulnerable
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened on the IUCN Red List 2004. Listed under CITES Appendix 1 (4), Appendix II of the Bern Convention and Annex II of the EC Habitats Directive (6). Protected in the UK by Schedule 5 of the Wildlife and Countryside Act 1981 (as amended) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In spite of several studies, the status of its population is not known from many parts of its range, particularly from Africa and Asia. The overall estimate of the population in United Kingdom was 10395 individuals in 2004 (JNCC 2007). The status of its distribution has been reviewed by Conroy and Chanin (1998) which gives a complete picture of its occurrence, though information on its abundance is lacking in this review. As far as its abundance is concerned limited information is available so as to get a clear picture of its status. In Shetland, otters averaged 1/km of shore, but each otter used several, overlapping km of shore. An estimated nine adult female produced a mean of total 5.6 litters/year. The estimated juvenile female per 100 female attaining the first reproduction was 33.7 individuals in Shetland (Kruuk et al. 1989). In central Finland between 1985 and 2003 the temporal and spatial variation in the density of otter population was 52 otters, including 16 cubs in 11 litters in an area of 1,650 km² in 2002–2003. Harris et al. (1995) estimated the density of otters in England as one adult per 27 linear km of river (1/24 km in the ‘high density’ area of Scotland. However, such information is lacking from other range countries. There is absolutely no information about its population status from Asia where it is believed to be under tremendous pressure because of poaching.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The aquatic habitats of otters are extremely vulnerable to man-made changes. Canalisation of rivers, removal of bank side vegetation, dam construction, draining of wetlands, aquaculture activities and associated man-made impacts on aquatic systems are all unfavourable to otter populations (Reuther and Hilton-Taylor 2004). In South and South East Asia, the decrease in prey species from wetlands and water ways had reduced the population to an unsustainable threshold leading to local extinctions. The poaching is one of the main cause of its decline from South and South East Asia, and possibly also from the North Asia.

Pollution is major threat to the otters in western and central Europe, the main pollutants posing a danger to otters are the organochlorines dieldrin (HEOD) and DDT/DDE, polychlorinated biphenyls (PCBs) and the heavy metal mercury. Coastal populations are particularly vulnerable to oil spills. Acidification of rivers and lakes results in the decline of fish biomass and reduces the food resources of the otters. The same effects are known to result from organic pollution by nitrate fertilisers, untreated sewage, or farm slurry.

In addition, major causes of mortality from range countries are drowning and road kills. Fyke nets set for eels or for fish as well as creels set for marine crustaceans have a great attraction to otters and a high risk to those that successfully try to enter these traps.

A further potential threat is strangulation by transparent, monofilament drift net. A potential risk comes from traps designed to kill other species, especially underwater cages constructed to drown muskrats. Illegal hunting is still a problem in many parts of their distribution range. In several European countries political pressure especially by fishermen has resulted in granting of licenses for killing otters (Reuther and Hilton-Taylor, 2004).

There is an ongoing discussion about the problem of reintroduction of otters. In recent years it is feared that it may contaminate the genetic structure of the native population (Mason 1992, Reuther 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Common otter fur was once highly prized, and for many years the species was hunted for this reason, for 'sport' and to protect fish stocks (2). Throughout most of Europe and Britain, common otter numbers declined drastically in the late 1950s and early 1960s. Habitat loss and pollution played a major part in the decline (3). Furthermore, many otherwise suitable rivers lack enough tall vegetation for otters to conceal their holts and to rest in (3). The species has a low rate of population growth due to the extended period of maternal care, the small size of litters and the short average lifespan of about 4 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Eurasian otter is strictly protected under international legislation and conventions. It is listed in Appendix I of the CITES, Appendix II of the Bern Convention, Annexes II and IV of the EU Habitats and Species Directives and Appendix I of the Bonn Convention (Convention on the Conservation of Migratory Species of Wild Animals (CMS) which recommends highest degree of protection to it. It is also listed as endangered species in many of its range countries in Asia such as India, Pakistan, Bangladesh, Myanmar, Thailand. The species is listed as Critically Endangered in Mongolian Red Books (Shagdarsuren et al. 1987).

A European Breeding Programme (EEP) for self-sustaining captive populations was started in 1985. Monitoring programmes have been established in many range states in Europe. Several reintroduction programme has been initiated in Europe such as in UK, Sweden and Netherlands which was successful in bringing back the otters into its former habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Some areas managed as 'otter havens' have been protected against human disturbance and had plenty of vegetation planted (5), building artificial holts may also help the otter (5). In some cases, reintroductions of captive bred otters to parts of the former range have been successful (3), and natural recolonisation has occurred in some areas (2). Under the EC Habitats Directive two areas have been proposed as SACs (Special Areas of Conservation) for the otter. The species action plan produced as part of the UK Biodiversity Action Plan (UK BAP) aims to maintain and expand existing populations and ensure that by the year 2010, breeding populations have been restored to all catchments and coastal areas where post-1960 records exist (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In the past river otters were considered to be the main competition of fishermen and a bounty was paid by the Swiss goverment for each otter killed. (Sivasothi 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The pelts of river otters are considered to be valuable to humans. (Grzimek 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European otter

The European otter (Lutra lutra), also known as the Eurasian otter, Eurasian river otter, common otter and Old World otter, is a European and Asian member of the Lutrinae or otter subfamily, and is typical of freshwater otters.

Contents

Description

The European otter is a typical species of the otter subfamily. Brown above and cream below, these long, slender creatures are well-equipped for their aquatic habits. This otter differs from the North American river otter by its shorter neck, broader visage, the greater space between the ears and its longer tail.[2] However, the European otter is the only otter in its range, so it cannot be confused for any other animal. Normally, this species is 57 to 95 cm (23-37 in) long, not counting a tail of 35-45 cm (14-18 in). The female is shorter than the male. [3] The otter's average body weight is 7 to 12 kg (15.4-26.4 lbs), although occasionally a large old male may reach up to 17 kg (37 lbs).[4][5] The record-sized specimen, reported by a reliable source but not verified, weighed over 24 kg (53 lbs).[6]

Range and habitat

The European otter is the most widely distributed otter species, its range including parts of Asia and Africa, as well as being spread across Europe. Though currently believed to be extinct in Liechtenstein, and Switzerland, they are now very common in Latvia, along the coast of Norway and across Great Britain, especially Shetland, where 12% of the UK breeding population exist.[7] Ireland has the highest density of Eurasian otters in Europe.[citation needed] In Italy, they can be found in the Calore River area. These creatures live in South Korea, and are endangered.

In general, their varied and adaptable diets mean they may inhabit any unpolluted body of fresh water, including lakes, streams, rivers, and ponds, as long as the food supply is adequate. European otters may also live along the coast, in salt water, but require regular access to fresh water to clean their fur. When living in the sea, individuals of this species are sometimes referred to as "sea otters", but they should not be confused with the true sea otter, a North American species much more strongly adapted to a marine existence.

Diet

Otter feeding on fish

The European otter's diet mainly consists of fish. During the winter and in colder environments, though, fish consumption is significantly lower, and the otters use other sources of food, including birds, insects, frogs, crustaceans and sometimes small mammals, including young beavers.[8]

Behavior and reproduction

Skull

European otters are strongly territorial, living alone for the most part. An individual's territory may vary between about one and 40 kilometres long (about one-half to 25 miles), with about 18 km (about 11 miles) being usual. The length of the territory depends on the density of food available and the width of the water suitable for hunting (it is shorter on coasts, where the available width is much wider, and longer on narrower rivers). The territories are only held against members of the same sex, so those of males and females may overlap.[9]Mating takes place in water. Eurasian otters are nonseasonal breeders (males and females will breed at any time of the year) and it has been found that their mating season is most likely determined simply by the otters' reproductive maturity and physiological state. Female otters are sexually mature between 18 and 24 months old and the average age of first breeding is found to be 2.5 years old. Gestation for L. lutra is 60–64 days, litter weight when being compared to the female body mass is about 10%. After the gestation period one to four pups are born, which remain dependent on the mother for about 13 months.[10] The male plays no direct role in parental care, although the territory of a female with her pups is usually entirely within that of the male.[9] Hunting mainly takes place at night, while the day is usually spent in the European otter's holt (den) – usually a burrow or hollow tree on the riverbank which can sometimes only be entered from underwater. Though long thought to hunt using sight and touch only, evidence is emerging that they may also be able to smell underwater - possibly in a similar manner to the star-nosed mole.[11][12]

Conservation

A European otter skeleton

The European otter declined across its range in the second half of the 20th century[13] primarily due to pollution from pesticides such as organochlorine (OCs) and polychlorinated biphenyls (PCBs). Other threats included habitat loss and hunting, both legal and illegal.[14] European otter populations are now recovering in many parts of Europe. In the United Kingdom the number of sites with an otter presence increased by 55% between 1994 and 2002.[citation needed] In August, 2011, the Environment Agency announced that otters had returned to every county in England since vanishing from every county except the West Country and parts of Northern England.[15] Recovery is partly due to a ban on the most harmful pesticides that has been in place across Europe since 1979,[16] partly to improvements in water quality leading to increases in prey populations, and partly to direct legal protection under the European Union Habitats Directive[17] and national legislation in several European countries.[18][19][20] In Hong Kong, it is a protected species under Wild Animals Protection Ordinance Cap 170. It is listed as Near Threatened by the 2001 IUCN Red List.[21]

References

  1. ^ Ruiz-Olmo, J., Loy, A., Cianfrani, C., Yoxon, P., Yoxon, G., de Silva, P.K., Roos, A., Bisther, M., Hajkova, P. & Zemanova, B. (2008). Lutra lutra. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 March 2009. Database entry includes justification for why this species is near threatened
  2. ^ American Natural History, by John Davidson Godman, published by Hogan & Thompson, 1836
  3. ^ Hans, Kruuk (2007). Otters ecology, behavior and conservation. Oxford University Press. ISBN 978-0-19-856587-1. 
  4. ^ [1] (2011).
  5. ^ [2] (2011).
  6. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  7. ^ "Shetland Otters". "Shetland Otters". http://www.shetlandotters.com/shetlands-otters.php. Retrieved 2010-03-15. 
  8. ^ Kitchener, Andrew (2001). Beavers. p. 144. ISBN 1-873580-55-X. 
  9. ^ a b "Territoriality of the otter Lutra lutra L." Erlinge, S. (1968), Oikos, No. 19, 81-98.
  10. ^ Hauer S., et al. "Reproductive performance of otters Lutra lutra (Linnaeus, 1758) in Eastern Germany: Low reproduction in a long-term strategy." Biological Journal of the Linnean Society. 77.3 (2002): 329-340.
  11. ^ Alleyne, Richard (2010-06-05). "Can otters smell underwater?". Daily Telegraph (London). Archived from the original on 2010-06-06. http://www.webcitation.org/5qIDV2lGC. Retrieved 2010-06-06. "Hamilton James said: “I always had an inkling that otters could smell underwater and I wanted to prove it. As it was dark and the fish was fully submerged it proved that the otters had to be using a sense other than sight or touch to locate it. After reviewing the footage I noticed a tiny bubble which hit the fish and was sniffed back in by the otter.”" 
  12. ^ Director: Richard Taylor Jones; Camera Operators: Richard Taylor Jones, Charlie Hamilton James; Producer: Philippa Forrester (2010-06-06). "Late Summer". Halcyon River Diaries. episode 4. London. BBC. BBC One. http://www.bbc.co.uk/programmes/b00sqkbv. 
  13. ^ "The Eurasian Otter (Lutra lutra)". English Nature. http://www.english-nature.org.uk/lifeinukrivers/species/otter.html. Retrieved 2010-03-15. 
  14. ^ "Otter: Background to selection". Jncc.gov.uk. http://www.jncc.gov.uk/ProtectedSites/SACSelection/species.asp?FeatureIntCode=S1355. Retrieved 2010-03-15. 
  15. ^ Michael McCarthy (2011=08-18). "Otters return to every county in England". The Independent. http://www.independent.co.uk/environment/nature/otters-return-to-every-county-in-england-2339626.html. Retrieved 2011-08-19. 
  16. ^ "Council Directive 79/117/EEC of 21 December 1978". Eur-lex.europa.eu. http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=CELEX:31979L0117:EN:HTML. Retrieved 2010-03-15. 
  17. ^ "Council Directive 92/43/EEC of 21 May 1992". Eur-lex.europa.eu. http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=CELEX:31992L0043:EN:HTML. Retrieved 2010-03-15. 
  18. ^ "Species other than birds specially protected under The Wildlife and Countryside Act, 1981: Schedule 5 (Animals)". Jncc.gov.uk. 2005-08-30. http://www.jncc.gov.uk/page-1815. Retrieved 2010-03-15. 
  19. ^ "Wildlife Act 1976 (Ireland)". Internationalwildlifelaw.org. 1976-12-22. http://www.internationalwildlifelaw.org/WILDLIFEACT1976_1.html. Retrieved 2010-03-15. 
  20. ^ Otters of the world[dead link]
  21. ^ "Lutra lutra– Near Threatened". Iucnredlist.org. http://www.iucnredlist.org/search/details.php/12419/summ. Retrieved 2010-03-15. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!