Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Hog badgers are distributed primarily in Southeast Asia, starting from Sikkim and northeastern China to Thailand. They are found on the Indian subcontinent and the island of Sumatra. Hog badgers do not appear to be migratory from winter to summer. They are also native to both the Palearctic and Oriental regions. There was no evidence suggesting that they are an introduced species.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Their fur color ranges from a dark grey to brown, while tail color ranges from white to a light yellow. Two dark stripes are found on the face, and the throat is white in color. The most notable feature is the "pig-like snout" that is used for feeding, along with modified teeth specifically used to move soil. Tail lengths range from 12 cm to 17 cm (120 mm to 170 mm). Another notable feature used to distinguish hog badgers from the closely related Eurasian badgers is the color of their claws. Hog badgers have light-colored claws whereas Eurasian badgers have dark claws. To distinguish between hog badgers, Sumatran hog badgers, and northern hog badgers, there is a difference in skull shape and size. No information was found on the basal metabolic rate of hog badgers. However, Eurasian badgers (a closely related group), have a basal metabolic rate of 1,323 kJ per day. Also, there was little information on sexual dimorphism in hog badgers other than males are larger than females.

Range mass: 7 to 14 kg.

Range length: 55 to 70 cm.

Sexual Dimorphism: male larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hog badgers are found in grasslands, hills, mountains, tropical rainforests, tropical evergreen, and semi-evergreen forests.

Range elevation: 0 to 3,500 m.

Average elevation: 2,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; mountains

Other Habitat Features: agricultural

  • Timmins, R., B. Long, J. Duckworth, W. Ying-Xiang, T. Zaw. 2008. "Encyclopedia of Life" (On-line). Arctonyx collaris. Accessed August 15, 2012 at http://eol.org/pages/328030/details.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Hog badgers feed on a variety of things based on what is available ranging from plants to worms to small mammals. It is therefore considered an omnivore. It is able to find food using its adapted pig like snout to sense smells. They dig in the ground using their snout, incisors, and canine teeth of their lower jaws. They will also eat fruit, roots and tubers. Its favorite food appears to be terrestrial earthworms.

Animal Foods: mammals; insects; terrestrial worms

Plant Foods: roots and tubers; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore , Vermivore); herbivore (Frugivore ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

There is little to no known information on the impact of hog badgers on their surrounding ecosystem. However, due to their foraging behaviors, they play some role in controlling the populations of invertebrates. Also, they aerate the soil by digging. Another interesting role they play is creating a habitat for other small animals through abandoned hog badger burrows.

Ecosystem Impact: creates habitat; soil aeration

Species Used as Host:

  • palm civets (Paradoxurus Hermaphroditus)

Mutualist Species:

  • sables (Martes zibellina)

Commensal/Parasitic Species:

  • SARS-CoV-like virus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hog badgers are well suited predators as they possess big claws, strong jaws, flexible skin and nasty tempers. Their coloration pattern is aposematic, meaning it has distinct coloration or patterns to warn other organisms it is dangerous and should be left alone. Hog badgers are great diggers, and can dig out of sight if it feels threatened. Also, they can produce secretions from their anal glands, but it is unknown whether or not that is a defense mechanism. Their only known predators are tigers and leopords.

Known Predators:

  • tigers (Panthera tigris)
  • leopards (Panthera pardus)

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arctonyx collaris preys on:
Annelida
Insecta
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Arctonyx collaris is prey of:
Panthera pardus
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

There is no information known about the communication patterns for hog badgers. However, it is suggested that tactile communication and communication via scents may be used as seen in other species of belonging to the badgers, otters, weasels family.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no information known for the lifespan of hog badgers in the wild. However, in captivity the average lifespan is 14 years old.

Range lifespan

Status: captivity:
15.8 (high) years.

Average lifespan

Status: captivity:
14 years.

Average lifespan

Status: captivity:
13.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (captivity) Observations: There is usually a delayed implantation. Although females may be pregnant for up to 10 months, the postimplantation gestation period takes about 6 weeks.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little information known on the mating system for hog badgers. However, there is some information about the badgers, otters, weasels family. Males begin their sexual seasons before the females, and therefore, initiate breeding. This is often done by first obtaining territory.

The breeding period occurs from April to September, with the gestation period being 5 to 9.5 months long. Their litter size is 2 to 4 cubs. Although there is no information known about the sexual maturity of the two sexes, the information about the badgers, otters, weasels family offers some insight about what might occur for hog badgers, as well. For the badgers, otters, weasels family, females reach sexual maturity after 2 to 3 months, whereas the males do not reach sexual maturity until they are a year old. Also, there is little to know of the time of independence in hog badgers. However, American badgers (a similar species) have a time of independence of 5 to 6 months.

Breeding interval: Hog badgers breed once yearly during warmer months.

Breeding season: Hog badgers mate from April to September.

Range number of offspring: 2 to 4.

Range gestation period: 5 to 9.5 months.

Average weaning age: 4 months.

Range time to independence: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 2 to 3 months.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation

Average birth mass: 58 g.

Average number of offspring: 3.

Females are the primary caretakers of the young, and wean them for up to 4 months. Currently no information is available regarding specifics of parental care.

Parental Investment: female parental care ; pre-fertilization; pre-hatching/birth; pre-weaning/fledging; pre-independence

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonyx collaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAATCGATGACTATTTTCCACAAATCATAAAGATATCGGCACCCTTTACCTTCTATTTGGTGCATGAGCTGGAATAGTAGGTACTGCTCTTAGCTTACTAATTCGCGCCGAATTAGGTCAACCCGGTACTTTAATAGGAGATGATCAGATCTACAACGTAGTCGTGACAGCCCATGCATTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGTTTCGGAAACTGACTAGTCCCCCTAATAATTGGCGCACCCGACATAGCTTTTCCTCGAATAAATAATATAAGTTTCTGACTCCTACCCCCCTCCTTTCTGCTTCTCTTGGCCTCTTCCATAGTAGAAGCAGGCGCAGGAACAGGGTGGACTGTATATCCTCCTCTAGCAGGAAACTTAGCGCATGCAGGAGCATCTGTGGATATAACAATCTTCTCCCTTCATTTAGCAGGTGTTTCGTCCATCCTAGGAGCTATTAATTTTATTACTACTATTATTAACATAAAACCTCCTGCAATATCACAATATCAAACCCCCCTGTTCGTGTGATCTGTCCTAGTTACAGCTGTGCTATTACTTCTATCACTACCAGTCCTAGCAGCTGGTATTACCATATTACTAACAGACCGAAACCTAAATACAACCTTCTTCGATCCTGCCGGAGGAGGAGACCCTATTCTTTACCAACATTTATTCTGATTTTTTGGACACCCTGAAGTATATATCCTAATCCTACCAGGATTTGGAATTATTTCACATGTAGTCACTTATTACTCAGGAAAAAAAGAACCATTTGGTTATATAGGAATGGTTTGAGCAATAATATCCATCGGTTTCTTAGGATTTATTGTATGAGCCCATCATATATTTACTGTAGGAATAGACGTCGACACACGAGCATACTTCACTTCAGCTACCATAATTATTGCTATCCCCACAGGAGTTAAAGTGTTTAGTTGACTAGCCACTTTACATGGGGGGAATATTAAATGATCTCCAGCTATGCTATGAGCCCTAGGGTTTATCTTTCTATTCACAGTAGGTGGCCTAACAGGTATCGTCCTATCAAACTCGTCCCTAGATATTGTTCTTCATGACACATACTACGTGGTAGCTCATTTCCATTATGTCCTCTCAATGGGAGCAGTTTTCGCGATCATAGGTGGGTTCGTTCATTGATTCCCATTATTCACAGGATATACGCTAAATGATGTTTGAGCAAAAATTCACTTTACAATCATATTTGTAGGAGTAAATACCACATTCTTTCCACAACATTTCCTAGGTTTATCAGGCATACCTCGACGATACTCCGATTACCCAGATGCCTACACAGCATGAAACACAATCTCCTCTATAGGCTCATTTATTTCATTAACAGCAGTAATACTAATAATTTTCATAGTTTGAGAAGCCTTCGCATCCAAACGAGAAGTACTAACGGTAGAACTCACCTCAACAAACATTGAATGATTACATGGATGCCCTCCTCCATACCACACATTTGAAGAGCCAGCCTATGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctonyx collaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Hog badgers, in 1996, were listed least concerned. However, their population is decreasing, and they are currently listed as near threatened. In Thailand and India, they are under high protected statuses under law. They are threatened due to the use of hunting dogs in all of Indochina.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There is no known adverse effects of hog badgers on humans. However, its relatives, Eurasian badgers, have been known to carry bovine tuberculosis. There is a possibility that hog badgers could also carry diseases common to livestock. Hog badgers and Eurasian badgers have a similar diet and have been known to damage crops.

Negative Impacts: crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is little known evidence to suggest a positive benefit to humans from hog badgers. However, some groups in India eat hog badgers, and they are hunted and farmed for food in China. In Lao, taste preference for hog badgers varies among ethnic groups. Some groups do not care for their meat, whereas groups in parts of the Nam Theun basin seek them for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hog badger

The hog badger (Arctonyx collaris) is a terrestrial mustelid that is widespread in Central and Southeast Asia. It is listed as Near Threatened in the IUCN Red List of Threatened Species as its occurrence is patchy. The population is thought to be declining due to high levels of exploitation.[2]

Characteristics[edit]

It has medium-length brown hair, stocky body, white throat, two black stripes on an elongated white face and a pink, pig-like snout. The head-and-body length is 55–70 cm (22–28 in), the tail measures 12–17 cm (4.7–6.7 in) and the body weight is 7–14 kg (15–31 lb).[3]

Its appearance generally resembles the European badger, but it is generally smaller, with larger claws on the front feet. Its tail has long white hairs, and its front feet have white claws.

Distribution and habitat[edit]

Hog badgers are considered fairly common in Thailand and in tropical evergreen forests and grasslands of the Terai in north-eastern India. They occur in Indochina and in southern China.[2] Their distribution in Myanmar is considered patchy.[4] In the Indonesian island of Sumatra, hog badgers occur primarily above 2,000 m (6,600 ft) with one record at 700 m (2,300 ft).[5] There is one isolated record in eastern Mongolia.[6]

The following subspecies are recognized:[1]

  • Greater hog badger A. c. collaris (Cuvier, 1825) – lives in the Eastern Himalayas;[7]
  • Northern hog badger A. c. albogularis (Blyth, 1853) – occurs in southern China northwards to Shensi;[7]
  • Chinese hog badger A. c. leucolaemus (Milne-Edwards, 1867) – occurs in northern China from southern Kansu to Chihli;[7]
  • Sumatran hog badger A. c. hoevenii (Hubrecht, 1891) – lives in Sumatra;
  • Indochinese hog badger A. c. dictator (Thomas, 1910) – lives in southern Thailand and Indochina;[7]
  • Burmese hog badger A. c. consul (Pocock, 1940) – occurs from Assam to Myanmar.[7]

Ecology and behavior[edit]

The hog badger is active by day and not very wary of humans.[8] Analysis of numerous camera trap pictures from Myanmar show no peak activity at either day or night.[9]

The hog badger is omnivorous, its diet consists of fruits, roots and small animals.

References[edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 532–628. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Timmins, R.J., Long, B., Duckworth, J.W., Wang Ying-Xiang and Than Zaw (2008). "Arctonyx collaris". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  3. ^ Boitani, L. (1984). Simon & Schuster's Guide to Mammals. Touchstone. ISBN 978-0-671-42805-1
  4. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
  5. ^ Holden, J. (2006). Small carnivores in central Sumatra. Small Carnivore Conservation 34/35: 35–38.
  6. ^ Stubbe, M., Stubbe, A., Ebersbach, H., Samjaa, R. and Doržraa, O. (1998). Die Dachse (Melinae/Mustelidae) der Mongolei. Beiträge zur Jagd- und Wildforschung 23: 257–262.
  7. ^ a b c d e Ellerman, J. R. and Morrison-Scott, T. C. S. (1966). Checklist of Palaearctic and Indian mammals 1758 to 1946. Second edition. British Museum of Natural History, London. Pages 274–275.
  8. ^ Duckworth, J. W., Salter, R. E. and Khounbline, K. (1999). Wildlife in Lao PDR: 1999 Status Report. IUCN, Vientiane, Laos.
  9. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!