Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Hog badgers are distributed primarily in Southeast Asia, starting from Sikkim and northeastern China to Thailand. They are found on the Indian subcontinent and the island of Sumatra. Hog badgers do not appear to be migratory from winter to summer. They are also native to both the Palearctic and Oriental regions. There was no evidence suggesting that they are an introduced species.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The hog badger occurs in Central to Southeast Asia. It is found in Mongolia, India (Sikkim, Terai, Assam, Arunacha Pradesh), throughout southern China, Indochina (Viet Nam, Lao PDR and Cambodia), Myanmar, in Indonesia (Sumatra), throughout Thailand and possibly in Perak, Malaysia (Lekagul and McNeely 1977; Duckworth 1997; Pocock 1941; Holden 2006; Roberton et al. in prep.; Than Zaw et al. in press). There is one isolated record in eastern Mongolia (Aimak Dornod) (Stubbe et al. 1998). According to Holden (2006) in Sumatra the hog badger appears to occur primarily above 2,000 m with one record at 700 m, and historical records also indicate a montane range (Miller 1942). Corbet and Hill's (1992) map suggest that on Sumatra the species is restricted to the southern part of the island, whereas, in fact, individuals have been found in many mountainous locations in the north as well (van Strien 2001).

In Lao PDR, most recent records are from the central part of the country, with some from the north, although historic records come also from the south (Duckworth 1997, Duckworth et al. 1999). There are recent indirect reports (unsubstantiated villager reports) from many survey areas in Lao PDR, but few documented records (R.J. Timmins and J.W. Duckworth pers. comm. 2006); in aggregate, these suggest that this species was present in the recent past, but has more or less been hunted out from quite wide areas (J.W. Duckworth in litt. 2006). Deuve (1972) considered that the species occurred in the southern region of Lao PDR, listing several lowland sites; however, Deuve’s Lao range information is often faulty (e.g. Timmins and Duckworth 1999), so this cannot be taken as complete confirmation the animal was formerly widespread in Lao lowlands. All seven records in 1992-1996 were from in and around the Nam Theun catchment at sites above 500 m (Duckworth 1997), while both historical sites listed by Delacour (1940) are in mountainous areas: Phongsali and the Bolaven Plateau. The post-1996 records are also from hills and mountains (Duckworth et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Their fur color ranges from a dark grey to brown, while tail color ranges from white to a light yellow. Two dark stripes are found on the face, and the throat is white in color. The most notable feature is the "pig-like snout" that is used for feeding, along with modified teeth specifically used to move soil. Tail lengths range from 12 cm to 17 cm (120 mm to 170 mm). Another notable feature used to distinguish hog badgers from the closely related Eurasian badgers is the color of their claws. Hog badgers have light-colored claws whereas Eurasian badgers have dark claws. To distinguish between hog badgers, Sumatran hog badgers, and northern hog badgers, there is a difference in skull shape and size. No information was found on the basal metabolic rate of hog badgers. However, Eurasian badgers (a closely related group), have a basal metabolic rate of 1,323 kJ per day. Also, there was little information on sexual dimorphism in hog badgers other than males are larger than females.

Range mass: 7 to 14 kg.

Range length: 55 to 70 cm.

Sexual Dimorphism: male larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hog badgers are found in grasslands, hills, mountains, tropical rainforests, tropical evergreen, and semi-evergreen forests.

Range elevation: 0 to 3,500 m.

Average elevation: 2,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; mountains

Other Habitat Features: agricultural

  • Timmins, R., B. Long, J. Duckworth, W. Ying-Xiang, T. Zaw. 2008. "Encyclopedia of Life" (On-line). Arctonyx collaris. Accessed August 15, 2012 at http://eol.org/pages/328030/details.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The hog badger is active by day, terrestrial, and not very wary of humans (Duckworth et al. 1999). This species if
often referred to as nocturnal, however, analysis of numerous camera-trap pictures from Myanmar show no peak at either day or night; it can be active at any time (Than Zaw et al. in press). It is usually found in forested areas as high as 3,500 m, and it feeds on “tubers, roots, earthworms, insects, and other small living creatures” (Lekagul and McNeely 1977). Wang and Fuller (2003) conducted a study on the food habits of this species in a rural agricultural area of southeastern China (Taohong Village, Jiangxi Province), and found that this species ate more mammals and gastropods than other species studied. Little is known about its breeding habits, though litter size seems to be two to three young, and individuals have lived up to seven years in captivity (Lekagul and McNeely 1977).

In Lao PDR, the hog badger is found in forested areas, and mainly now on hills and mountains (Duckworth et al. 1999), however, this altitudinal restriction may be a secondary effect of overhunting. In contrast to Lao PDR, this species in Cambodia occurs in level lowlands, in mosaics of deciduous and semi-evergreen forests, which is a further line of supposition that its current Lao distribution reflects anthropogenic restriction.

In India, this species is fairly common within grassland habitats of Terai, as well as in dense, tropical evergreen and semi-evergreen forests, and tall grassland -woodland mosaic. In Thailand it is also found in rubber plantations adjacent to forests (B. Kanchanaska pers. comm.). In Myanmar, the hog badger has been recorded in forest including bamboo stands under tree cover (Than Zaw et al. in press), and it is also found in limestone forests in Viet Nam (Roberton et al. in prep.). It mainly occurs in upper montane forest in Sumatra (Holden 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Hog badgers feed on a variety of things based on what is available ranging from plants to worms to small mammals. It is therefore considered an omnivore. It is able to find food using its adapted pig like snout to sense smells. They dig in the ground using their snout, incisors, and canine teeth of their lower jaws. They will also eat fruit, roots and tubers. Its favorite food appears to be terrestrial earthworms.

Animal Foods: mammals; insects; terrestrial worms

Plant Foods: roots and tubers; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore , Vermivore); herbivore (Frugivore ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

There is little to no known information on the impact of hog badgers on their surrounding ecosystem. However, due to their foraging behaviors, they play some role in controlling the populations of invertebrates. Also, they aerate the soil by digging. Another interesting role they play is creating a habitat for other small animals through abandoned hog badger burrows.

Ecosystem Impact: creates habitat; soil aeration

Species Used as Host:

Mutualist Species:

Commensal/Parasitic Species:

  • SARS-CoV-like virus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hog badgers are well suited predators as they possess big claws, strong jaws, flexible skin and nasty tempers. Their coloration pattern is aposematic, meaning it has distinct coloration or patterns to warn other organisms it is dangerous and should be left alone. Hog badgers are great diggers, and can dig out of sight if it feels threatened. Also, they can produce secretions from their anal glands, but it is unknown whether or not that is a defense mechanism. Their only known predators are tigers and leopords.

Known Predators:

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arctonyx collaris preys on:
Annelida
Insecta
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Arctonyx collaris is prey of:
Panthera pardus
Panthera tigris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

There is no information known about the communication patterns for hog badgers. However, it is suggested that tactile communication and communication via scents may be used as seen in other species of belonging to the badgers, otters, weasels family.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no information known for the lifespan of hog badgers in the wild. However, in captivity the average lifespan is 14 years old.

Range lifespan

Status: captivity:
15.8 (high) years.

Average lifespan

Status: captivity:
14 years.

Average lifespan

Status: captivity:
13.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (captivity) Observations: There is usually a delayed implantation. Although females may be pregnant for up to 10 months, the postimplantation gestation period takes about 6 weeks.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little information known on the mating system for hog badgers. However, there is some information about the badgers, otters, weasels family. Males begin their sexual seasons before the females, and therefore, initiate breeding. This is often done by first obtaining territory.

The breeding period occurs from April to September, with the gestation period being 5 to 9.5 months long. Their litter size is 2 to 4 cubs. Although there is no information known about the sexual maturity of the two sexes, the information about the badgers, otters, weasels family offers some insight about what might occur for hog badgers, as well. For the badgers, otters, weasels family, females reach sexual maturity after 2 to 3 months, whereas the males do not reach sexual maturity until they are a year old. Also, there is little to know of the time of independence in hog badgers. However, American badgers (a similar species) have a time of independence of 5 to 6 months.

Breeding interval: Hog badgers breed once yearly during warmer months.

Breeding season: Hog badgers mate from April to September.

Range number of offspring: 2 to 4.

Range gestation period: 5 to 9.5 months.

Average weaning age: 4 months.

Range time to independence: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 2 to 3 months.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation

Average birth mass: 58 g.

Average number of offspring: 3.

Females are the primary caretakers of the young, and wean them for up to 4 months. Currently no information is available regarding specifics of parental care.

Parental Investment: female parental care ; pre-fertilization; pre-hatching/birth; pre-weaning/fledging; pre-independence

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonyx collaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAATCGATGACTATTTTCCACAAATCATAAAGATATCGGCACCCTTTACCTTCTATTTGGTGCATGAGCTGGAATAGTAGGTACTGCTCTTAGCTTACTAATTCGCGCCGAATTAGGTCAACCCGGTACTTTAATAGGAGATGATCAGATCTACAACGTAGTCGTGACAGCCCATGCATTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGTTTCGGAAACTGACTAGTCCCCCTAATAATTGGCGCACCCGACATAGCTTTTCCTCGAATAAATAATATAAGTTTCTGACTCCTACCCCCCTCCTTTCTGCTTCTCTTGGCCTCTTCCATAGTAGAAGCAGGCGCAGGAACAGGGTGGACTGTATATCCTCCTCTAGCAGGAAACTTAGCGCATGCAGGAGCATCTGTGGATATAACAATCTTCTCCCTTCATTTAGCAGGTGTTTCGTCCATCCTAGGAGCTATTAATTTTATTACTACTATTATTAACATAAAACCTCCTGCAATATCACAATATCAAACCCCCCTGTTCGTGTGATCTGTCCTAGTTACAGCTGTGCTATTACTTCTATCACTACCAGTCCTAGCAGCTGGTATTACCATATTACTAACAGACCGAAACCTAAATACAACCTTCTTCGATCCTGCCGGAGGAGGAGACCCTATTCTTTACCAACATTTATTCTGATTTTTTGGACACCCTGAAGTATATATCCTAATCCTACCAGGATTTGGAATTATTTCACATGTAGTCACTTATTACTCAGGAAAAAAAGAACCATTTGGTTATATAGGAATGGTTTGAGCAATAATATCCATCGGTTTCTTAGGATTTATTGTATGAGCCCATCATATATTTACTGTAGGAATAGACGTCGACACACGAGCATACTTCACTTCAGCTACCATAATTATTGCTATCCCCACAGGAGTTAAAGTGTTTAGTTGACTAGCCACTTTACATGGGGGGAATATTAAATGATCTCCAGCTATGCTATGAGCCCTAGGGTTTATCTTTCTATTCACAGTAGGTGGCCTAACAGGTATCGTCCTATCAAACTCGTCCCTAGATATTGTTCTTCATGACACATACTACGTGGTAGCTCATTTCCATTATGTCCTCTCAATGGGAGCAGTTTTCGCGATCATAGGTGGGTTCGTTCATTGATTCCCATTATTCACAGGATATACGCTAAATGATGTTTGAGCAAAAATTCACTTTACAATCATATTTGTAGGAGTAAATACCACATTCTTTCCACAACATTTCCTAGGTTTATCAGGCATACCTCGACGATACTCCGATTACCCAGATGCCTACACAGCATGAAACACAATCTCCTCTATAGGCTCATTTATTTCATTAACAGCAGTAATACTAATAATTTTCATAGTTTGAGAAGCCTTCGCATCCAAACGAGAAGTACTAACGGTAGAACTCACCTCAACAAACATTGAATGATTACATGGATGCCCTCCTCCATACCACACATTTGAAGAGCCAGCCTATGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctonyx collaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Hog badgers, in 1996, were listed least concerned. However, their population is decreasing, and they are currently listed as near threatened. In Thailand and India, they are under high protected statuses under law. They are threatened due to the use of hunting dogs in all of Indochina.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Long, B., Duckworth, J.W., Wang Ying-Xiang & Than Zaw

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Near Threatened as it is undergoing a population decline but globally this is not believed to be at a rate sufficient to qualify for A2cd (i.e.<30% over 3 generations) at this time. Even though it is widespread, it is severely threatened in some areas (Lao, Viet Nam, southeastern China and perhaps Myanmar) by exploitation, which occurs at high levels, and field status surveys reveal that the species is now occurring only patchily and overall rather rarely in these countries. More research and monitoring particularly in northeast India, Cambodia and Myanmar is needed to quantitatively determine the affect of exploitation on the population. This species should be periodically reassessed for the Red List in light of ongoing threats and uncertainty about range-wide levels of exploitation and the effects these are having on wild populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
opulation trends for the hog badger may vary across its range. In Lao PDR, this species can be locally common, as indicated by its presence during most surveys in and around the Nam Theun catchment (Duckworth et al. 1999). The lack of sightings elsewhere indicates that this species is either naturally patchy in abundance or under widespread decline (Duckworth et al. 1999). Occurrence in Myanmar is also patchy without obvious natural explantion (Than Zaw et al. in press). In Thailand, it is fairly common and found in both the north and the south (B. Kanchanaska pers. comm.). It is also very common in the high montane zone of Sumatra (Holden 2006), and in southwestern and eastern Cambodia (J. L. Walston and R. J. Timmins pers. comm.). In India, this species is fairly common in Terai. The hog badger is historically widespread in Viet Nam, but sightings seem to be declining (Roberton et al. in prep.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Major threats to the hog badger are hunting by dogs as well as snaring, primarily for human consumption and as bycatch. In Lao, the palatability of hog badger varies among ethnic groups, with some groups disliking the taste, whereas groups in parts of the Nam Theun basin (and perhaps widely elsewhere) seek the species specifically for food (J. Baker pers. comm. and J. Chamberlain per. comm. in Duckworth et al. 1999). This species is also eaten by some groups in India, and is hunted as well as farmed for food in China (M.W.N. Lao pers. comm.). Field surveys in China generated very few records of wild animals in Southeastern China (M.W.N. Lao pers. comm.), and the species is also hunted at the local level in Viet Nam (Roberton et al. in prep.). In all of Indochina, this species is threatened by the use of hunting dogs (J. Baker pers. comm. 1999).

The snaring intensity in Cambodia is considerably lower than that in Lao PDR and Viet Nam, and the relatively larger number of recent records from Cambodia than from Viet Nam and Lao PDR is strong indirect evidence that trapping levels are driving reductions in these latter countries. In Viet Nam and presumably elsewhere, gun-hunting poses another threat to the species (Timmins et al. 1999).

While threats similar to those in Lao PDR and Viet Nam are known to exist in Thailand, it is generally thought that the hunting is operating at much lower intensities and are therefore not as serious. In Sumatra as well, the threats are minimal, because the zone of occurrence is above where the majority of hunting takes place (Holden 2006)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Throughout its range, this species is found in a number of protected areas. In Thailand this species is protected by law, and in India this species is protected under the highest level of protection. It is not protected in Viet Nam or Cambodia and is the largest-bodied unprotected mammal, except for Euraisan Wild Hog Sus scrofa, in Myanmar (Than Zaw et al. in press). The China Red List has listed the hog badger as Vulnerable under C1 and A2c.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There is no known adverse effects of hog badgers on humans. However, its relatives, Eurasian badgers, have been known to carry bovine tuberculosis. There is a possibility that hog badgers could also carry diseases common to livestock. Hog badgers and Eurasian badgers have a similar diet and have been known to damage crops.

Negative Impacts: crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is little known evidence to suggest a positive benefit to humans from hog badgers. However, some groups in India eat hog badgers, and they are hunted and farmed for food in China. In Lao, taste preference for hog badgers varies among ethnic groups. Some groups do not care for their meat, whereas groups in parts of the Nam Theun basin seek them for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hog badger

The hog badger (Arctonyx collaris) is a terrestrial mustelid that is widespread in Central and Southeast Asia. It is listed as Near Threatened in the IUCN Red List of Threatened Species as its occurrence is patchy. The population is thought to be declining due to high levels of exploitation.[2]

Characteristics[edit]

It has medium-length brown hair, stocky body, white throat, two black stripes on an elongated white face and a pink, pig-like snout. The head-and-body length is 55–70 cm (22–28 in), the tail measures 12–17 cm (4.7–6.7 in) and the body weight is 7–14 kg (15–31 lb).[3]

Its appearance generally resembles the European badger, but it is generally smaller, with larger claws on the front feet. Its tail has long white hairs, and its front feet have white claws.

Distribution and habitat[edit]

Hog badgers are considered fairly common in Thailand and in tropical evergreen forests and grasslands of the Terai in north-eastern India. They occur in Indochina and in southern China.[2] Their distribution in Myanmar is considered patchy.[4] In the Indonesian island of Sumatra, hog badgers occur primarily above 2,000 m (6,600 ft) with one record at 700 m (2,300 ft).[5] There is one isolated record in eastern Mongolia.[6]

The following subspecies are recognized:[1]

  • Greater hog badger A. c. collaris (Cuvier, 1825) – lives in the Eastern Himalayas;[7]
  • Northern hog badger A. c. albogularis (Blyth, 1853) – occurs in southern China northwards to Shensi;[7]
  • Chinese hog badger A. c. leucolaemus (Milne-Edwards, 1867) – occurs in northern China from southern Kansu to Chihli;[7]
  • Sumatran hog badger A. c. hoevenii (Hubrecht, 1891) – lives in Sumatra;
  • Indochinese hog badger A. c. dictator (Thomas, 1910) – lives in southern Thailand and Indochina;[7]
  • Burmese hog badger A. c. consul (Pocock, 1940) – occurs from Assam to Myanmar.[7]

Ecology and behavior[edit]

The hog badger is active by day and not very wary of humans.[8] Analysis of numerous camera trap pictures from Myanmar show no peak activity at either day or night.[9]

The hog badger is omnivorous, its diet consists of fruits, roots and small animals.

References[edit]

  1. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 532–628. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Timmins, R.J., Long, B., Duckworth, J.W., Wang Ying-Xiang and Than Zaw (2008). "Arctonyx collaris". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  3. ^ Boitani, L. (1984). Simon & Schuster's Guide to Mammals. Touchstone. ISBN 978-0-671-42805-1
  4. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
  5. ^ Holden, J. (2006). Small carnivores in central Sumatra. Small Carnivore Conservation 34/35: 35–38.
  6. ^ Stubbe, M., Stubbe, A., Ebersbach, H., Samjaa, R. and Doržraa, O. (1998). Die Dachse (Melinae/Mustelidae) der Mongolei. Beiträge zur Jagd- und Wildforschung 23: 257–262.
  7. ^ a b c d e Ellerman, J. R. and Morrison-Scott, T. C. S. (1966). Checklist of Palaearctic and Indian mammals 1758 to 1946. Second edition. British Museum of Natural History, London. Pages 274–275.
  8. ^ Duckworth, J. W., Salter, R. E. and Khounbline, K. (1999). Wildlife in Lao PDR: 1999 Status Report. IUCN, Vientiane, Laos.
  9. ^ Than Zaw, Saw Htun, Saw Htoo Tha Po, Myint Maung, Lynam, A. J., Kyaw Thinn Latt and Duckworth, J. W. (2008). Status and distribution of small carnivores in Myanmar. Small Carnivore Conservation 38: 2–28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!