Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Range Description

The hog badger occurs in Central to Southeast Asia. It is found in Mongolia, India (Sikkim, Terai, Assam, Arunacha Pradesh), throughout southern China, Indochina (Viet Nam, Lao PDR and Cambodia), Myanmar, in Indonesia (Sumatra), throughout Thailand and possibly in Perak, Malaysia (Lekagul and McNeely 1977; Duckworth 1997; Pocock 1941; Holden 2006; Roberton et al. in prep.; Than Zaw et al. in press). There is one isolated record in eastern Mongolia (Aimak Dornod) (Stubbe et al. 1998). According to Holden (2006) in Sumatra the hog badger appears to occur primarily above 2,000 m with one record at 700 m, and historical records also indicate a montane range (Miller 1942). Corbet and Hill's (1992) map suggest that on Sumatra the species is restricted to the southern part of the island, whereas, in fact, individuals have been found in many mountainous locations in the north as well (van Strien 2001).

In Lao PDR, most recent records are from the central part of the country, with some from the north, although historic records come also from the south (Duckworth 1997, Duckworth et al. 1999). There are recent indirect reports (unsubstantiated villager reports) from many survey areas in Lao PDR, but few documented records (R.J. Timmins and J.W. Duckworth pers. comm. 2006); in aggregate, these suggest that this species was present in the recent past, but has more or less been hunted out from quite wide areas (J.W. Duckworth in litt. 2006). Deuve (1972) considered that the species occurred in the southern region of Lao PDR, listing several lowland sites; however, Deuve’s Lao range information is often faulty (e.g. Timmins and Duckworth 1999), so this cannot be taken as complete confirmation the animal was formerly widespread in Lao lowlands. All seven records in 1992-1996 were from in and around the Nam Theun catchment at sites above 500 m (Duckworth 1997), while both historical sites listed by Delacour (1940) are in mountainous areas: Phongsali and the Bolaven Plateau. The post-1996 records are also from hills and mountains (Duckworth et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Hog badgers, Arctonyx collaris, have a wide distribution in southeast Asia. This distribution is mostly tropical. The species os found from Sikkim and northeastern China to Thailand. To the west, its range is bounded by the Indian subcontinent. Hog badgers also are found on the island of Sumatra (Nowak, 1999; Ernest, 1977; Ernest, 1986; Jackson, 2001; Long et al., 1983).

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

A. collaris is very similar in size and build to Meles meles, a Eurasian badger. Hog badgers are typically 550 mm to 700 mm in length, and have tails 120 mm to 170 mm long. Weight ranges from 7 to 14 kg.

Fur on the body is yellowish to grey, although the feet and belly are black. Black eye stripes run from the nose to the ears. There are also stripes that run from the mouth to the main stripe. The black stripes are contrasted by white fur on the head. As with Meles, the coloration pattern has been interpreted to be a warning to potential enemies that this creature should be left undisturbed.

A. collaris has long, pale-colored claws, a useful distinction from Meles, which has dark claws. Hog badgers also have a pig-like snout, which has a patch of naked skin at its tip.

(Nowak, 1999; Ernest, 1977; Ernest, 1986; Jackson, 2001; Long et al., 1983).

Range mass: 7 to 14 kg.

Range length: 550 to 700 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The hog badger is active by day, terrestrial, and not very wary of humans (Duckworth et al. 1999). This species if
often referred to as nocturnal, however, analysis of numerous camera-trap pictures from Myanmar show no peak at either day or night; it can be active at any time (Than Zaw et al. in press). It is usually found in forested areas as high as 3,500 m, and it feeds on “tubers, roots, earthworms, insects, and other small living creatures” (Lekagul and McNeely 1977). Wang and Fuller (2003) conducted a study on the food habits of this species in a rural agricultural area of southeastern China (Taohong Village, Jiangxi Province), and found that this species ate more mammals and gastropods than other species studied. Little is known about its breeding habits, though litter size seems to be two to three young, and individuals have lived up to seven years in captivity (Lekagul and McNeely 1977).

In Lao PDR, the hog badger is found in forested areas, and mainly now on hills and mountains (Duckworth et al. 1999), however, this altitudinal restriction may be a secondary effect of overhunting. In contrast to Lao PDR, this species in Cambodia occurs in level lowlands, in mosaics of deciduous and semi-evergreen forests, which is a further line of supposition that its current Lao distribution reflects anthropogenic restriction.

In India, this species is fairly common within grassland habitats of Terai, as well as in dense, tropical evergreen and semi-evergreen forests, and tall grassland -woodland mosaic. In Thailand it is also found in rubber plantations adjacent to forests (B. Kanchanaska pers. comm.). In Myanmar, the hog badger has been recorded in forest including bamboo stands under tree cover (Than Zaw et al. in press), and it is also found in limestone forests in Viet Nam (Roberton et al. in prep.). It mainly occurs in upper montane forest in Sumatra (Holden 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A. collaris prefers forested areas along with lowland jungles. Hog badgers have been observed to inhabitat areas up to 3,500 m in elevation, and use a wide array of habitat types throughout southeast Asia, including grasslands and agricultural areas (Nowak, 1999; Ernest, 1977; Ernest, 1986; Jackson, 2001; Long et al., 1983).

Range elevation: 0 to 3,500 m.

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest ; mountains

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

A. collaris will eat just about anything, including worms, invertebrates, fruits, and roots. It forages for food using its sense of smell. Hog badgers use their snouts, incisors, and the canine teeth of the lower jaw to root in the ground much like a pig. Hog badgers will eat other small animals (such as small mammals) if given the opportunity. However, as with Eurasiam badgers, their favorite food appears to be earthworms. (Nowak, 1999; Ernest, 1977; Ernest, 1986; Jackson, 2001; Long et al., 1983).

Animal Foods: mammals; insects; terrestrial worms

Plant Foods: roots and tubers; fruit

Primary Diet: carnivore (Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Not much is known about roles that A. collaris plays in the ecosystem. Becuase of their dietary habits, these badgers likely play some role in regulating populations of invertebrates. They dig into the soil, so they contribute to aeration of the soil. To the extent that other small animals use abandoned burrows, they create habitat.

Ecosystem Impact: soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

A. collaris has big claws, strong jaws, thick and flexible loose skin, and a nasty disposition. All of thes attributes help hog badgers fend off predators. Their coloration pattern is though to be aposematic--a warning that they are dangerous and should be left alone (Nowak, 1999). Hog badgers are good diggers, and can dig out of sight if threatend. Like other mustelids, they can also produce secretions from their anal glands, but it is not known if this is used as a defense mechanism (Jackson, 2001).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arctonyx collaris preys on:
Annelida
Insecta
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Arctonyx collaris is prey of:
Panthera pardus
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication patterns in A. collaris have not been documented. They likely involve scents, as well as vocalizations and some tactile communication, as in other species of mustelid.

Communication Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Not much is known about the lifespan of A. collaris in the wild. However, in captivity one hog badger reached 13 years 11 months of age (Jackson, 2001; Nowak, 1999).

Range lifespan

Status: captivity:
14 (high) years.

Average lifespan

Status: captivity:
13.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (captivity) Observations: There is usually a delayed implantation. Although females may be pregnant for up to 10 months, the postimplantation gestation period takes about 6 weeks.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system and behavior of this species is not known.

Not much is known about the reproductive behavior of A. collaris. In the wild, the young are born in a burrow and litter sizes typically range from 2 to 4 cubs (Ernest, 1977; Ernest, 1986; Jackson, 2001; Long et al., 1983). Mating occurs in May, and births occur the following February or March, indicating a pregancy length of 10 months. This has suggested a period of delayed implantation, as is found in Eurasian badgers, Meles meles (Nowak, 1999). Weaning apparently occurs around four months of age (Nowak, 1999).

In captivity, young hog badgers reach adult size around 7.5 months of age. Mating at the Toronto zoo was observed throughout the spring and summer months, although birth of a litter occurred the following February. Delayed implantation was again suspected, and the actual gestation was estimated as 6 weeks. This is also about the duration of embyonic development in M. meles, which ranges from 6 to 8 weeks. The female hog badger at the Toronto zoo produced litters during each of two successive years. (Nowak, 1999)

Breeding season: Breeding appears to occur in May, with births occurring the following February or March.

Range number of offspring: 2 to 4.

Average gestation period: 10 months.

Average weaning age: 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 58 g.

Average gestation period: 42 days.

Average number of offspring: 3.

Females of this species nurse their young for about 4 months (Nowak, 1999).

Parental Investment: female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonyx collaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAATCGATGACTATTTTCCACAAATCATAAAGATATCGGCACCCTTTACCTTCTATTTGGTGCATGAGCTGGAATAGTAGGTACTGCTCTTAGCTTACTAATTCGCGCCGAATTAGGTCAACCCGGTACTTTAATAGGAGATGATCAGATCTACAACGTAGTCGTGACAGCCCATGCATTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGTTTCGGAAACTGACTAGTCCCCCTAATAATTGGCGCACCCGACATAGCTTTTCCTCGAATAAATAATATAAGTTTCTGACTCCTACCCCCCTCCTTTCTGCTTCTCTTGGCCTCTTCCATAGTAGAAGCAGGCGCAGGAACAGGGTGGACTGTATATCCTCCTCTAGCAGGAAACTTAGCGCATGCAGGAGCATCTGTGGATATAACAATCTTCTCCCTTCATTTAGCAGGTGTTTCGTCCATCCTAGGAGCTATTAATTTTATTACTACTATTATTAACATAAAACCTCCTGCAATATCACAATATCAAACCCCCCTGTTCGTGTGATCTGTCCTAGTTACAGCTGTGCTATTACTTCTATCACTACCAGTCCTAGCAGCTGGTATTACCATATTACTAACAGACCGAAACCTAAATACAACCTTCTTCGATCCTGCCGGAGGAGGAGACCCTATTCTTTACCAACATTTATTCTGATTTTTTGGACACCCTGAAGTATATATCCTAATCCTACCAGGATTTGGAATTATTTCACATGTAGTCACTTATTACTCAGGAAAAAAAGAACCATTTGGTTATATAGGAATGGTTTGAGCAATAATATCCATCGGTTTCTTAGGATTTATTGTATGAGCCCATCATATATTTACTGTAGGAATAGACGTCGACACACGAGCATACTTCACTTCAGCTACCATAATTATTGCTATCCCCACAGGAGTTAAAGTGTTTAGTTGACTAGCCACTTTACATGGGGGGAATATTAAATGATCTCCAGCTATGCTATGAGCCCTAGGGTTTATCTTTCTATTCACAGTAGGTGGCCTAACAGGTATCGTCCTATCAAACTCGTCCCTAGATATTGTTCTTCATGACACATACTACGTGGTAGCTCATTTCCATTATGTCCTCTCAATGGGAGCAGTTTTCGCGATCATAGGTGGGTTCGTTCATTGATTCCCATTATTCACAGGATATACGCTAAATGATGTTTGAGCAAAAATTCACTTTACAATCATATTTGTAGGAGTAAATACCACATTCTTTCCACAACATTTCCTAGGTTTATCAGGCATACCTCGACGATACTCCGATTACCCAGATGCCTACACAGCATGAAACACAATCTCCTCTATAGGCTCATTTATTTCATTAACAGCAGTAATACTAATAATTTTCATAGTTTGAGAAGCCTTCGCATCCAAACGAGAAGTACTAACGGTAGAACTCACCTCAACAAACATTGAATGATTACATGGATGCCCTCCTCCATACCACACATTTGAAGAGCCAGCCTATGTACTATCAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctonyx collaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Long, B., Duckworth, J.W., Wang Ying-Xiang & Than Zaw

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Near Threatened as it is undergoing a population decline but globally this is not believed to be at a rate sufficient to qualify for A2cd (i.e.<30% over 3 generations) at this time. Even though it is widespread, it is severely threatened in some areas (Lao, Viet Nam, southeastern China and perhaps Myanmar) by exploitation, which occurs at high levels, and field status surveys reveal that the species is now occurring only patchily and overall rather rarely in these countries. More research and monitoring particularly in northeast India, Cambodia and Myanmar is needed to quantitatively determine the affect of exploitation on the population. This species should be periodically reassessed for the Red List in light of ongoing threats and uncertainty about range-wide levels of exploitation and the effects these are having on wild populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is no information available on conservation of A. collaris. The species is not listed by CITES or by IUCN.

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
opulation trends for the hog badger may vary across its range. In Lao PDR, this species can be locally common, as indicated by its presence during most surveys in and around the Nam Theun catchment (Duckworth et al. 1999). The lack of sightings elsewhere indicates that this species is either naturally patchy in abundance or under widespread decline (Duckworth et al. 1999). Occurrence in Myanmar is also patchy without obvious natural explantion (Than Zaw et al. in press). In Thailand, it is fairly common and found in both the north and the south (B. Kanchanaska pers. comm.). It is also very common in the high montane zone of Sumatra (Holden 2006), and in southwestern and eastern Cambodia (J. L. Walston and R. J. Timmins pers. comm.). In India, this species is fairly common in Terai. The hog badger is historically widespread in Viet Nam, but sightings seem to be declining (Roberton et al. in prep.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Major threats to the hog badger are hunting by dogs as well as snaring, primarily for human consumption and as bycatch. In Lao, the palatability of hog badger varies among ethnic groups, with some groups disliking the taste, whereas groups in parts of the Nam Theun basin (and perhaps widely elsewhere) seek the species specifically for food (J. Baker pers. comm. and J. Chamberlain per. comm. in Duckworth et al. 1999). This species is also eaten by some groups in India, and is hunted as well as farmed for food in China (M.W.N. Lao pers. comm.). Field surveys in China generated very few records of wild animals in Southeastern China (M.W.N. Lao pers. comm.), and the species is also hunted at the local level in Viet Nam (Roberton et al. in prep.). In all of Indochina, this species is threatened by the use of hunting dogs (J. Baker pers. comm. 1999).

The snaring intensity in Cambodia is considerably lower than that in Lao PDR and Viet Nam, and the relatively larger number of recent records from Cambodia than from Viet Nam and Lao PDR is strong indirect evidence that trapping levels are driving reductions in these latter countries. In Viet Nam and presumably elsewhere, gun-hunting poses another threat to the species (Timmins et al. 1999).

While threats similar to those in Lao PDR and Viet Nam are known to exist in Thailand, it is generally thought that the hunting is operating at much lower intensities and are therefore not as serious. In Sumatra as well, the threats are minimal, because the zone of occurrence is above where the majority of hunting takes place (Holden 2006)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Throughout its range, this species is found in a number of protected areas. In Thailand this species is protected by law, and in India this species is protected under the highest level of protection. It is not protected in Viet Nam or Cambodia and is the largest-bodied unprotected mammal, except for Euraisan Wild Hog Sus scrofa, in Myanmar (Than Zaw et al. in press). The China Red List has listed the hog badger as Vulnerable under C1 and A2c.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no information on how A. collaris adversely affects humans. The Eurasian badger, however, is known to carry bovine tuberculosis (Nowak, 1999). It is possible that hog bagers also carry diseases common to livestock. Eurasian badgers, which have a diet very like that of hog badgers, are also known to damage crops (Nowak, 1999), and it is likely that A. collaris is similar in that regard.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There is no information on the benefits of A. collaris for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hog badger

The hog badger (Arctonyx collaris) is a terrestrial mustelid that is widespread in Central and Southeast Asia. It is listed as Near Threatened in the IUCN Red List of Threatened Species as it is occurring only patchily. The population is thought to be declining due to high levels of exploitation.[2]

Characteristics[edit]

It has medium-length brown hair, stocky body, white throat, two black stripes on an elongated white face and a pink, pig-like snout. The head-and-body length is 55–70 cm (22–28 in), the tail measures 12–17 cm (4.7–6.7 in) and the body weight is 7–14 kg (15–31 lb).[3]

Its appearance generally resembles the European badger, but it is generally smaller, with larger claws on the front feet. Its tail has long white hairs, and its front feet have white claws.

Distribution and habitat[edit]

Hog badgers are considered fairly common in Thailand and in tropical evergreen forests and grasslands of the Terai in north-eastern India. They occur in Indochina and in southern China.[2] Their distribution in Myanmar is considered patchy.[4] In the Indonesian island of Sumatra, hog badgers occur primarily above 2,000 m (6,600 ft) with one record at 700 m (2,300 ft).[5] There is one isolated record in eastern Mongolia.[6]

The following subspecies are recognized:[1]

  • Greater hog badger A. c. collaris (Cuvier, 1825) – lives in the Eastern Himalayas;[7]
  • Northern hog badger A. c. albogularis (Blyth, 1853) – occurs in southern China northwards to Shensi;[7]
  • Chinese hog badger A. c. leucolaemus (Milne-Edwards, 1867) – occurs in northern China from southern Kansu to Chihli;[7]
  • Sumatran hog badger A. c. hoevenii (Hubrecht, 1891) – lives in Sumatra;
  • Indochinese hog badger A. c. dictator (Thomas, 1910) – lives in southern Thailand and Indochina;[7]
  • Burmese hog badger A. c. consul (Pocock, 1940) – occurs from Assam to Myanmar.[7]

Ecology and behavior[edit]

The hog badger is active by day and not very wary of humans.[8] Analysis of numerous camera trap pictures from Myanmar show no peak activity at either day or night.[9]

The hog badger is omnivorous, its diet consists of fruits, roots and small animals.

References[edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 532–628. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Timmins, R.J., Long, B., Duckworth, J.W., Wang Ying-Xiang and Than Zaw (2008). "Arctonyx collaris". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  3. ^ Boitani, L. (1984). Simon & Schuster's Guide to Mammals. Touchstone. ISBN 978-0-671-42805-1
  4. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
  5. ^ Holden, J. (2006). Small carnivores in central Sumatra. Small Carnivore Conservation 34/35: 35–38.
  6. ^ Stubbe, M., Stubbe, A., Ebersbach, H., Samjaa, R. and Doržraa, O. (1998). Die Dachse (Melinae/Mustelidae) der Mongolei. Beiträge zur Jagd- und Wildforschung 23: 257–262.
  7. ^ a b c d e Ellerman, J. R. and Morrison-Scott, T. C. S. (1966). Checklist of Palaearctic and Indian mammals 1758 to 1946. Second edition. British Museum of Natural History, London. Pages 274–275.
  8. ^ Duckworth, J. W., Salter, R. E. and Khounbline, K. (1999). Wildlife in Lao PDR: 1999 Status Report. IUCN, Vientiane, Laos.
  9. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!