Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Range Description

This species is found in China (central and southeastern, Hainan), northeast India (Naga Hills near Manipur), northern Myanmar, northern Lao, Taiwan, and northern Viet Nam (Pocock 1941, Wilson and Reeder 2005). Southern China constitutes most of the known range (Neal 1986). There are no recent field records in Lao PDR (Duckworth et al. 1999); though, it was previously assessed as very common around Xiangkhouang and Phongsali (Osgood 1932, Delacour 1940) and it is possible that recent surveys have not used appropriate methodology to find the species. A study on the ecology of this species took place in Taohong Village, northern Jiangxi Province, about 15 km south of the Yangtze River (29º48'N, 116º40'E) (Wang and Fuller 2003). The southern extent of range into central Viet Nam, Lao PDR, Myanmar and potentially Thailand (where mapped by Storz and Wozencraft 1999, apparently predictively) requires further investigation due to confusion with other species, but it appears to go several degrees of latitude further south than is mapped in standard sources, at least in Viet Nam. The species has been found from 700 to 1,524 m in Viet Nam (Roberton et al. in prep). Records in Lao are from high elevations (Osgood 1932). In India it has been found from 50 to 2,000 m (A. Choudhury pers. comm.). In northern Myanmar it is found up to 5,000 ft (Pocock 1941). Thus, in Myanmar, Thailand, Lao PDR, Viet Nam, Cambodia and India there is continued difficulty of identifying recent records of ferret badgers to species, most of which lack skulls or or did not have the skull characters checked and were not preserved. Hence it is impossible to say anything about this species’s current distribution, status or ecology in these regions.

Melogale moschata and M. personata are very similar in external morphologically, and - and field records, including skin specimens lacking an associated skull, need to be considered as identifiable only as Melogale sp. throughout the parts its range where M. personata is known to occur or might plausibly occur, and only references to skull characteristics should be used for species- level identification. Thus, in Myanmar, Thailand, Lao PDR, Viet Nam, Cambodia and India there is continued difficulty of identifying recent records of ferret badgers to species, most of which lack skulls or or did not have the skull characters checked and were not preserved. Hence it is impossible to say anything about this species’s current distribution, status or ecology in these regions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Chinese ferret badgers (Melogale moschata) are found from Assam to central China and northern Indochina, as well as in Taiwan, and Hainar (Jones, 1982).

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

M. moschata is the smallest badger. They can weigh from 1 to 3 kg and range in length from 30 to 40 cm (Barnhart, 2001). The dorsal color has phases that vary from dark chocolate-brown, to fawn-brown, to grayish-brown. The underside can vary from white to orange. The face is black with a white forehead, which borders a dark, variable "mask." This species has a characteristic long bushy tail, large ears, and a slender body. The fur of Chinese ferret badgers is short. There usually is a stripe down the middle of the back and a spot on the crown of the head (Long, 1993). They also have elongated, strong fore claws needed for digging (Lekagul, 1977).

Range mass: 1 to 3 kg.

Range length: 30 to 40 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat use of this species in Lao PDR is unclear (Duckworth et al. 1999), as it is in the rest of South-east Asia.

This species is fossorial and lives in preexisting holes (including rodent dens, firewood stacks, open fields, and rock piles around houses (Wang and Fuller, 2003), rather than digging new ones (Taylor, 1989). It is exclusively nocturnal (Wang and Fuller, 2003) and feeds primarily on small animals such as insects, earthworms (most important part of its diet (Qian et al, 1976; Chuang and Lee, 1997), snails, frogs, and sometimes carcasses of small birds and mammals, eggs, and fruit (Chian and Sheng, 1976; Long and Killingley, 1983; Ewer, 1985; Neal, 1986; Chuang, 1994). Resting home range size was found to be 10.6 ha (Wang and Fuller, 2003).

Almost all pregnant females were found between March and October during a study on the reproduction of this species on Taiwan (Pei and Wang, 1995). Litter size is two, and evidence suggests that they breed once a year (Pein and Wang, 1995). This species is often found near human habitations (Storz and Wozencraft, 1999), taking shelter during the day, and earthworms (the most important part of its diet) are most abundant in the fertile vegetable gardens and farmland soils were this species frequently forages (Wang and Fuller, 2003). It is also sometimes invited into native huts to exterminate cockroaches and other insects (Storz and Wozencraft, 1999). Storz and Wozencraft (1999) report that it is found in tropical and subtropical forests and wooded hillsides, as well as grasslands and cultivated areas such as rice fields.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Melogale moschata live in tropical and subtropical forests, and can also be found in grasslands (Hussain, 2001).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Melogale moschata is an omnivore. The diet consists of small rodents, insects, amphibians, invertebrates, and occasionally fruit. The most important food items eaten by ferret badgers are earthworms, insects, and amphibians (Chuang and Lee, 1997; Chien et al., 1976).

Animal Foods: mammals; amphibians; insects; terrestrial worms

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Chinese ferret badgers probably affect populations of invertebrates and small mammals upon which they feed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Specific reports of predation upon ferret badgers are lacking. However, some think that because of the small size of M. moschata, they could be vulnerable to predation by larger carnivores. Chinese ferret badgers will fiercely defend themselves if attacked and also emit a strong odorous secretion from their anal glands (Jackson, 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Melogale moschata preys on:
Annelida
Insecta
Amphibia
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

In captivity, Chinese ferret badgers have been known to live up to 10 years (Jackson, 2001), and one Chinese ferret badger in captivity lived for 17 years (Jones, 1982).

Range lifespan

Status: captivity:
10 to 17 years.

Average lifespan

Status: captivity:
10.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: One wild born specimen was about 19 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of this species is not known.

Chinese ferret badgers give birth to cubs, which can be born year round, but usually arrive in late spring (May or June) and again in late fall (September and October). On average, two to three cubs make up a litter. These litters are born in burrows. The mother feeds the cubs until they are two to three months of age (Barnhart, 2001).

Breeding season: Births peak in May and June, and then again in September and October.

Range number of offspring: 2 to 3.

Average weaning age: 2-3 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average number of offspring: 2.5.

The mother cares for her cubs in a den until they are 2 to 3 months old. She protects them and provides them with milk.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melogale moschata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGATGATTATTCTCCACAAATCACAAAGATATCGGTACCCTTTACCTCTTGTTCGGCGCATGAGCTGGAATAGTAGGCACCGCCCTCAGCCTATTGATTCGTGCTGAACTAGGTCAGCCCGGTGCTCTGCTAGGGGATGACCAAATTTACAATGTAATTGTAACCGCCCACGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGCTTTGGAAACTGACTGGTACCTCTAATAATCGGGGCGCCTGATATAGCATTCCCACGAATAAATAACATAAGCTTTTGGCTTCTACCTCCTTCCTTTCTCCTTCTTCTAGCCTCCTCTATGGTAGAGGCGGGCGCAGGAACTGGATGAACCGTATACCCCCCTTTGGCAGGAAATCTAGCACATGCGGGAGCATCCGTAGACCTGACGATCTTCTCTCTACACCTGGCAGGTGTCTCATCCATTTTAGGAGCCATCAACTTTATCACCACAATTATTAACATGAAGCCCCCCGCAATATCACAATACCAGACACCCTTATTCGTATGATCTGTCCTAATTACGGCCGTACTCCTGCTTCTATCACTACCAGTACTGGCAGCCGGCATTACCATGCTACTTACGGATCGAAACCTAAACACTACTTTCTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAGCACCTGTTCTGATTTTTTGGGCACCCAGAAGTATATATCCTAATTCTGCCAGGGTTCGGGATCATTTCTCATGTTGTAACATACTACTCAGGAAAAAAGGAACCCTTTGGTTATATAGGAATAGTCTGGGCAATAATATCCATTGGCTTCCTGGGATTTATTGTATGAGCCCACCACATATTTACCGTAGGAATAGATGTCGACACACGAGCATATTTCACCTCAGCCACTATAATTATTGCTATTCCAACGGGAGTCAAAGTATTCAGCTGACTAGCTACTCTGCATGGAGGAAACATTAAATGATCGCCAGCTATACTGTGAGCCTTAGGTTTTATTTTTCTATTTACAGTGGGAGGCTTAACGGGTATTGTCCTATCAAATTCATCATTAGACATTGTTCTTCACGACACGTATTATGTGGTAGCACACTTCCACTACGTCCTTTCAATAGGAGCTGTCTTTGCAATCATAGGTGGATTCGTCCATTGATTTCCACTATTTACAGGCTATACACTAAATGACGTCTGAGCAAAAATCCACTTTACAATCATATTCGTTGGGGTAAACATAACGTTTTTTCCTCAACATTTCCTGGGCCTATCAGGCATGCCCCGACGTTATTCCGATTACCCAGACGCCTACACAACATGAAACACGGTATCTTCCATAGGCTCATTCATTTCATTAACAGCAGTAATACTAATAATCTTTATCATTTGAGAGGCTTTCGCATCCAAGCGAGAAGTACTAACAGTGGAACTCACCCCAACAAATATTGAATGACTACATGGCTGCCCTCCGCCGTATCACACGTTTGAAGAGCCAACCTACGTACTATCAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melogale moschata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W., Timmins, R.J., R., Roberton, S., Long, B., Lau, M.W.N. & Choudhury, A.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern due to its wide distribution, locally large populations in central and southern China, occurrence in a number of protected areas throughout its range, tolerance to a high degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. However, this does not exclude that the species might be at risk in the southern portion of its range.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Chinese ferret badger is listed in Schedule I part I of the Indian Wildlife (Protection) Act (Hussain 2001).

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species in general seems to be relatively common, although this can only be confirmed in areas where it does not overlap with M. personata; where it does or might overlap, there are too few properly identified records to indicate relative abundance of the two species (J.W. Duckworth in litt. 2006). However, they are seldom caught in live traps due to their wariness (Storz and Wozencraft, 1999). There are no recent field records in Lao PDR (Duckworth et al. 1999). It was previously very common around Xiangkhouang and Phongsali (Delacour 1940). There were 238 record of this species from Taiwan between 1991 to 1993 (Pei and Wang, 1995). This species is still common on Taiwan (unlike other carnivores on Taiwan, which have decreased due to widespread deterioration of natural habitat and possibly also intensive rodent control programs during the past few decades) (Wang 1986; Pei and Wang 1995). "It is a poorly understood species, despite the fact that it seems quite common (Wang and Fuller 2003)." During a survey on ecology in Taohong Village, southeastern China, 27 records of this species were reported during an 11 month period by Wang and Fuller (2003). Despite the annual average harvest of 40 individuals in an area of about 16 km², which included the study area of Wang and Fuller (2003), this species still seemed rather abundant (Wang and Fuller 2003).

Melogale moschata and personata are very similar in external morphologically - and field records, including skin specimens lacking an associated skull, need to be considered as identifiable only as Melogale sp. throughout the parts its range where M. personata is known to occur or might plausibly do so, and only references to skull characteristics should be used for species level identification.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In northeastern India the genus is hunted for food (A. Choudhury pers. comm.). In Lao PDR, parts of all badgers are used in traditional medicine (Baird 1995b), however, there is no evidence that there is a big enough demand to cause declines of ferret badgers (W. Duckworth in litt. 2006). In southern China this species has historically been one of the most important furbearers and is subjected to heavy harvest pressure (Shou, 1962; Sheng, 1993; Storz and Wozencraft 1999). Because this species does not prey on poultry or livestock, nor cause to damage to property or farm facilities, it is not threatened by humans, despite its close proximity to them (Wang and Fuller, 2003). In addition, the value of an individual pelt is not high, and the meat is eaten in some areas (Wang and Fuller, 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is likely to occur in many protected areas across its range, specifically the northern part of its range; it has not been found in many protected areas in the southern part of its range where it overlaps with Melogale personata, but given survey methodology to date, the lack of records cannot be use to infer absence of the species (W. Duckworth in litt. 2006). In India, it is protected in Schuedule 2, Part 1. This species is listed as Near Threatened on the China Red List (Wang and Xie, 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impact on humans has been noted for this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

People like these animals around because they feed on certain pest insects such as cockroaches (Nowak, 1999). Some people, such as members of the Bhotia and the Lepha tribes, encourage Chinese ferret badgers to come into their huts (Barnhart, 2001).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinese ferret-badger

The Chinese ferret-badger (Melogale moschata), also known as the small-toothed ferret-badger, is a member of the Mustelidae family. Distinctive mask-like face markings distinguish the Chinese ferret-badger from most other oriental mustelids, although the remaining members of the genus Melogale have comparable facial markings. This badger lives in burrows or crevices and is active at dusk and at night. It is a good climber and feeds on fruit, insects, small animals and worms. It is savage when alarmed and its anal secretions are foul-smelling. The female gives birth to a litter of up to 3 young in May or June.

The average body size of the Chinese ferret-badger is 33 to 43 centimetres (13 to 17 in) with a tail of 15 to 23 centimetres (5.9 to 9.1 in). It lives in grassland, open forest and tropical rainforest from north-eastern India to southern China, Taiwan and northern Indochina.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!