Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Description

The largest North American rodent and the only one with a broad, flat, scaly tail, the Beaver is now common and widespread, even in areas it did not inhabit during pre-colonial times. The modifications it makes to the environment by felling trees and building dams result in changes to plant, animal, and microbial communities that are sometimes desirable and sometimes not. The Beaver itself is not easily seen, being nocturnal and secretive, but it can be spotted in ponds, lakes, or large streams at twilight by a quiet observer. Its pelage is brown, with gray underfur, and is prized by trappers. The webbing on its hind feet help it to swim; claws on the digits of its forefeet give it dexterity in handling food; comblike claws on its hind feet help it in careful grooming; and it can close its mouth behind its front teeth, so that it can carry woody material without taking in water. Beavers cache and consume the inner bark of both deciduous and evergreen shrubs and trees, as well as terrestrial and aquatic plants. Their young, called kits, leave the colony at the age of six months.

Adaptation: The shape of the Beaver skull, and the rough texture of its bone, is evidence of a powerful set of chewing muscles. The groove-like depression at the back of the snout and the round one near the jaw joint are areas where large muscles attach. The ridge of bone that marks the curvature below the back angle of the mandible is another muscle attachment site.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Kuhl, H., 1820.  Beitrage zur zoologie und vergleichenden anatomie, p. 64.  Verlag der Hermannschen Buchandlung, Frankfurt am Main, Abt 1. 151 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species is found throughout North America except the arctic tundra, peninsular Florida and the deserts of the southwestern United States. Its range extends into northern Mexico. In 1937 it was introduced in Finland, from where it naturally dispersed to Karelia and Leningrad Region (northwest Russia). It is also introduced in the Russian Far East, Kamchatka and Sakhalin Island (Russia). In 1946 American Beavers were introduced at Isla Grande, Tierra del Fuego (Argentina). Beavers are now found in all streams in the Andean and extra-Andean areas, and in nearly all aquatic habitats on Isla Grande as well as other Chilean islands of the Tierra del Fuego archipelago (Lizarralde et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) North America except arctic tundra, peninsular Florida, and much of the desert area of the Southwest, including parts of the northern edge of Mexico; introduced into Eurasia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Beavers are found throughout all of North America except for the northern regions of Canada and the deserts of the southern United States and Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Beavers are found throughout all of North America except for the northern regions of Canada and the deserts of the southern United States and Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Beavers are the largest rodents in North America, and they spend most of their time in the water. To protect themselves from the cold and wetness they have waterproof reddish brown or blackish brown hair. They have small, round, brown ears, and powerful back legs for swimming. A beaver's front legs are not as large or as strong as its back legs.

Beaver skulls and teeth are very big. The two front teeth are orange colored, and they can be up to 5 mm wide and between 20 and 25 mm long. These teeth grow throughout the animal's life, and they are used for cutting wood. Without these teeth beavers could not cut down or eat trees and wood. Beavers also have see-through eye lids, and closable nostrils and ears for swimming underwater.

Beavers also have anal and castor glands, which they use to mark their territory. These glands are located beneath the tail. A beaver's tail is broad, flat, and covered with large black scales.

Range mass: 13 to 32 kg.

Range length: 900 to 1170 mm.

Sexual Dimorphism: sexes alike

  • Hall, E., K. Kelson. 1959. The Mammals of North America, vol. 2. New York: The Ronald Press Company.
  • Whitaker, J., W. Hamilton. 1998. Mammals of the Eastern United States. New York: Cornell University Press, Sage House.
  • 1998. "Data: Species: Mammal: American Beaver- Castor canadiensis" (On-line). Sevilleta LTER Data. Accessed August 01, 2002 at http://sevilleta.unm.edu/data/species/mammal/sevilleta/profile/american-beaver.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Beavers are primarily aquatic animals, and the largest rodents in North America. They have a waterproof, rich, glossy, reddish brown or blackish brown coat. The underhairs are much finer than the outer, protective, guard-hairs. The ears are short, round, and dark brown in coloration. A beaver's hind legs are longer than its front legs, thus making the rear end to be higher than the front end while walking.

Beaver skulls and teeth are disproportionately large. This is crucial for cutting through hard woods like maple and oak. Most noteably, the upper incisors, bright orange in color, are at least 5 mm wide and 20-25 mm long. These teeth grow throughout the animal's lifetime and are a necessity to survival, just as the animal's closable nostrils, closable ears, and transparent eye membranes are for aquatic existence.

Also notable are the anal and castor glands, found in both male and female beavers. Both sets of glands lie at the base of the tail, which is possibly the most defining characteristic of the beaver. It is broad, flat, and covered in large blackish scales. The anal and castor glands have been recorded as large as 3.4 by 2.2 inches for the castors, and 3.0 by 1 inch for the anal glands. Secretions from these glands are used in scent-marking, and give the beaver its odd odor.

Beavers also have anal and castor glands, which they use to mark their territory. These glands are located beneath the tail. A beaver's tail is broad, flat, and covered with large black scales.

Range mass: 13 to 32 kg.

Range length: 900 to 1170 mm.

Sexual Dimorphism: sexes alike

  • Hall, E., K. Kelson. 1959. The Mammals of North America, vol. 2. New York: The Ronald Press Company.
  • Whitaker, J., W. Hamilton. 1998. Mammals of the Eastern United States. New York: Cornell University Press, Sage House.
  • 1998. "Data: Species: Mammal: American Beaver- Castor canadiensis" (On-line). Sevilleta LTER Data. Accessed August 01, 2002 at http://sevilleta.unm.edu/data/species/mammal/sevilleta/profile/american-beaver.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 117 cm

Weight: 27000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 1,000-1,200 mm

Weight:
Range: 16-30 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

An inexperienced observer could mistake a muskrat (ONDATRA ZIBETHICUS), round-tailed muskrat (NEOFIBER ALLENI) or a nutria (MYOCASTOR COYPUS) for a beaver, but these other rodents do not have a broad flattened tail.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Beavers inhabit permanent sources of water of almost any type in their range, which extends from arctic North America to the Gulf of Mexico and arid Southwest, and from sea level to over 3400 m in the mountains. They prefer low gradient streams (which they modify), ponds, and small mud-bottomed lakes with dammable outlets (Slough and Sadleir 1977, Beier and Barrett 1987, Novak 1987a, McComb et al. 1990). Beavers readily occupy artificial ponds, reservoirs, and canals if food is available. They generally avoid lakes with strong wave action and fast- moving streams. Waters with greatly fluctuating flow or water levels generally are poor habitat. In larger rivers (9th order or larger streams), beavers use floodplains and backwaters. In the north, they require water that is deep enough such that it does not freeze to the bottom and allows the accumulation of a substantial food pile beneath the ice. Beavers are associated with deciduous tree and shrub communities. In many situations beavers modify existing stream courses or other bodies of water and make them more suitable for their own use (see section below on dam building). They may occupy deep sections of streams and existing lakes or ponds without constructing a dam.

See Allen (1983) for a beaver habitat suitability index based on food and water characteristics. See Novak (1987a) for references to other models that have been developed in attempts to predict beaver family density.

Dam Construction Most dam building occurs April-June and especially August-October (Hill 1982), though repairs may be made at any time. In Quebec, the density of dams on small streams (4th order or less) averaged 10.6 per kilometer (range 8.6-16.0) (Naiman et al. 1986). In the northeastern U.S., a beaver family maintains an average of 2.5 dams. Generally trees, together with mud and rocks, supply the material for a dam.

Streams dammed by beavers typically are 2nd to 4th order streams; rarely do they build on 1st-order streams except at uncommonly high population densities. Dams in the main channel of streams of 5th order or larger often are destroyed by spring flooding (Naiman et al. 1986). In some areas (e.g. Missouri), dam building does not occur as commonly as in the north or west, perhaps due to the occurrence of deep swift rivers subject to severe flooding (Schwartz and Schwartz 1981).

Lodges

A characteristic beaver sign is the lodge, a hollow mound of tree branches (or, in the far north, mainly nonwoody material) and mud within which the beaver family sleeps and raises young. A lodge may be built against a bank, on an island, or in shallow water, but it must be near permanently deep water such that the entrance of the lodge is under water and so that the food cache can be reached even when the body of water is ice-covered. In bogs in northern Minnesota, beavers sometimes built lodges on the bog mat and many lodges were floating (Rebertus 1986). allowing for some ventilation. A family may maintain and use more than one lodge in summer in some areas (e.g., Colorado, Massachusetts). In some localities beavers use a different lodge each winter; it is more likely that the same lodge will be used if food in the area is abundant (Buech 1985). Beaver dens are not always in lodges. In some areas, beavers den in burrows in the banks of streams or lakes. This is common in areas subject to floods and fluctuating water levels. Beavers normally stay within 0.8 km of the den throughout the year (Schwartz and Schwartz 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It inhabits areas near lakes, ponds, and streams with access to suitable food and building resources. Beavers are known for their ability to modify an environment through the construction of dams, which often cause flooding of the surrounding areas (Jenkins and Busher 1979). Beaver activity modifies the original Nothofagus (the main component of the South Patagonian forests) ecosystem from a closed forest to a grass and sedge dominated meadow (Martínez Pastur et al. 2006).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beavers live in lodges. They will either live in one built on an island, one built on the shore of a pond, or one built on a lakeshore. The lodge has one main room with its floor above water. There are two entrances to the lodge.

The lodge is oven-shaped, and is made of sticks, grass, moss, and mud. The inside room may be 8 feet wide and up to 3 ft high. Over the years beavers add more sticks and mud. This makes the lodge larger. The floor of the lodge is covered in bark, grass, and wood chips.

The pond lodge is built either a short way back from the edge of the bank, or partly hanging over it, with the front wall built up from the bottom of the pond. The lake lodge is built on the shelving shores of lakes. To ensure adequate water depth surrounding the lodge, beavers dam streams with logs, branches, mud, and stones.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beavers live in lodges, of which there are three types: those built on islands, those built on the banks of ponds, and those built on the shores of lakes. The island lodge consists of a central chamber, with its floor slightly above the water level, and with two entrances. One entrance opens up into the center of the hut floor, while the other is a more abrupt descent into the water.

The lodge, itself, is an oven-shaped house of sticks, grass, and moss, woven together and plastered with mud. Over the years, repair and elaboration leads to an increase in hut size. The room inside may measure 2.4 m (8 ft) wide and up to 1 m (3 ft) high. The floor is blanketed with bark, grass, and wood chips.

The pond lodge is built either a short way back from the edge of the bank, or partly hanging over it, with the front wall built up from the bottom of the pond. The lake lodge is built on the shelving shores of lakes. To ensure adequate water depth surrounding the lodge, beavers dam streams with logs, branches, mud, and stones.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Beavers usually stay within 0.8 km of the den (Schwartz and Schwartz 1981). The longest movements are made by dispersing two-year-olds (Hill 1982); these average 8-16 stream km but range up to 238 stream km (108 air km, Hibbard 1958). In Ohio, nearly all dispersers moved out of natal drainage system (Svendsen 1980). Families generally are at least 0.8-1.6 km apart (reviewed in Novak 1987a). In Manitoba, home range averaged 17.6 ha for solitary beavers and 7.7 ha for families (Wheatley 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: The diet of the beaver changes throughout the year. Use of woody vegetation extends from fall to spring, peaking in winter and reaching a minimum in summer. Favored woody plants in many regions include aspen (POPULUS TREMULOIDES), willow (SALIX), cottonwood (POPULUS sp.), alder (ALNUS sp.), birch (BETULA), sweetgum (LIQUIDAMBAR STYRACIFLUA), blackgum (NYSSA), and pine (PINUS). Aspen is especially favored where it is available. Apparently alder often is cut for construction material and not for food, except when other sources are unavailable (see Novak 1987a). In general the beaver is flexible in its choice of woody plants and eats the leaves, bark, and twigs of most species. Beavers commonly debark pine trees and lick the pitch.

Summer foods include aquatic succulents such as pond lilies (NUPHAR, NYMPHAEA), bur-reed (SPARGANIUM), duckweeds (LEMNA, etc.), pondweeds (POTAMOGETON), algae, and fleshy rootstocks of many other species, as well as a wide variety of upland or riparian herbaceous plants. In addition, beavers in some areas commonly visit fields to eat and/or harvest clover, alfalfa, corn, soybeans, and other crops, some of which may be used as construction materials. Relatively little is known about the possible use of below-surface aquatic vegetation in winter. See Novak (1987a) for an overview of beaver food habits in different regions.

Naiman et al. (1988) cited various studies indicating that in northern regions beavers annually cut at least a metric ton of wood within approximately 100 m of their pond. In Wisconsin, it was estimated that a beaver family may cut about one-half acre (0.2 ha) per year in pole stands of 500 stems per acre (1250 stems per ha) (Knudsen 1962). Extensive tree cutting occurs only in late summer and fall (Adirondacks; Stegeman 1954).

In northern areas, beavers store food in late summer and fall for use in winter. Food cache construction begins at the end of August at the Mackenzie Delta (Aleksiuk 1970). Branches of woody plants are cached in deep pools near the den. Normally branches that are cut and carried to the cache are under 13 cm in diameter. The food pile may be capped with alder, peeled logs, or conifers. Caching provides an under-ice food supply in winter. In areas that rarely become heavily ice-covered, beavers do not always or regularly cache food (Swenson et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Beavers eat bark and cambium, the soft wood underneath bark. Their favorites include maple, willow, beech, birch, alder, and aspen trees. Beavers also eat plants that live in the water, including root and flowers. When beavers live in zoos, they are fed yams, lettuce, carrots, and "rodent chow".

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Beavers eat bark and cambium (the softer growing tissue under the bark of trees). Their favorites include willow, maple, poplar, beech, birch, alder, and aspen trees. They also eat water vegetation, as well as buds, and roots. Cellulose, which usually can not be digested by mammals, is a major component of their diet. Beavers have microorganisms in their cecum (a sac between the large and small intestine) that digest this material. In zoos, beavers are fed yams, lettuce, carrots and "rodent chow."

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Beaver dams create ponds that provide homes for many other animals. They also raise the level of the water in the area and prevent damage from flood waters.

Ecosystem Impact: creates habitat; keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Young beavers are very vulnerable, and are threatened by Ursus, Canis lupus, Gulo gulo, Lynx canadensis, Martes pennanti and Lontra canadensis. An adult beaver's size is a deterrent to most predators, and though natural predators pose a very real danger to kits, man has proven to be, by far, the most dangerous predator to beavers. Killing beavers for their pelts, disrupting them through a change in habitat, and slowly poisoning them through pollution, which is known to infect wounds, all have lead to the threat which man poses on beavers.

Known Predators:

  • wolves (Canis_lupus)
  • wolverines (Gulo_gulo)
  • lynx (Lynx_canadensis)
  • northern river otters (Lontra_canadensis)
  • humans (Homo_sapiens)
  • black bears and brown bears (Ursus)
  • fishers (Martes_pennanti)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Beavers maintain wetlands that can slow the flow of floodwaters. They prevent erosion, and they raise the water table, which acts as a purifying system for the water. This happens because silt occurs upstream from dams, and toxins are then broken down. As ponds grow from water backed up by the damn, pond weeds and lilies take over. After beavers leave their homes, the dams decay, and meadows appears.

Ecosystem Impact: creates habitat; keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Young beavers are very vulnerable, and are threatened by bears, wolves, wolverines, lynx, fishers and otters. An adult beaver's size is a deterrent to most predators, and though natural predators pose a very real danger to kits, man has proven to be, by far, the most dangerous predator to beavers. Killing beavers for their pelts, disrupting them through a change in habitat, and slowly poisoning them through pollution, which is known to infect wounds, all have lead to the threat which man poses on beavers.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Castor canadensis is prey of:
Ursus
Homo sapiens
Enhydra lutris
Gulo gulo
Lynx canadensis
Canis lupus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

A keystone species that has profound effects on aquatic and riparian ecosystems (Naiman et al. 1986).

In boreal systems, may influence 20-40% of the length of 2nd- to 5th-order streams (Ford and Naiman 1988). Open patches created by beaver in New York and Wisconsin varied from less than 0.5 ha to 30 ha (Remillard et al. 1987, Dickinson 1971, Knudsen 1962), but averaged less than 4 ha.

Among the many changes that occur with beaver activity are the following (see Johnston and Naiman 1987 and Naiman et al. 1988):

1. Storage of precipitation and reduced discharge variability (Naiman et al. 1986, Hill 1982).

2. Increased depth and surface area of water (Hill 1982, Naiman et al. 1986).

3. Increase in open canopy (Naiman et al. 1986)).

4. Reduction of riparian deciduous trees (Beier and Barrett 1987, NYDEC 1991).

5. Enhancement or degradation of fish habitat (Neff 1957, Gard 1961, Hill 1982, Churchill 1980, cited in Munther 1983).

6. Habitat enhancement for species dependent on wetlands or dead trees (Reese and Hair 1976, Hill 1982, Ermer 1988, Dieter and McCabe 1989, Arner and Hepp 1989, Dubec et al. 1988, 1990, NYDEC 1991, Novak 1987a).

7. Increased plankton productivity and an increase in aquatic insects (Naiman et al. 1986).

8. Increased trapping of sediment and decreased turbidity downstream (Naiman et al. 1986).

9. Enhancement of beaver food plants such as willow and alder (Slough and Sadleir 1977).

10. Increase in carbon and nutrients in the channel (Hodkinson 1975, Naiman et al. 1986, Naiman and Mellilo 1984, Francis et al. 1985).

11. Increased resistance of ecosystem to perturbation (Naiman et al. 1986).

Beaver ponds are a shifting mosaic of habitats, dependent on pond age and size, successional state, substrate, hydrology, and nutrients. In boreal regions, there is a complex pattern of ecosystem development that involves the formation of marshes, seasonally flooded meadows, and forested wetlands, which appear to persist in a somewhat stable condition for centuries (Naiman et al. 1988). Food shortage probably is the major factor affecting colony longevity (Hodgdon 1978).

Population Ecology: A typical 'colony' is a family group (Payne 1982) of 3-6 individuals, with one breeding female (Novak 1977). Typical densities range from 0.4 to 0.8 families per square kilometer (Naiman et al. 1986) or from 0.09 to 1.2 families per stream km (Voight et al. 1976); saturation densities 0.4-1.9 families per km. In Newfoundland, reach greatest density in early succession (Northcott 1964). In Massachusetts, density increased with increasing hardwoods and with decreasing gradient, watershed size, and stream width (Howard and Larson 1985).

Mortality Factors: Humans are the only significant predators in most areas. Wolves may prey on beavers when ungulate populations are low (Voight et al. 1976, Shelton and Peterson 1983). In some regions tularemia (the bacterium FRANCISELLA TULARENSIS) has caused large die-offs (see Novak 1987a, Addison et al. 1987). However, most unexploited populations have a low mortality rate (less than 5- 7%), and can grow quickly in areas with abundant resources.

Scent Marking and Territoriality: A family maintains a territory from which other unrelated beavers generally are thought to be excluded (see Hodgden 1978 for evidence to the contrary). An important component of this is the construction of scent mounds, which typically are placed along trails and canals, and on lodges, dams, and pond banks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Beavers have a pair of anal scent glands, called castors, which secrete a musk-like substance called castoreum. This is used mainly for marking territories. The broad, flat, scaly tail is about 25 cm (about 10 in) long and serves as a warning signal when slapped against the water. Beavers also call out to others, making a low, groaning sound.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Beavers have a pair of anal scent glands, called castors, which secrete a musk-like substance called castoreum. This is used mainly for marking territories. The broad, flat, scaly tail is about 25 cm (about 10 in) long and serves as a warning signal when slapped against the water. Beavers also call out to others, making a low, groaning sound.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most beaver activity is crepuscular and nocturnal, but commonly they are active diurnally as well. According to Schwartz and Schwartz (1981) diurnal activity is most likely in fall. Beavers exhibit winter torpor but do not hibernate (Seal and Kreeger 1987). Rarely are beavers active above ice when temperatures are below -10 C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Under favorable conditions, beavers will produce their first litters at two or three years of age. The average lifespan of a beaver in the wild is 10 to 20 years. While its size saves it from most predators, a beaver's lifespan can be cut short by predators, most commonly humans, wolves, and coyotes. Parasites and disease also play a factor in mortality.

Typical lifespan

Status: wild:
10 to 20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Under favorable conditions, beavers will produce their first litters at two or three years of age. The average lifespan of a beaver in the wild is 10 to 20 years. While its size saves it from most predators, a beaver's lifespan can be cut short by predators, most commonly humans, wolves, and coyotes. Parasites and disease also play a factor in mortality.

Typical lifespan

Status: wild:
10 to 20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.4 years (captivity) Observations: It has been suggested that beavers may live as much as 50 years (Ronald Nowak 1999), which is doubtful. One captive specimen was still alive after 23.4 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating is monogamous. Outbreeding is the rule, with rare parent-progeny mating; matings between parent and offspring apparently occur only when a family unit is disrupted by the death of one adult (Taylor 1970, Svendsen 1980). In Ohio, Svendsen (1989) found that 56% of all pairs were formed in September, October, and November. Pair-bonds tended to last longer in areas with more stable conditions (lakes) than they did in comparatively unstable sites (streams).

Breeding (i.e., copulation) occurs January-March in the middle part of the range, mainly February-March in cold northern areas, mid-February in Newfoundland (Bergerud and Miller 1977), and over a longer season (late October-March) in the south (near the winter soltice in Mississippi; Wigley et al. 1983).

Gestation is thought to be 105-107 days, though also reported as about 128 days (Miller 1983) or around 100 days (Bergerud and Miller 1977). Parturition occurs in April, May, or June in Missouri (Schwartz and Schwartz 1981), April or May in Texas, generally late March and early April in Mississippi (Wigley et al. 1983), late May or early June in Newfoundland (Bergerud and Miller 1977), and June in Saskatchewan (Gunson 1970). In Ohio, Svendsen (1980) first heard the whining of kits in lodges in June.

Litter size ranges from one to nine, with three or four being typical in many areas. Factors influencing litter size include food supply, growing season, female size and age, and harvest rate. A female beaver produces one litter per year. Weaning occurs at an age of about six weeks and a weight of 4 pounds (1.8 kg).

In most cases, the young disperse from their family group in late winter or early spring, at an age of almost two years, before the new kits are born, or dispersal may occur later in summer. Some authors state that dispersal occurs at the end of the first year. Dispersal occurs over land and via waterways (Leege 1968). Apparently the young may remain in the family group longer than two years in high quality habitats and/or in habitats that are saturated with beavers (Boyce 1974, Gunson 1970, Bergerud and Miller 1977, Novakowski 1965). Dispersers often move to another area and begin a new pond. Sometimes they may return to their natal site (Svendsen 1980, Ryden 1988).

Survival of the young can be quite high in untrapped populations. Svendsen (1980) found that survival of the kits through their second summer was 95% (based on cohorts that lived long enough to emerge from their natal lodge). Some other studies also found that losses in the first year were very low, but other research indicates higher mortality rates (see Novak 1987a).

Compared to other rodents, beavers attain sexual maturity at a relatively late age. Females normally first give birth on or near their third birthday, and may remain productive for up to at least ten years (Stegeman 1954), though only a few live that long. Sometimes females breed when one (rarely) or two years old, though this is rare at the northern and southern range limits (Hill 1982). Males generally first breed at an age of about 21 months, though a variable proportion of yearlings may breed and sometimes older males may be functionally sterile.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beavers are monogamous, but if one mate dies, the other will "remarry", or seek out a new mate. Beavers are driven away from their colonies usually around their second year of life, right before a new litter is born. They then make a colony of their own, usually several kilometers away, and they first breed around their third years of life, give or take a year depending on the quality of the environmtnt.

Mating System: monogamous

Female beavers are sexually mature when they are about 3 years old. They give birth to one litter each year, usually between April and July. Baby beavers develop inside their mother for about 3 months. Baby beavers are called kits. When they are born they already have all of the fur and have their eyes open.

At birth kits are usually around 38 cm long including their tales. They tend to weigh from 250 to 600 grams and can be red, brown, or almost black. They remain in the lodge for a month, afterwards leaving for longer periods of time to swim and take in solid foods. Most beavers are weaned within two weeks, although it can take up to 90 days. The young usually stay with their parents for 2 years and then leave to make their own homes.

Breeding interval: Beavers breed once a year.

Breeding season: Mating takes place during the winter season, usually in January or February.

Range number of offspring: 1 to 4.

Average gestation period: 3 months.

Average weaning age: 2 weeks.

Average time to independence: 2 years.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 430 g.

Average gestation period: 128 days.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
639 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
639 days.

Both male and female beavers will care for their young for up to two years. To prepare for new kits, a mother beaver will make a soft bed on the floor of the lodge. She will then use her tail to help deliver her babies. She licks each kit clean and nurses it. Both mother and father beavers will protect their young from predators, catch food for them, and teach them how to catch food on their own.

Parental Investment: pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beavers are monogamous, but if one mate dies, the other will "remarry", or seek out a new mate. Beavers are driven away from their colonies usually around their second year of life, right before a new litter is born. They then make a colony of their own, usually several kilometers away, and they first breed around their third years of life, give or take a year depending on the quality of the environmtnt.

Mating System: monogamous

Male and female beavers are sexually mature at about 3 years of age. They mate between January and March in cold climates, and in late November or December in the south. Beavers give birth to one litter of kits per year, usually between April and June. The gestation period is about 3 months, or 105-107 days. During this time, the young develop inside the female's body. When they are born they are fully furred,have open eyes, and can swim within 24 hours. After several days they are also able to dive out of the lodge with their parents to explore the surrounding area.

Female beavers are sexually mature when they are about 3 years old. They give birth to one litter each year, usually between April and July. Baby beavers develop inside their mother for about 3 months. Baby beavers are called kits. When they are born they already have all of the fur and have their eyes open.

At birth kits are usually around 38 cm long including their tales. They tend to weigh from 250 to 600 grams and can be red, brown, or almost black. They remain in the lodge for a month, afterwards leaving for longer periods of time to swim and take in solid foods. Most beavers are weaned within two weeks, although it can take up to 90 days. The young usually stay with their parents for 2 years and then leave to make their own homes.

Breeding interval: Beavers breed once a year.

Breeding season: Mating takes place during the winter season, usually in January or February.

Range number of offspring: 1 to 4.

Average gestation period: 3 months.

Average weaning age: 2 weeks.

Average time to independence: 2 years.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 430 g.

Average gestation period: 128 days.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
639 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
639 days.

Parental care begins before birth, and continues for 1-2 years until the young have reached the stage of independence. In preparation for birth females will prepare a soft bed within the lodge. She then will use her flat tail as a sort of birthing mat. She will lick each kit clean, and nurse it. Both mother and father beaver play a part in providing food for the young and protecting them from predators.

Parental Investment: pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Stream remodeling alters ecosystems: American beaver
 

Beavers alter ecosystems by cutting trees and shrubs and creating mosaics of wetlands, moist meadows, and ponds.

       
  "For extensive stream remodeling that creates new wetlands, waterfowl habitat, fish spawning pools, and settling ponds for sediment, nothing matches the work of beavers." (Baskin 1997:95)

"Beaver (Castor canadensis) provide a striking example of how  animals influence ecosystem structure and dynamics in a hierarchical  fashion. Initially beaver modify stream morphology and hydrology by  cutting wood and building dams. These activities retain sediment and  organic matter in the channel, create and maintain wetlands, modify  nutrient cycling and decomposition dynamics, modify the structure and  dynamics of the riparian zone, influence the character of water and  materials transported downstream, and ultimately influence plant and  animal community composition and diversity (Naiman and Melillo 1984,  Naiman et al. 1986). In addition to their importance at the ecosystem  level, these effects have a significant impact on the landscape and must  be interpreted over broad spatial and temporal scales as beaver  population dynamics shift in response to disturbance, food supply,  disease, and predation." (Naiman et al. 1988:753)

Watch Video

  Learn more about this functional adaptation.
  • Baskin, Y. 1997. The Work of Nature: How The Diversity Of Life Sustains Us. Island Press.
  • Naiman RJ; Johnston CA: Kelley JC. 1988. Alteration of North American streams by beaver. BioScience. 38(11): 753-762.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Teeth are self-sharpening: American beaver
 

The teeth of beavers self-sharpen because their inner surface is softer than the outer enamel and wears away faster to create a sharp edge.

       
  "Plant-eaters have to have particularly good teeth. Not only do they use them for very long periods but the material they have to deal with is often very tough. Rats, like other rodents--squirrels, mice, beavers, porcupines--cope with that problem by maintaining open roots to their front gnawing teeth, the incisors, so that they continue to grow throughout the animal's life compensating for wear. They are kept sharp by a simple but very effective self-stropping process. The main body of the rodent incisor is made of dentine, but its front surface is covered by a thick and often brightly coloured layer of enamel which is even harder. The cutting edge of the tooth thus becomes shaped like a chisel. As the top incisors grind over the lower ones the dentine is worn away more quickly and this exposes the blade of enamel at the front keeping a sharp chisel edge." (Attenborough 1979:246)

"Like all rodents, beavers have self-sharpening incisor teeth that never stop growing. The outer surface is protected by tough enamel, but the inner surface is softer and wears away as the beaver gnaws, creating a sharp, chiseled edge." (McKay et al. 2004:222)
  Learn more about this functional adaptation.
  • George McKay; Fred Cooke; Stephen Hutchinson; Richard Vogt; Hugh Dingle. 2004. The Encyclopedia of Animals: A Complete Visual Guide. Berkeley: University of California Press. 608 p.
  • Attenborough, D. 1979. Life on earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Functional adaptation

Habitat mosaics stop fires: beaver
 

Beavers reduce fire impacts in spruce stands by creating a mosaic of habitats that act as natural firebreaks.

   
  "Not only do the appetites of moose and beavers help determine when a northern forest will reach this flammable spruce stage, but beavers also indirectly affect the extent of the burn. The mosaic of aspen and willow stands, meadows, ponds, and wetlands they maintain amid the flammable spruce forests can serve as natural firebreaks, keeping fires smaller than they would be in homogeneous landscapes. Both the moose and beaver then benefit from the effects of fire because it clears the way for the regrowth of aspen and willows in the nutrient-laden ash." (Baskin 1997: 168)
  Learn more about this functional adaptation.
  • Baskin, Y. 1997. The Work of Nature: How The Diversity Of Life Sustains Us. Island Press.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Functional adaptation

Enhancing species richness: beavers
 

Beavers enhance species richness in their environments by increasing habitat heterogeneity.

   
  "Many organisms modulate the availability of resources to other species by causing state changes in biotic or abiotic materials (ecosystem engineering), in the process frequently changing the selection to which the ecosystem engineers and other organisms are exposed (niche construction)…Jones and colleagues (1997) hypothesized that at a scale encompassing unmodified or 'virgin' habitats, engineered habitats, and degraded areas abandoned by engineers, the net effect of ecosystem engineering should be to enhance species richness via a net increase in habitat diversity. Recent studies provide support for this hypothesis. For example, natural sites with and without beavers (Castor canadensis) exhibit low overlap in species composition. By increasing habitat heterogeneity, beavers increased herbaceous plant species numbers by more than 33% (Wright et al. 2002)." (Boogert 2006:570, 574)
  Learn more about this functional adaptation.
  • Boogert, Neeltje J.; Paterson, David M.; Laland, Kevin N. 2006. The Implications of Niche Construction and Ecosystem Engineering for Conservation Biology. BioScience. 56(7): 570-578.
  • Jones CG; Lawton JH; Shachak M. 1997. Positive and negative effects of organisms as physical ecosystem engineers. Ecology. 78: 1946-1957.
  • Wright JP; Jones CG; Flecker AS. 2002. An ecosystem engineer, the beaver, increases species richness at the landscape scale. Oecologia. 132: 96-101.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Castor canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGTTGACTATTCTCAACAAACCATAAAGACATCGGCACGCTGTACTTGATGTTTGGTGCTTGAGCAGGGATAGTGGGAACCGCCCTAAGCCTACTAATTCGAGCAGAGCTAGGACAGCCAGGAACCCTGCTAGGAGATGACCAGATCTATAACGTTATCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATGCCAATTCTTATTGGGGGATTTGGCAATTGACTAGTGCCATTAATGATTGGAGCCCCCGATATAGCATTTCCCCGAATAAACAACATGAGCTTCTGACTTCTCCCGCCATCTTTTCTACTCCTACTGGCCTCCTCTATAGTAGAAGCCGGAGCGGGAACTGGATGAACCGTATACCCCCCACTAGCAGGCAACCTAGCTCATGCTGGAGCATCAGTAGACCTCACCATCTTTTCTCTTCACTTGGCTGGTGTATCTTCAATCCTTGGTGCCATTAATTTTATCACAACAATCATCAACATAAAACCCCCTGCAATGTCACAATACCAGACACCGTTGTTCGTGTGATCCGTCCTGGTCACTGCAGTCCTTTTACTACTCTCCTTACCAGTCCTAGCAGCCGGAATTACAATACTCTTAACCGACCGAAACCTAAACACCACTTTCTTCGACCCCGCAGGGGGAGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTAATCCTTCCAGGTTTCGGCATAATCTCCCATATCGTCACCTACTATTCAGGCAAAAAAGAACCATTTGGATACATAGGAATAGTATGAGCCATAATATCTATCGGATTCTTAGGATTTATCGTATGAGCACACCACATGTTTACAGTTGGAATAGACGTTGACACCCGAGCCTACTTTACATCCGCCACTATAATCATCGCCATCCCCACAGGAGTAAAAGTCTTCAGCTGGCTGGCCACACTTCACGGAGGCAACATCAAATGATCCCCAGCCCTACTCTGAGCCCTAGGTTTTATCTTCCTCTTCACAGTGGGCGGCCTAACAGGCATTGTCCTATCCAACTCATCCCTAGACATCGTACTACACGACACATACTACGTAGTAGCCCATTTCCACTACGTCTTATCAATAGGAGCAGTGTTCGCAATCATAGGAGGATTTGTGCACTGATTCCCACTATTTTCAGGTTATACACTAGACCAAACATGAGCAAAAATCCACTTTACTATTATATTTGTAGGGGTAAACCTGACCTTTTTCCCCCAGCACTTCCTCGGCCTGTCCGGCATGCCACGACGCTATTCTGACTACCCTGATGCTTACACAGCATGAAACACAGTATCATCAATAGGCTCCTTCATCTCCCTAACTGCAGTAATTATTATAGTCTTTATGATCTGAGAAGCATTTGCTTCTAAGCGAGAAGTAGGAGTAATCGAACTTACAACAACAAACCTAGAGTGATTACACGGATGCCCACCACCATACCATACATTCGAAGAACCTACATATGTAAAAACGCACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Castor canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North America; common; expanding populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G. & Cannings, S.)

Reviewer/s
Amori, G. & Chanson, J.S.

Contributor/s

Justification
Listed as Least Concern because it is very widespread, common in many parts of its range, it occurs in many protected areas and its populations are currently stable.

History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The conservation status differs with respect to source, but there have been significant threats to the survival of the beaver. Beavers have been hunted and trapped extensively in the past and by about 1900, the animals were almost gone in many of their original habitats. Pollution and habitat loss have also affected the survival of the beaver. In the last century, however, beavers have been successfully reintroduced to many of their former habitats.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The conservation status differs with respect to source, but there have been significant threats to the survival of the beaver. Beavers have been hunted and trapped extensively in the past and by about 1900, the animals were almost gone in many of their original habitats. Pollution and habitat loss have also affected the survival of the beaver. In the last century, however, beavers have been successfully reintroduced to many of their former habitats.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Following overexploitation for the fur trade, protection and re-introduction programs have re-established the American beaver throughout its historical range. It is now abundant. The current population size in Russia is unknown, but the population in northwest Russia is stable. In the Isla Grande of Tierra del Fuego, several factors favored a rapid population growth and range expansion (Lizarralde et al. 2004). Twenty-five mated pairs of beaver introduced in 1946, have grown to a population of 35,000-50,000 animals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Other than intensive, unregulated trapping, or extensive removal of deciduous woody plants near permanent water sources (except in circumstances where old growth is replaced by young growth), there are few threats to beaver populations. In fact, once established in an area (e.g., a watershed or drainage system), beavers often are difficult to eliminate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Overall there are no major threats to the species throughout its range. It is hunted and trapped for pelts. Many beavers are killed in areas where tree felling and dam building are in discordance with human development. It is highly sensitive to tularemia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Generally beavers easily can be reestablished in natural areas from which they have been extirpated. Simple protection from intensive trapping and, if necessary, translocation of animals trapped elsewhere are all that are needed if food supplies are adequate. Plans to reestablish beaver in an area should take into consideration the ecological and economic costs and benefits that may occur once the beavers begin building dams, cutting trees, and moving into adjacent available habitat as the population increases.

The recovery potential of sites damaged by flooding caused by beaver depends on the circumstances. In many instances (e.g., a flooded road or agricultural field) all that is needed is dewatering of the flooded area. However, little is known about the response and recovery potential of bogs and fens that have been flooded by beaver.

Management Requirements: Many areas inhabited by beaver, especially those also inhabited by humans, require active beaver management. The nature of the management depends on the particular conditions at the site and on the resource priorities established for the site (Allen 1987). In some situations beavers are desirable, whereas in other circumstances their presence may be detrimental to management goals. Often beavers present both positive and negative influences and a manager must weigh the benefits of beaver presence against the costs. The procedures discussed below cover most of the commonly encountered situations faced by those managing beavers.

The New York Department of Environmental Conservation (1991) pointed out that effective resolution of beaver-human conflicts is critical to maintaining public tolerance for beaver presence and that this tolerance is vital if the benefits of beaver presence are to be attained.

Protection of Individual Trees; Repellents

Individual trees can be protected by enclosing the bottom 1 m with heavy wire mesh, hardware cloth, or galvanized metal. The ends of the mesh should be wired together, rather than nailed to the tree. Leave enough space (about 15-30 cm) between the protective metal and the trunk to allow for tree growth; this also will prevent beavers from gnawing the bark through the mesh. Other coverings that sometimes have been successful include tar paper, Clark's tree wrap, and wood preservatives (e.g., Penta or creosote).

Commercial deer repellents (e.g., Thiram, Magic Circle, 10% solution of trinitrobenzene-aniline [TNB-A]) may deter beavers but may have an unpleasant odor (de Almeida 1987). The following results were reported in The American Tree Farmer (October 1983): full strength use of deer repellent (Magic Circle, $52 per 5 gallons in the late 1970s) was successful in repelling beavers every time. Beavers did not return when diluted repellent (1:50) was painted on the base of damaged trees along the shoreline. In a single pond in which the dam was blasted, a cord was run across the opening in the dam about 60 cm above the top of the remaining dam; rags were hung from the cord with the ends touching the dam and about 4 fluid ounces of repellent were poured on the rags; beavers did not return to the site for at least three years. In a 4-ha area occupied by beavers for 20 years, all dams were broken to a depth of 30 cm and rags were hung as described above; when diluted repellent was used, beavers rebuilt each dam within three months; with undiluted repellent, beavers did not return (frequency of reapplication was not stated). However, not all researchers have found deer repellents to be consistently effective when used as just described (Owen et al. 1984, cited by de Almeida 1987).

Another approach to protecting individual trees involves artificial feeding (leaving tree cuttings near beaver dens). This technique reduced damage to valued trees in Denver, Colorado, but obviously is not a long-term solution (Gray 1990).

Regulated Harvest Trapping and Nuisance Trapping

IMPORTANT NOTE: TRAPPING REGULATIONS VARY FROM STATE TO STATE; SOME OF THE PROCEDURES DISCUSSED IN THE FOLLOWING SECTIONS ARE ILLEGAL IN SOME STATES.

Beavers are most likely to become a management or stewardship problem when their population density is high. Regulated harvest during the furbearer trapping season is an obvious means of lowering population density and thus reducing the probability of a nuisance situation, while at the same time encouraging utilization of beaver as an economic resource. Moreover, this management approach can be employed at no cost to the landowner (trapper does the work for free in exchange for the benefits derived from the pelts obtained).

The level of harvest that is appropriate for a given area depends, of course, on management goals for that area. Annually removing about one-third of a beaver population (1.5-3 beaver per family, Ermer 1988) generally will prevent a population increase and will allow a sustained harvest (Hill 1982, Novak 1987a).

The traps usually used for beaver are no. 330 or 220 Conibear traps (kill traps), or no. 3 or no. 4 leghold traps (Hill 1982). Conibear traps are very effective and portable; time to death or unconsciousness is 1.5-9.25 minutes (Novak 1987b). Sets made with Conibear traps usually are easier to construct and can be used in a greater variety of situations than those made with leghold traps (Baker and Dwyer 1987); most professional trappers and fur trappers who are trapping principally for beaver use the no. 330 trap (Miller 1983). Two or three Conibear traps per family, set for about two weeks in winter during each of two years, effectively eliminated beaver in four Alabama watersheds (Hill 1976). Robertson (in Novak 1987b) captured 20 beavers per 100 trap nights using 330 Conibear traps in British Columbia. See Baker and Dwyer (1987) for further details on the use of Conibear traps for beaver. Novak (1987b) discusses the humane use of Conibear traps. He also describes some safety devices effective in preventing injury to the trapper. [Note: many states require first-time trappers to complete a trapper education course prior to obtaining a trapping permit. These courses demonstrate how to safely and effectively use traps.]

Leghold traps of size No. 3 or larger also are effective when properly used. To avoid escapes, these traps should be set to ensure drowning (Miller 1983). See Baker and Dwyer (1987) for further details on the use of leghold traps. These authors also describe the use of underice snare sets for capturing and killing beavers. In summary, underwater Conibear sets and drown sets employing leghold traps are recognized as legal, quick, and efficient methods for catching beavers (Tom Decker, Massachusetts Division of Fisheries and Wildlife, pers. comm.).

According to Hutchison et al. (1986), one professional trapper using water-based explosives and traps can wipe out an entire population by a single concentrated effort, with only occasional follow-up visits. These authors reported that professional trappers believe that the only way to protect timber from beaver is to remove beaver from the watershed; the trappers said that water control devices (see below) don't work, excluders (see below) are ineffective, and removing part of a population does not necessarily result in a lower water level. The trappers noted that a perpetual effort is needed to control a population if any beaver are allowed to remain in the watershed.

Miller (1983) stated that a week of trapping, especially if trapping is allowed in lodges and bank dens (prohibited by some states), usually is sufficient to remove all beavers from a single pond (cf. Novak [1987b], who reported that trappers rarely can catch all the beavers in a house). Miller noted that the removed beavers will be quickly replaced by others if beavers are common in surrounding areas. In Newfoundland, Bergerud and Miller (1977) found that one area from which beaver were removed was recolonized and occupied at former abundance levels within a few years. Miller described various effective trapping techniques and noted that it is not difficult for anyone with reasonable strength and some outdoor experience to become an effective beaver trapper.

Despite the difficulty that is sometimes encountered in totally removing beaver from an area, their confined ecological limits and low reproductive rate, together with the ease with which they may be trapped (usually), make beaver vulnerable to overharvest (Hill 1982).

Hutchison et al. (1986) pointed out a potential problem with removing beavers from an area--lowered water levels may expose the land to invasion by exotic plants. They did not provide any documentation for this point.

A final important note on kill trapping: beware of the possibility of capturing nontarget species--do not use exposed baits, which may attract raptors to sets (Bortolotti, cited in Novak 1987b); do not leave the remains of skinned animals near trap sets (may attract raptors or carnivores); properly adjust the pan tensioning devices on leghold traps (Novak 1987b).

Shooting

Hill (1982) stated that shooting can be effective in areas where boats and spotlights can be used (large rivers, lakes). According to Miller (1983), shooting rarely is effective for complete control and one's time would be better spent on trapping.

Poisoning

Hill (1976) found that strychnine alkaloid baits (sweetgum limbs painted with storax containing the poison) were consumed apparently without hesitation by both captive and wild beaver; most beavers died within 10 hours. He cautioned that additional work is needed to determine the hazards to other wildlife when the poison is used in this way. He also determined that the approximate minimal acute lethal dose of sodium monofluoroacetate (Compound 1080) was approximately 0.202 mg/kg. Hill warned that neither Compound 1080 nor strychnine are registered for use as a beaver control agent; their use for this purpose is illegal. Though initial research indicates that poisoning has some promise as a beaver control technique, political and practical considerations make it doubtful that this method ever will be an acceptable means of beaver control.

Live trapping

Sometimes a beaver problem can be alleviated by capturing and moving nuisance beavers to areas where their presence is not regarded as undesirable. It is a labor intensive, expensive method that generally is viable only when a dedicated group of volunteers is available to do the trapping and relocation. Usually Bailey or Hancock traps are used for live trapping beavers. The Hancock trap is preferable because of its greater catch efficiency and versatility (Novak 1987b). Apples and corn are effective baits (de Almeida 1987). Muller-Schwarze et al. (no date) noted that initial live trapping can be quite successful (one catch per 2-3 trap-nights). Later the beaver are more likely to avoid traps.

In some areas live trapping is not a feasible or allowable control method if the objective is to relocate the beavers. For example, the Connecticut Wildlife Bureau does not permit relocation of beavers because all suitable habitats are deemed to be saturated. As beaver populations and nuisance problems have increased, many states will not now accept beavers for relocation. Release of translocated beavers may not be appropriate in regions of high human density or where agriculture or road systems occupy low lying areas vulnerable to flooding.

Behavior and Maintenance of Live-trapped Beavers

Captured beavers can lacerate human skin with their claws and, as might be expected, can give a severe bite (Hill 1982). Some beavers may die of shock if restrained sufficiently long to attach ear tags (Hill 1982). Adults are too strong to handle without anaesthesia. Kits often can be handled without anaesthesia.

If beavers are to be penned for a few days prior to release, they should be kept wet and cool, and provided with water that they can enter for defecation (Novak 1987). Food (e.g. aspen twigs and leaves, apples) should

Novak (1987a) reviewed the literature on movements of transplanted beavers. The general pattern, based on several studies in various regions, is that a transplanted beaver may or may not move a great distance from the release site; many or most individuals can be expected to move at least a few miles, averaging perhaps 5-10 miles.

See Novak (1987) for a review of methods for tagging beavers. The most common method involves ear-tagging with No. 3 or No. 4 monel tags. Other methods employ colored or reflective markers, neck collars with lights, tattoos, tail notching, freeze-branding, fur bleaching, tetracycline, and radio collars (see Novak 1987a for references).

Immobilization

Seal and Kreeger (1987) recommended using ketamine (10 mg/kg) with acepromazine (0.2 mg/kg) in yearlings and adults; Lancia et al. (1978, in Hill 1982) reported that 10-13 mg/kg of ketamine hydrochloride plus 2.5 mg of acepromazine maleate was suitable for yearlings and adults. Ketamine alone is satisfactory for kits. The combination of ketamine and acepromazine produces sedation in 3-6 minutes with recovery in 1.5-7 hours. See Seal and Kreeger (1987) for additional information.

Biological Control There is no evidence that any nonhuman predator can be effective in controlling beaver populations.

Artificial Scent Mounds

Muller-Schwarze et al. (n.d.) found that artificial scent mounds were effective at deterring transient beaver from using existing but uninhabited lodges. Svendsen and Huntsman (1988) reported that scent mounds do not necessarily exclude nonresident beavers.

Chemosterilents

Chemosterilents have been field tested successfully on both males and females at Noxubee National Wildlife Refuge, Mississippi (Gordon and Arner 1976). The orally administered chemosterilents (17 alpha-ethynylestradiol-3-cyclopentyl ether and SC-24674 of Serle Laboratories; 1-2 mg/kg body weight, mixed with ethanol and placed in an apple), suppressed spermatogenesis and reduced ovulation and pregnancy. However effective application of this technique will have to await the development of efficient methods for treating wild beavers (Hill 1982).

Surgical Sterilization

Beavers should respond well to reproductive control because they are long-lived, apparently monogamous, and form discrete family units in which older progeny normally do not reproduce unless one or both parents are removed (Brooks et al. 1980; see also Muller-Schwarze et al., no date). Though surgical sterilization has limited application as a practical management tool, in. Denver, Colorado, where beavers are regarded as a nuisance along the Platte River Greenway and kill trapping is prohibited, the state wildlife commission funded a three-year control plan (in progress as of 1990) that involves surgical sterilization. Beavers are live-trapped by volunteers, sterilized by a volunteer veterinarian, who at the same time implants a radio transmitter. Radio-tagged beavers are being monitored by Division of Wildlife personnel. It is anticipated that the territorial behavior of the sterile animals will prevent nonsterile individuals from immigrating to the area and that population size will decrease due to lack of reproduction and immigration.

Exclusion Fencing

Fencing small critical areas such as culverts, drains, and small ponds or lakes sometimes can prevent damage, but often results in the beaver using the fence as construction material for a dam (Miller 1983).

Modification of Culverts and Beaver Dams

Important note: In some states, wetlands laws require that a permit be obtained before removing or destroying a beaver dam; this may entail a lengthy application and review process.

A common problem in beaver management is that of maintaining the water level lower than that sought by the beavers. Simply removing or breaching dams, or unplugging culverts, usually is ineffective because the beavers normally repair the damage within 24 hours. Daily destruction of dams or lodges sometimes may cause a family to relocate, but this is a labor intensive approach that is not practical in many situations. A better method of lowering the water level is to insert a drain pipe through the dam or culvert at the desired water level. In addition to decreasing the water level, an effective drain occasionally will cause the beavers to move to another site (Miller 1983). One method of drain installation, originally described by Carl Frentress, is included in Hammerson (1994) (note: most designs employ drain pipes of larger diameter than that described in this article).

Wire mesh cylinders (up to around four feet in diameter), rectangular home-made wooden pipes, and three-log drains have been used successfully to control water level in much the same way as described above. One successful design involves the use of a 4.5-m-long cylinder of concrete reinforcing mesh wrapped closely with one-inch by two-inch mesh fencing wire. This cylinder is sized to fit snugly inside a culvert (it also could be placed in a breach in a beaver dam). For most of its length, the protruding upstream end of the cylinder is surrounded by a larger-diameter cylinder of reinforcing mesh, with a six-inch space between the two-layered core cylinder and the outer mesh. Both ends of the core cylinder are capped with reinforcing mesh. The whole unit is held in place by metal fence posts driven into the pond bottom.

The three-log drain method (Arner 1963, Teaford 1986) is basically the same as the wire mesh cylinder method just described but substitutes for the wire mesh cylinder three green or waterlogged 10-16-foot logs (fastened together lengthwise, separated by spacers, and covered by roofing tin). Another technique substitutes for the wire mesh cylinder a rectangular wooden pipe that has the bottom side covered with wire mesh (Laramie 1963, Schemnitz 1980). See de Almeida (1987) and Schemnitz (1980:381) for some additional brief descriptions of drains that have been used to control water levels in beaver ponds.

Laramie (1963) noted that without monthly maintenance, about half the drain devices will fail.

Electrified Barriers

Electrified wires can be highly successful in controlling beaver flooding at sites where the activity of beavers is otherwise acceptable (Muller-Schwarze et al., n.d.). Such systems should be checked following heavy rains because rising water levels may short out the battery. The wires should be placed such that the beavers will not drag limbs behind the wire to plug a breached dam. Electrified systems work best in areas with little public exposure; otherwise vandalism probably will be a problem. Gaylord (no date) provided a description of a procedure for installing an electrified barrier.

Manipulation of the Food Supply

In the north and in the mountains, availability of a winter food supply is the most important factor affecting beaver distribution and abundance. Hence it is theoretically possible to affect beaver populations through manipulations of the vegetation. In general, activities that favor young woody deciduous growth will benefit the beaver. For example, clearing of tall hardwoods (for pine plantations) along streams along the Gulf Coast resulted in an abundance of beaver food (new growth) and nuisance complaints (Hill 1982).

According to Slough and Sadleir (1977), management of aspen, which depends primarily on fire to open up new areas for colonization, is a powerful tool in beaver management. They suggested that beaver populations (in the northern interior of British Columbia) would benefit from the protection of aspen from overuse by beaver by rotating the beaver harvest to allow aspen regeneration. In the Adirondacks of New York, Stegeman (1954) found that the size of aspen producing the greatest amount of beaver food per acre was the one-inch (2.5 cm) diameter class, which averaged 6.6 years of age. He suggested that the most advantageous rotation period for aspen for production of beaver food would be about 10 years.

Information gathered by Dieter and McCabe (1989) along a prairie river in South Dakota indicates that restricting grazing in the riparian zone would improve and expand beaver habitat.

Food supply manipulation is not an important management strategy in the south where food is not cached and where winter foods include many plant species (Hill 1982). Beier and Barrett (1987), who studied beaver habitat in the Sierra Nevada of California and Nevada, felt that the beaver's highly opportunistic food habits made it unlikely that beaver populations could be controlled through manipulation of forage resources.

Beaver, Cattle, and Stream Rehabilitation

Beavers have been used to help return to a predisturbance condition damaged streams in Wyoming and Oregon. In areas of southwestern Wyoming, overgrazing by cattle resulted in the loss of riparian vegetation, erosion, and lowering of the water table (Apple 1983, 1985). Initially an electrified fence was used to exclude livestock from a degraded stream course. This resulted in initial vegetative recovery and some bank stabilization. Then beavers were live-trapped and released in the enclosure (before complete willow recovery was attained). Several loads of aspen (stems 10-13 cm in diameter) were placed in the release sites coincident with the release of the beavers, which used the aspen to construct dams. The beaver dams changed a gully system into a pond system with adjacent meadows that benefited from the elevated water table. Willows recovered, with regrowth averaging 1.5 m tall at the end of the second year. In another degraded stream (unfenced) that beavers were attempting to colonize (but had failed to do so in the past due to their dams being too weak and washing out in spring), truck tires were wired together and placed across washed-out beaver dams. The beavers were able to build strong dams in these areas, impounding much more water than they could previously, and the dams withstood spring runoff. Mud bars and wetted sites above the dams provided excellent sites for vegetation reestablishment. The series of dams along the stream created conditions that prevented livestock from trailing up and down the stream, which aided in riparian recovery. The habitat changes induced by the beavers appeared to result in improved conditions for various wildlife species.

Munther (1981) stated that the immediate impact of cattle on a stream is often minor if beavers are established in wide valley willow habitats prior to the introduction of the cattle. Munther pointed out that in narrow valleys in western Montana, simultaneous feeding by beavers and cattle results in a gradual decline of willow and aspen due to removal of mature growth by beavers and harvest of new growth by cattle. Such a situation eventually may lead to the elimination of beaver, with subsequent further degradation of the vegetation by cattle as dams fail and the site becomes dewatered. The stream cuts a deeper channel, leaving the water table several feet lower than it was when the system was influenced by beavers. The end result is a system less suitable for both beavers and cattle. In western Montana, Munther felt that a year of rest from grazing was inadequate for rapid shrub recovery and that plantings (protected from livestock grazing) might be appropriate. He regarded the reestablishment of beaver and management for their continued presence as part of a well-conceived management strategy for grazed riparian ecosystems. Munther (1983) commented briefly on the incorporation of beavers into forest management in Lolo National Forest, Montana.

For information on the use of beaver to rehabilitate streams in Wyoming and Oregon, contact: Bruce Smith or Larry Apple, BLM, P.O. Box 1869, Rock Springs, WY 82901, and Jim R. Sedell, USFS, Forest Sciences Laboratory, Oregon State Univ., Corvallis, OR. Other contacts: Cliff Dahm, Oregon State Univ. Dept. of Fisheries and Wildlife; Greg Munther, U.S. Forest Service, Lolo National Forest, Missoula, MT 59801.

Managing Beaver Ponds for Waterfowl

Arner and Hepp (1989) discussed the importance and management of beaver ponds for waterfowl (especially mallard and wood duck) in the southeastern United States. Three situations were addressed: (1) ponds with shallow water and little emergent vegetation, (2) shallow ponds dominated by emergent vegetation, and (3) ponds with no possibilities for drainage. Recommended management techniques include installation of drains and planting of Japanese millet (in areas lacking suitable native vegetation, Teaford 1986) (situation 1); and maintaining or introducing favorable food and cover plants, and removing undesirable vegetation through burning, water-level manipulation, mechanical disturbance, and/or herbicides (situations 2 and 3). Arner and Hepp gave specific examples of favorable and unfavorable plants and provided some details on pond drains, burning, and herbicides.

Management Research Needs: Novak (1987) concluded that the following are important research needs: (1) quantification of when and how dispersing individuals die and how new colonies are established; (2) improved techniques for attaching radio transmitters; (3) development of a multiple-capture live trap, (a) for effective control of nuisance beavers, (b) to make trapping more economical for the trapper in the time it takes to catch a beaver, and (c) to enable the trapper to harvest selectively specific individuals from a group; (4) development of markets for the meat and other by-products of trapped beavers; (5) development of techniques to enable trappers to practice aspen regeneration around beaver ponds; and (6) development of techniques that can use the vast amount of data found at fur auction house. To these can be added several others, including the development of effective and efficient techniques for preventing flooding by beavers in areas where their eradication is not possible or desireable. Clearly research also is needed on the effect of the beaver on ecosystem structure and dynamics (e.g., in relation to rare wetland plants and animals).

Comments: Those working with beavers should be aware that humans can contract tularemia by handling carcasses or wet skins of infected animals, by being bitten by a tick or deer fly that already has bitten an infected animal, or by consuming infected meat or water. Symptoms of tularemia include a small ulcer, sore, or black scab where the germ penetrated, enlarged underarm lymph nodes, fever, and other complications (see Addison et al. 1987 for further details). The disease responds to the various antibiotics. A basic precaution in handling a beaver carcass is to wear rubber gloves and disinfect any equipment that may have been in direct contact with a carcass. However, tularemia is not present in beaver populations in some areas of North America.

Beavers may transmit GIARDIA LAMBLIA, a pathogenic intestinal parasite that has caused human health problems in water supply systems (von Oettingen 1982). However, research by Woo and Paterson (1986) casts doubt on the role of beaver in contaminating water supplies with GIARDIA. Human cases of giardiasis seem to be caused primarily by drinking water from lakes and streams that have been contaminated with human feces (LaBastille 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: In situations where beaver protection is desired, it is necessary to protect both aquatic and riparian habitats. Generally beavers will modify the aquatic system to make it most suitable for themselves. Protection of an adequate amount of riparian habitat to meet the food and building needs of the beavers is critical; ideally the riparian habitat to be protected should extend at least 50 m from the water and should support young deciduous woody vegetation. Along streams, about 1 km of stream channel generally is sufficient to support one beaver family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Hunting and trapping of the American beaver is regulated at the national level. Introduced populations occur in some protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Problems posed by the beaver are several. Hill (1982) and Miller (1983) listed the following as especially important: flooding of roads, fields, pastures, home sites, and septic systems; damage to timber by flooding and cutting (most serious in the southeastern U.S. where the land is relatively flat); damage to dikes, ditches, and dams (mainly in the arid western U.S. where gravity-flow irrigation systems are used); blockage of culverts and drain pipes to such an extent that they must be dynamited or otherwise removed and replaced; damage to high-value trees; and degradation of trout waters (northeastern and northcentral U.S.). Though implicated in contaminating public drinking water supplies with the pathogen Giardia lamblia, recent research has indicated that this is unlikely (Woo and Paterson 1986, cited by de Almeida 1987).

The beaver is an important fur bearer. The annual harvest of beavers from trapping is about 270,000 in the U.S., and 400,000 in Canada.

In 1990, the state of New York Department of Environmental Conservation received 1721 complaints about beavers (up from 706 in 1975 when beaver populations were much lower) and in recent years annually expended $180,000 or more (almost 75% of beaver management costs) in resolving those complaints. Along the Platte River Greenway in Denver, Colorado, beavers reportedly annually have caused $150,000-200,000 in damage to trees and landscaping. Likewise, other states are faced with similar situations. Novak (1987) concluded that the economic losses caused by beavers far surpass the value of harvested pelts (though of course beavers and their habitats have substantial economic benefits other than pelts).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Although beavers are beneficial to the environment, they can destroy it also. Dams slow the flow of water in fast streams, changing the flora and fauna and sometimes creating silting. They may flood low-lying areas, sometimes causing extensive loss of timber.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Beaver fur has been a significant trade item for the last century, creating large amounts of money for merchants.

Beavers are incredibly beneficial to the environment. They are instrumental in creating habitats for many aquatic organisms, maintaining the water table at an appropriate level and controlling flooding and erosion, all by building dams. See the Sevilleta Long-Term Eocological Research Project (LTER)/ RKM and KVP-- University of New Mexico account on the web at   http://sevilleta.unm.edu/animal/mammal/beaver.html for a more detailed explanation of the benefits of beavers in the environment.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Although beavers are beneficial to the environment, they can destroy it also. Dams slow the flow of water in fast streams, changing the flora and fauna and sometimes creating silting. They may flood low-lying areas, sometimes causing extensive loss of timber.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Beaver fur has been a significant trade item for the last century, creating large amounts of money for merchants.

Beavers are incredibly beneficial to the environment. They are instrumental in creating habitats for many aquatic organisms, maintaining the water table at an appropriate level and controlling flooding and erosion, all by building dams. See the Sevilleta Long-Term Eocological Research Project (LTER)/ RKM and KVP-- University of New Mexico account on the web at   http://sevilleta.unm.edu/animal/mammal/beaver.html for a more detailed explanation of the benefits of beavers in the environment.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Beavers may cause destruction through flooding of habitats of rare plants or animals (e.g., bog or fen species, Rawinski 1986, Rawinski and Lapin 1990; R. Radis, unpublished, who found that beaver flooding killed black spruce and other bog species along the Delaware and Kittatinny rivers).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

North American beaver

The North American beaver (Castor canadensis) is one of two extant beaver species. It is native to North America and introduced to Patagonia in South America and some European countries (e.g., Norway). In the United States and Canada, the species is often referred to simply as "beaver", though this causes some confusion because another distantly related rodent, Aplodontia rufa, is often called the "mountain beaver". Other vernacular names, including American beaver[2] and Canadian beaver,[6] distinguish this species from the other extant beaver species, Castor fiber, which is native to Eurasia.

Description[edit]

This beaver is the largest rodent in North America and the second or third largest rodent in the world, after the South American capybara. The species' Eurasian counterpart, the European beaver, reaches similarly large sizes. Adults usually weigh from 11 to 32 kg (24 to 71 lb), with 20 kg (44 lb) being a typical mass. The head-and-body length is 74–90 cm (29–35 in), with the tail adding a further 20–35 cm (7.9–13.8 in). Very old individuals can exceptionally exceed normal sizes, weighing more than 40 kg (88 lb) or even as much as 50 kg (110 lb).[7][8][9][10]

Like the capybara, the beaver is semi-aquatic. The beaver has many traits suited to this lifestyle. It has a large flat paddle-shaped tail and large, webbed hind feet reminiscent of a human diver's swimfins. The unwebbed front paws are smaller, with claws. The eyes are covered by a nictitating membrane which allows the beaver to see underwater. The nostrils and ears are sealed while submerged. A thick layer of fat under its skin insulates the beaver from its cold water environment.

The beaver's fur consists of long, coarse outer hairs and short, fine inner hairs (see Double coat). The fur has a range of colours but usually is dark brown. Scent glands near the genitals secrete an oily substance known as castoreum, which the beaver uses to waterproof its fur.

Before their near extirpation by trapping in North America, beaver were practically ubiquitous and lived from the arctic tundra to the deserts of northern Mexico, and from the Atlantic to the Pacific Oceans.[11][12] Physician naturalist Edgar Alexander Mearns' 1907 report of beaver on the Sonora River may be the southernmost extent of the range of this North American aquatic mammal.[13] However, beaver have also been reported both historically and contemporaneously in Mexico on the Colorado River, Bavispe River and San Bernardino River.[14]

Skull of a North American Beaver found on San Francisco Bay shore

Behaviour[edit]

Beaver lodge, Ontario, Canada
Beaver dam, northern California, USA
Beavers use rocks for their dams when mud and branches are less available as seen on Bear Creek, a tributary to the Truckee River, in Alpine Meadows, California.

Beavers are mainly active at night. They are excellent swimmers and may remain submerged for up to 15 minutes. More vulnerable on land, they tend to remain in the water as much as possible. They use their flat, scaly tail both to signal danger by slapping the surface of the water and as a location for fat storage.

They construct their homes, or "lodges," out of sticks, twigs, rocks and mud in lakes, streams, and tidal river deltas.[15] These lodges may be surrounded by water, or touching land, including burrows dug into river banks. They are well known for building dams across streams and constructing their lodge in the artificial pond which forms. When building in a pond, the beavers first make a pile of sticks and then eat out one or more underwater entrances and two platforms above the water surface inside the pile. The first is used for drying off. Towards winter, the lodge is often plastered with mud which when it freezes has the consistency of concrete. A small air hole is left in the top of the lodge.

The purpose of the dam is to create deep water refugia enabling the beaver to escape from predators. When deep water is already present in lakes, rivers or larger streams, the beaver may dwell in a bank burrow and bank lodge with an underwater entrance. The beaver dam is constructed using branches from trees the beavers cut down, as well as rocks, grass, and mud. The inner bark, twigs, shoots, and leaves of such trees are also an important part of the beaver's diet.[16] The trees are cut down using their strong incisor teeth. Their front paws are used for digging and carrying and placing materials. Some researchers have shown that the sound of running water dictates when and where a beaver builds its dam. Besides providing a safe home for the beaver, beaver ponds also provide habitat for waterfowl, fish, and other aquatic animals. Their dams help reduce soil erosion and can help reduce flooding. However, beaver dams are not permanent and depend on the beavers' continued presence for their maintenance. Beavers generally concentrate on building and repairing dams in the fall in preparation for the coming winter. In northern areas they often don't repair breaches in the dam made by otters, and sometimes breach the dam themselves and lower the water level in the pond in order to create more breathing space under the ice or get easier access to trees below the dam. In a 1988 study in Alberta, Canada, no beavers repaired "sites of water loss" during the winter. Of 178 sites of water loss, beavers repaired 78 when water was opened, and did not repair 68. The rest were partially repaired.[17]

Beavers are best known for their dam-building. They maintain their pond-habitat by reacting quickly to the sound of running water, and damming it up with tree branches and mud. Early ecologists believed that this dam-building was an amazing feat of architectural planning, indicative of the beaver's high intellect. This theory was questioned when a recording of running water was played in a field near a beaver pond. Despite the fact that it was on dry land, the beaver covered the tape player with branches and mud.[18] The largest beaver dam is 2,790 ft (850 m) in length—more than half a mile long—and was discovered via satellite imagery in 2007.[19] It is located on the southern edge of Wood Buffalo National Park in northern Alberta and is twice the width of the Hoover Dam which spans 1,244 ft (379 m).[20]

C. c. canadensis, feeding in winter

Normally, the purpose of the dam is to provide water around their lodges that is deep enough that it does not freeze solid in winter. The dams also flood areas of surrounding forest, giving the beaver safe access to an important food supply, which is the leaves, buds, and inner bark of growing trees. They prefer aspen and poplar, but will also take birch, maple, willow, alder, black cherry, red oak, beech, ash, hornbeam and occasionally pine and spruce.[21] They will also eat cattails, water lilies and other aquatic vegetation, especially in the early spring (and contrary to widespread belief,[22] they do not eat fish). In areas where their pond freezes over, beavers collect food in late fall in the form of tree branches, storing them underwater (usually by sticking the sharp chewed base of the branches into the mud on the pond bottom), where they can be accessed through the winter. Often the pile of food branches projects above the pond and collects snow. This insulates the water below it and keeps the pond open at that location.

Beavers usually mate for life. The young beaver "kits" typically remain with their parents for up to two years.

Brooklyn Museum - American Beaver - John J. Audubon

Common natural predators include gray wolves, coyotes, and mountain lions. Beaver can be particularly important food for lone wolves.[23] American black bears may also prey on beavers if the opportunity arises, often by smashing their paws into the beaver's lodges.[24][25][26] Perhaps due to differing habitat preferences, Brown bears were not known to hunt beavers in Denali National Park.[27] Less significant predators include wolverines, Canadian lynx, bobcats, and fox, which are increasingly unlikely to take full-grown beavers due to their smaller size, and American alligators, which only minimally co-exist with beavers. Both Golden Eagles (Aquila chrysaetos) and Bald Eagles (Haliaeetus leucocephalus) may on occasion predate a beaver, most likely only small kits.[28] Despite repeated claims there is no evidence that river otters are predators of beavers.[29]

Reproduction[edit]

North American beaver have one litter per year, coming into estrus for only 12 to 24 hours, between late December and May but peaking in January. Unlike most other rodents, beaver pairs are monogamous, staying together for multiple breeding seasons. Gestation averages 128 days and they average two to three kits per litter with a range of two to six kits.[30] Most beaver do not reproduce until they are three years of age, but about 20% of two-year-old females reproduce.[31]

Subspecies[edit]

The first fossil records of beaver are 10 to 12 million years old in Germany, and they are thought to have migrated to North America across the Bering Strait. The oldest fossil record of beaver in North America are of two beaver teeth near Dayville, Oregon and are 7 million years old.[32]

At one time, 25 subspecies of beaver were identified in North America, with distinctions based primarily on slight morphological differences and geographical isolation at the time of discovery. However, modern techniques generally use genetics rather than morphology to distinguish between subspecies, and currently the Integrated Taxonomic Information System, (which provides authoritative taxonomic information on plants, animals, fungi, and microbes of North America and the world), does not recognize any subspecies of C. canadensis, though a definitive genetic analysis has not been performed. Such an analysis would be complicated by the fact that there has been substantial genetic mixing of populations because of the numerous reintroduction efforts intended to help the species recover following extirpation from many regions.

The most widespread (formerly recognized) subspecies, which perhaps are now best thought of as populations with some distinct physical characteristics, are C. c. acadicus (New England beaver), C. c. canadensis (Canadian beaver), C. c. carolinensis (Carolina beaver), and C. c. missouriensis (Missouri River beaver).[33] The Canadian beaver originally inhabited almost all of the forested area of Canada,[34] and because of its more valued fur, was often selected for reintroductions elsewhere. The Carolina beaver is found in the southeastern United States, the Missouri River beaver, as its name suggests, is found in the Missouri River and its tributaries, and C. c. acadicus is found throughout the New England area in the northeastern United States.

Differences from European beaver[edit]

Although superficially similar to the European beaver (Castor fiber), there are several important differences between the two species. North American beavers tend to be slightly smaller, with smaller, more rounded heads, shorter, wider muzzles, thicker, longer and darker underfur, wider, more oval-shaped tails and have longer shin bones, allowing them a greater range of bipedal locomotion than the European species. North American beavers have shorter nasal bones than their European cousins, with the widest point being at the middle of the snout for the former, and in the tip for the latter. The nasal opening for the North American species is square, unlike that of the European race which is triangular. The foramen magnum is triangular in the North American beaver, and rounded in the European. The anal glands of the North American beaver are smaller and thick-walled with a small internal volume compared to that of the European species. Finally, the guard hairs of the North American beaver have a shorter hollow medulla at their tips. Fur colour is also different. Overall, 50% of North American beavers have pale brown fur, 25% are reddish brown, one fifth are brown and 6% are blackish, while in European beavers 66% have pale brown or beige fur, 20% have reddish brown, nearly 8% are brown and only 4% have blackish coats.[35]

The two species are not genetically compatible. North American beavers have 40 chromosomes, while European beavers have 48. Also, more than 27 attempts were made in Russia to hybridize the two species, with one breeding between a male North American beaver and a female European resulting in one stillborn kit. These factors make interspecific breeding unlikely in areas where the two species' ranges overlap.[35]

Ecology[edit]

The beaver was trapped out and almost extirpated in North America as its fur and castoreum were highly sought after.[12] The beaver furs were used to make clothing and beaver hats. In the United States extensive trapping began in the early 17th century with more than 10,000 beaver per year taken for the fur trade in Connecticut and Massachusetts between 1620 and 1630.[36] From 1630 to 1640, approximately 80,000 beaver were taken annually from the Hudson River and western New York.[37] From 1670 onwards, the Hudson's Bay Company sent two or three trading ships into the bay every year to take furs to England from Canada. As eastern beaver populations were depleted, English, French and American trappers pushed west. Much of the westward expansion and exploration of North America was driven by the quest for this animal's fur. Before the 1849 California Gold Rush, there was an earlier 19th century California Fur Rush which drove the earliest American settlement in that State. During the approximately 30 years (1806–1838) of the era of the Mountain Man, the West from Missouri to California and from Canada to Mexico was thoroughly explored and the beaver was brought to the brink of extinction.

With protection in the late 19th and early 20th centuries the current beaver population has rebounded to an estimated 10 to 15 million; this is a fraction of the originally estimated 100 to 200 million North American beaver before the days of the fur trade.[38][39]

These animals are considered pests in parts of their range because their dams can cause flooding, or because their habit of felling trees can pose danger to people, as in Charlotte, North Carolina's Park Road Park.[40] Because they are persistent in repairing damage to the dam, they were historically relocated or exterminated. Non-lethal methods of containing beaver-related flooding have been developed.[41] One such flow device has been utilized by both the Canadian and U.S. governments, called "Beaver Deceivers," or levelers, invented and pioneered by wildlife biologist, Skip Lisle.[42]

The beaver is a keystone species, increasing biodiversity in its territory through creation of beaver ponds and wetlands.[43] As wetlands are formed and riparian habitats enlarged, aquatic plants colonize newly available watery habitat. Insect, invertebrate, fish, mammal, and bird diversity are also expanded.[44]

Effects on stream flows and water quality[edit]

Beaver ponds increase stream flows in seasonally dry streams by storing run-off in the rainy season, which raises groundwater tables via percolation from beaver ponds. In a recent study using 12 serial aerial photo mosaics from 1948 to 2002, the impact of the return of beaver on open water area in east-central Alberta, Canada found that the mammals were associated with a 9-fold increase in open water area. Beaver returned to the area in 1954 after a long absence since their extirpation by the fur trade in the 19th century. During drought years, where beaver were present, there was 60% more open water than those same areas during previous drought periods when beaver were absent. The authors concluded that beaver have a dramatic influence on the creation and maintenance of wetlands even during extreme drought.[45][46]

From streams in the Maryland coastal plain to Lake Tahoe, beaver ponds have been shown to remove sediment and pollutants including total suspended solids, total nitrogen, phosphates, carbon and silicates, improving stream water quality.[47][48] In addition, fecal coliform and streptococci bacteria excreted into streams by grazing cattle are reduced by beaver ponds, where slowing currents lead to settling of the bacteria in bottom sediments.[49]

The term "beaver fever" is a misnomer coined by the American press in the 1970s, following findings that the parasite Giardia lamblia, which causes Giardiasis, was putatively carried by beavers. Further research has shown that many animals and birds carry this parasite, and the major source of water contamination is by humans.[50][51][52] Recent concerns point to domestic animals as a significant vector of giardia with young calves in dairy herds testing as high as 100% positive for giardia.[53] In addition, fecal coliform and streptococci bacteria excreted into streams by grazing cattle have been shown to be reduced by beaver ponds, where the bacteria are trapped in bottom sediments.[49] New Zealand has giardia outbreaks but no beaver, whereas Norway has plenty of beaver but had no giardia outbreaks until recently (in a southern part of Norway densely populated by humans but no beaver).[54]

Effects on bird abundance and diversity[edit]

Canada Goose nest on beaver lodge

Beaver help waterfowl by creating increased areas of water, and in northerly latitudes they thaw areas of open water, allowing an earlier nesting season.[55] In a study of Wyoming streams and rivers, watercourses with beaver had 75-fold more ducks than those without.[56]

Trumpeter swans (Cygnus buccinator) and Canada geese (Branta canadensis) often depend on beaver lodges as nesting sites.[44][57][58] Canada's small trumpeter swan population was observed not to nest on large lakes, preferring instead to nest on the smaller lakes and ponds associated with beaver activity.[59][60]

Beaver may benefit birds frequenting their ponds in several additional ways. Removal of some pondside trees by beavers would increase the density and height of the grass–forb–shrub layer, which enhances waterfowl nesting cover adjacent to ponds.[61] Both forest gaps where trees had been felled by beaver and a "gradual edge" described as a complex transition from pond to forest with intermixed grasses, forbs, saplings, and shrubs are strongly associated with greater migratory bird species richness and abundance.[62] Coppicing of waterside willows and cottonwoods by beavers leads to dense shoot production which provides important cover for birds and the insects they feed on.[63] Widening of the riparian terrace alongside streams is associated with beaver dams and has been shown to increase riparian bird abundance and diversity, an impact that may be especially important in semi-arid climates.[64]

As trees are drowned by rising beaver impoundments they become ideal nesting sites for woodpeckers, who carve cavities that attract many other bird species including flycatchers (Empidonax spp.), tree swallows (Tachycineta bicolor), tits (Paridae spp.), wood ducks (Aix sponsa), goldeneyes (Bucephala spp.), mergansers (Mergus spp.), owls (Tytonidae, Strigidae) and American kestrels (Falco sparverius).[44] Piscivores, including herons (Ardea spp.), grebes (Podicipedidae), cormorants (Phalacrocorax ssp.), American bitterns (Botaurus lentiginosa), great egret (Ardea alba), snowy egret (Egretta thula), mergansers and belted kingfishers (Megaceryle alcyon), utilize beaver ponds for fishing. Hooded mergansers (Lophodytes cucullatus), green heron (Butorides virescens), great blue heron (Ardea herodias) and belted kingfisher occurred more frequently in New York wetlands where beaver were active than at sites with no beaver activity.[65]

Effects on trout and salmon[edit]

Salmon (Oncorhynchus nerka) jumping beaver dam

Beaver ponds as rearing habitat for salmonids[edit]

Beaver ponds have been shown to have a beneficial effect on trout and salmon populations. Many authors believe that the decline of salmonid fishes is related to the decline in beaver populations. Research in the Stillaguamish River basin in Washington state, found that extensive loss of beaver ponds resulted in an 89% reduction in coho salmon (Oncorhynchus kisutch) smolt summer production and an almost equally detrimental 86% reduction in critical winter habitat carrying capacity.[66] This study also found that beaver ponds increased smolt salmon production 80 times more than the placement of large woody debris.[66] Swales and Leving had previously shown on the Coldwater River in British Columbia that off-channel beaver ponds were preferentially populated by coho salmon over other salmonids and provided overwintering protection, protection from high summer snowmelt flows and summer coho rearing habitat.[67] The presence of beaver dams has also been shown to either increase the number of fish, their size, or both, in a study of brook trout (Salvelinus fontinalis), rainbow trout (Oncorhynchus mykiss) and brown trout (Salmo trutta) in Sagehen Creek, which flows into the Little Truckee River at an altitude of 5,800 feet in the northern Sierra Nevada.[68] These findings are consistent with a study of small streams in Sweden, that found that brown trout were larger in beaver ponds compared with those in riffle sections, and that beaver ponds provide habitat for larger trout in small streams during periods of drought.[69] Similarly, brook trout, coho salmon and sockeye salmon (Oncorhynchus nerka) were significantly larger in beaver ponds than those in un-impounded stream sections in Colorado and Alaska.[70][71] In a recent study on a headwater Appalachian stream, brook trout were also larger in beaver ponds.[72]

Beaver ponds are generally not barriers to trout and salmon passage[edit]

Contrary to popular myth, most beaver dams do not pose barriers to trout and salmon migration, although they may be restricted seasonally during periods of low stream flows.[73] In a meta-review of studies claiming that beaver dams act as fish passage barriers Kemp et al. found that 78% of these claims were not supported by any data.[74] In a 2013 study of radiotelemetry-tagged Bonneville cutthroat trout (Oncorhynchus clarki utah) and brook trout (Salvelinus fontinalis) in Utah, both of these fish species crossed beaver dams in both directions, including dams up to 2 metres (6.6 ft) high.[75] Rainbow, brown and brook trout have been shown to cross as many as 14 consecutive beaver dams.[68] Both adults and juveniles of coho salmon, steelhead trout, sea run cutthroat (Oncorhyncus clarki clarki), Dolly Varden trout (Salvelinus malma malma), and sockeye salmon are able to cross beaver dams.[73] In southeast Alaska, coho jumped dams as high as two meters, were found above all beaver dams and had their highest densities in streams with beaver.[76] In Oregon coastal streams, beaver dams are ephemeral and almost all wash out in high winter flows only to be re-built every summer.[77] Migration of adult Atlantic salmon (Salmo salar) may be limited by beaver dams but the presence of juveniles upstream from the dams suggests that the dams are penetrated by parr.[78] Downstream migration of Atlantic salmon smolts was similarly unaffected by beaver dams, even in periods of low flows.[78] Two year old Atlantic salmon parr in beaver ponds in eastern Canada showed faster summer growth in length and mass and were in better condition than parr upstream or downstream from the pond.[79]

Beaver ponds play an important role in winter survival of salmonids[edit]

The importance of winter habitat to salmonids afforded by beaver ponds may be especially important (and underappreciated) in streams without deep pools or where ice cover makes contact with the bottom of shallow streams. Enos Mills wrote in 1913, "One dry winter the stream...ran low and froze to the bottom, and the only trout in it that survived were those in the deep holes of beaver ponds."[80] Cutthroat trout (Oncorhynchus clarki) and bull trout (Salvelinus confluentus) were noted to overwinter in Montana beaver ponds, brook trout congregated in winter in New Brunswick and Wyoming beaver ponds, and coho salmon in Oregon beaver ponds.[78] In 2011 a meta-analysis of studies of beaver impacts on salmonids found that beaver were a net benefit to salmon and trout populations primarily by improving habitat (building ponds) both for rearing and overwintering and that this conclusion was based over half the time on scientific data. In contrast, the most often cited negative impact of beavers on fishes were barriers to migration although that conclusion was based on scientific data only 22% of the time. They also found that when beaver dams do present barriers that these are generally short-lived, as the dams are overtopped, blown out, or circumvented by storm surges.[74]

Beavers create channel complexity important to salmonid survival[edit]

By creating additional channel network complexity, including ponds and marshes laterally separated from the main channel, beavers may play a role in the creation and maintenance of fish biodiversity.[81] In off-mainstem channels restored by beaver on the middle section of Utah's Provo River, native fish species persist even when they have been extirpated in the mainstem channel by competition from introduced non-native fish.[82] Efforts to restore salmonid habitat in the western United States have focused primarily on establishing large woody debris in streams to slow flows and create pools for young salmonids. Research in Washington state found that the average summer smolt production per beaver dam ranges from 527 to 1,174 fish, whereas the summer smolt production from a pool formed by instream large woody debris is about 6–15 individuals, suggesting that re-establishment of beaver populations would be 80 times more effective.[66]

Beavers live in tidal estuaries and may impact fish in estuarine systems[edit]

Recently, beaver have been discovered living in brackish water in estuarine tidal marshes, where Chinook salmon (Oncorhynchus tshawytscha) densities were five times higher in beaver ponds than in neighboring areas.[15][83]

Effects on riparian trees and vegetation[edit]

Tree felled by beaver (C. c. canadensis), diameter 20 cm

Conventional wisdom has held that beaver girdle and fell trees and that they diminish riparian trees and vegetation, but the opposite appears to be true when studies are conducted longer-term. In 1987, Beier reported that beaver had caused local extinction of Quaking aspen (Populus tremuloides) and Black cottonwood (Populus trichocarpa) on 4–5% of stream reaches on the lower Truckee River in the Sierra Nevada mountains, however Willow (Salix spp.) responded by re-growing vigorously in most reaches. He further speculated that without control of beaver populations that aspen and cottonwood could go extinct on the Truckee River.[84] Not only have aspen and cottonwood survived ongoing beaver colonization, but a recent study of ten Sierra Nevada streams in the Lake Tahoe basin utilizing aerial multispectral videography has shown that deciduous, thick herbaceous, and thin herbaceous vegetation are more highly concentrated near beaver dams, whereas coniferous trees are decreased.[85] These findings are consistent with those of Pollock, who reported that in Bridge Creek, a stream in semi-arid eastern Oregon, the width of riparian vegetation on stream banks was increased several-fold as beaver dams watered previously dry terraces adjacent to the stream.[86] In a second study of riparian vegetation based on observations of Bridge Creek over a 17 year time period, although portions of the study reach were periodically abandoned by beaver following heavy utilization of streamside vegetation, within a few years dense stands of woody plants of greater diversity occupied a larger portion of the floodplain. Although black cottonwood and thinleaf alder did not generally re-sprout after beaver cutting, they frequently grew from seeds landing on freshly exposed alluvial deposits secondary to beaver activity.[87] Therefore, beaver appear to increase riparian vegetation given enough years to aggrade sediments and pond heights sufficiently to create widened, well-watered riparian zones, especially in areas of low summer rainfall.

The surface of beaver ponds are typically at or near bank-full, so even small increases in stream flows cause the pond to overflow its banks. Thus, high stream flows spread water and nutrients beyond the stream banks to wide riparian zones when beaver dams are present.

Finally, beaver ponds may serve as critical firebreaks in fire-prone areas.[88]

Beavers and stream restoration[edit]

In the 1930s, the U.S. Government put 600 beaver to work alongside the Civilian Conservation Corps in projects to stop soil erosion by streams in Oregon, Washington, Wyoming, and Utah. At the time it was estimated that each beaver, whose initial cost was about $5, completed work worth $300.[89]

In a pilot study in Washington state, the Lands Council is reintroducing beavers to evaluate their projections that if 10,000 miles of suitable habitat were repopulated then 650 trillion gallons of spring runoff would be held back for release in the arid Autumn season.[90] This project was developed in response to a 2003 Washington Department of Ecology proposal to spend as much as $10 billion on construction of several dams on Columbia River tributaries to retain storm season runoff.[91] The State of Utah published a Beaver Management Plan which includes re-establishing beavers in ten streams per year for the purpose of watershed restoration each year from 2010 through 2020.[92]

Urban beavers[edit]

Beaver before being drowned by trapper's snare in Lincoln Park, Chicago 2008
After trapping, beaver lodge re-appears in Lincoln Park, Chicago Fall, 2009

After 200 years, a beaver returned to New York City in 2007, making its home along the Bronx River, having spent time living at the Bronx Zoo as well as the Botanical Gardens.[93] Beavers have not lived in New York City since the early 19th century when trappers extirpated them completely from the state.[94] The return of "José", named after Representative Jose Serrano from the Bronx, has been seen as evidence that efforts to restore the river have been successful.[95][96][97] In the summer of 2010 a second beaver name "Justin" joined José, doubling the beaver population in New York City.[98] In February 2013 what appears to be both José and Justin were caught on motion-sensitive cameras at the New York Botanical Garden.[99] Beaver were once important to the city's economy and a pair of beavers appears on the city's official seal and flag.

In Chicago, several beavers have returned and made a home near the Lincoln Park's North Pond. The "Lincoln Park Beaver" has not been as well received by the Chicago Park District and the Lincoln Park Conservancy, which was concerned over damage to trees in the area. In March 2009, they hired an exterminator to remove a beaver family using live traps, and accidentally killed the mother when she got caught in a snare and drowned.[100] Relocation costs $4,000–$4,500 per animal. Scott Garrow, District Wildlife Biologist with the Illinois Department of Natural Resources, opined that relocating the beavers may be "a waste of time", as there are records of beaver recolonizing North Pond in Lincoln Park in 1994, 2003, 2004, 2008 and 2009.[100][101][102][103] As of fall 2009 a new beaver lodge has appeared on North Pond's northwest bank.

Outside San Francisco, in downtown Martinez, California, a male and female beaver arrived in Alhambra Creek in 2006.[104] The Martinez beavers built a dam 30 feet wide and at one time 6 feet high, and chewed through half the willows and other creekside landscaping the city planted as part of its $9.7 million 1999 flood-improvement project. When the City Council wanted to remove the beavers because of fears of flooding, local residents organized to protect them, forming an organization called "Worth a Dam".[105] Resolution included installation of a flow device through the beaver dam so that the pond's water level could not become excessive. Now protected, the beaver have transformed Alhambra Creek from a trickle into multiple dams and beaver ponds, which in turn, led to the return of steelhead trout and river otter in 2008, and mink in 2009.[106][107] The Martinez beavers probably originated from the Sacramento-San Joaquin River Delta which once held the largest concentration of beaver in North America.[108]

In 1999, Washington, D.C.'s annual Cherry Blossom Festival was plagued by a family of beavers who lived in the Tidal Basin. The offenders were caught and removed, but not before damaging 14 cherry trees, including some of the largest and oldest trees.[109][110]


As introduced non-native species[edit]

Beaver damage on the north shore of Robalo Lake, Navarino Island, Chile

In the 1940s, beavers were brought to the island of Tierra Del Fuego in southern Chile and Argentina for commercial fur production and introduced near Fagnano Lake. Although the fur enterprise failed, 25 mating pairs of beavers were released into the wild. Having no natural predators in their new environment, they quickly spread throughout the island, and to other islands in the region, reaching a number of 100,000 individuals within just 50 years. Although they have been considered an invasive species, it has been more recently shown that the beaver have some beneficial ecological effects on native fish and should not be considered wholly detrimental.[111] Although the dominant Lenga beech (Nothofagus pumilio) forest can regenerate from stumps, most of the newly created beaver wetlands are being colonized by the rarer native Antarctic beech (Nothofagus antarctica). It is not known whether the shrubbier Antarctic beech will be succeeded by the originally dominant and larger Lengo beech, however, and the beaver wetlands are readily colonized by non-native plant species.[111] In contrast, areas with introduced beaver were associated with increased populations of the native catadromous puye fish (Galaxias maculatus).[112][113] Furthermore, the beavers did not seem to have a highly beneficial impact on the exotic brook trout (Salvelinus fontinalis) and rainbow trout (Oncorhynchus mykiss) which have negative impacts on native stream fishes in the Cape Horn Biosphere Reserve, Chile.[113] They have also been found to cross saltwater to islands northward; and reached the Chilean mainland in the 1990s.[114] On balance, because of their landscape-wide modifications to the Fuegian environment and because biologists want to preserve the unique biota of the region, most favor their removal.[115]

As food[edit]

Beaver meat is similar tasting to lean beef, but care must be taken to prevent contamination from the animal's strong castor (musk) gland. It is usually slow-cooked in a broth, and was a valuable food source to Native Americans.[citation needed] Early French Canadian Catholics considered beaver to be "four-legged fish" that could be eaten at Lent.[116]

Despite their name, the fried pastries found in parts of Canada called beaver tails contain no beaver.

Symbolism[edit]

Beaver sculpture over entrance to Canadian Parliament Building

As the national animal and one of the national symbols of Canada,[117] the beaver is depicted on the Canadian five-cent piece[117] and was on the first Canadian postage stamp, the Three Penny Beaver. It is also the state animal of Oregon and New York, and a common school emblem for engineering schools, including the California Institute of Technology, the Massachusetts Institute of Technology, and the University of Alberta as well as the mascot for Oregon State University, Babson College, and the City College of New York. The beaver also appears in the coats of arms of the Hudson's Bay Company,[118] University of Toronto, Wilfrid Laurier University, and the London School of Economics.

Much of the early economy of New Netherland was based on the beaver fur trade. As such, the seal of New Netherland featured the beaver; likewise, the coats of arms of Albany, New York and New York City included the beaver.

See also[edit]

References[edit]

  1. ^ Linzey, A. V. & NatureServe (Hammerson, G. & Cannings, S.) (2011). "Castor canadensis". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved January 18, 2012. 
  2. ^ a b Helgen, K. M. (2005). "Family Castoridae". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 842. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Warner, Richard E. and Hendrix, Kathleen M. (eds.). California Riparian Systems: Ecology, Conservation, and Productive Management University of California Press, 1984, p. 952. Retrieved on August 4, 2007.
  4. ^ Browse Genus equals Castor by Scientific Name for All Museums. Berkeley Natural History Museums. Retrieved on August 4, 2007.
  5. ^ Tesky, Julie L. Wildlife Species: Castor canadensis Fire Effects Information System (Online), U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory. 1993. Retrieved on August 4, 2007.
  6. ^ Invasive Species Specialist Group (ISSG) (2006). "Castor canadensis (mammal)". Global Invasive Species Database (GISD). IUCN Species Survival Commission. Retrieved July 16, 2009: "Common names: American beaver (English), beaver (English), Canadian beaver, castor (French), castor americano (Spanish), North American beaver (English)" 
  7. ^ "Home Page, Alaska Department of Fish and Game". Adfg.state.ak.us. Retrieved March 16, 2013. 
  8. ^ The Beaver – Life Tracks. Timberwolfinformation.org
  9. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  10. ^ Boyle, Steve and Owens, Stephanie (February 6, 2007) North American Beaver (Castor canadensis): A Technical Conservation Assessment. USDA Forest Service, Rocky Mountain Region
  11. ^ Morgan, Lewis H. (1868). The American Beaver and his Works. J. B. Lippincott & Co. p. 32. 
  12. ^ a b Naiman, Robert J.; Johnston, Carol A. and Kelley, James C. (Dec 1988). "Alteration of North American Streams by Beaver". BioScience: 753–762. Retrieved Feb 28, 2010. 
  13. ^ Mearns, Edgar Alexander (1907). Mammals of the Mexican boundary of the United States: A descriptive catalogue of the species of mammals occurring in that region; with a general summary of the natural history, and a list of trees. Government Printing Office. p. 359. 
  14. ^ Gallo-Reynoso, Juan-Pablo; Suarez-Gracida, Gabriela; Cabrera-Santiago, Horacia; Coria-Galindo, Else; Egido-Villarreal, Janitzio and Ortiz, Leo C. (Sep 2002). "Status of Beavers (Castor Canadensis Frontador) in Rio Bavispe, Sonora, Mexico". The Southwestern Naturalist. Retrieved November 25, 2011. 
  15. ^ a b Mapes, Lynda V. (May 18, 2009). "Scientist discovers beavers building prime salmon habitat in Skagit Delta". The Seattle Times. Retrieved June 22, 2010. 
  16. ^ Gallant, D., Bérubé, C.H.; Tremblay, E. and Vasseur, L. (2004). "An extensive study of the foraging ecology of beavers (Castor canadensis) in relation to habitat quality". Canadian Journal of Zoology 82 (6): 922–933. doi:10.1139/z04-067. Retrieved May 4, 2010. 
  17. ^ Donald G. Reid, Stephen M. Herrero and Thomas E. Code, "River Otters as Agents of Water Loss from Beaver Ponds," Journal of Mammalogy, February 1988.
  18. ^ Richard P.B. (1983). "Mechanisms and adaptation in the constructive behaviour of the beaver (C. fiber L.)". Acta Zoologica Fennica 174: 105–108. 
  19. ^ Thie, Jean. "National Geographic photos". Geostrategis.com. Retrieved March 16, 2013. 
  20. ^ Soodin, Vince. "Beaver Dam Seen from Space". The Sun. Retrieved May 5, 2010. 
  21. ^ Müller-Schwarze, Dietland and Sun, Lixing (2003). The Beaver: Natural History of a Wetlands Engineer. Cornell University Press. pp. 67–75. ISBN 978-0-8014-4098-4. 
  22. ^ Young, Mary Taylor (August 13, 2007). Colorado Division of Wildlife: Do Beavers Eat Fish? at the Wayback Machine (archived September 10, 2010) wildlife.state.co.us
  23. ^ Thurber, J. M., & Peterson, R. O. (1993). Effects of population density and pack size on the foraging ecology of gray wolves. Journal of Mammalogy, 879-889.
  24. ^ "The American Bear Association Home Page (Web Pages2/index)". The American Bear Association. 
  25. ^ "Adirondack Black Bears". Environmental Information Series. 
  26. ^ Smith, D. W., Trauba, D. R., Anderson, R. K., & Peterson, R. O. (1994). Black bear predation on beavers on an island in Lake Superior. American Midland Naturalist, 248-255.
  27. ^ Engelhart, A., & Müller-Schwarze, D. (1995). Responses of beaver (Castor canadensis Kuhl) to predator chemicals. Journal of Chemical Ecology, 21(9), 1349-1364.
  28. ^ "Beaver". Study of Northern Virginia Ecology, Fairfax County Public School. Retrieved 2013-01-03. 
  29. ^ Müller-Schwarze, Dietland and Sun, Lixing (2003). The Beaver: Natural History of a Wetlands Engineer. Cornell University Press. pp. 113–114. ISBN 978-0-8014-4098-4. 
  30. ^ "Beaver Biology". Beaver Solutions. Retrieved 22 November 2013. 
  31. ^ Müller-Schwarze, Dietland and Sun, Lixing (2003). The Beaver: Natural History of a Wetlands Engineer. Cornell University Press. p. 80. ISBN 978-0-8014-4098-4. 
  32. ^ "N. America's Earliest Beaver Found Near Dayville – Discovered Teeth "A Dam Important Find,' Scientists Say". KVTZ. September 19, 2011. Retrieved September 20, 2011. 
  33. ^ Baker, B. W., and E. P. Hill. Beaver (Castor canadensis). G. A. Feldhamer, B. C. Thompson, and J. A. Chapman, editors. Wild Mammals of North America: Biology, Management, and Conservation. Second Edition. The Johns Hopkins University Press, Baltimore, Maryland, USA, pp. 288–310. 2003. Retrieved on August 4, 2007.
  34. ^ Kieffer, Michael Meadows in Mist Bull Run Mountains Conservancy, Inc. Retrieved on August 4, 2007.
  35. ^ a b Kitchener, Andrew (2001). Beavers. p. 144. ISBN 1-873580-55-X. 
  36. ^ Moloney, F. X. (1967). The Fur Trade in New England, 1620–1676. Hamden, Connecticut: Archon Books. p. 150. 
  37. ^ Hays, W. J. (Sep 1871). "Notes on the range of some of the animals in America at the time of arrival of the whitemen". The American Naturalist 5 (7): 25–30. doi:10.1086/270797. JSTOR 2447602. 
  38. ^ Seton-Thompson, cited in Sun, Lixing; Müller-Schwarze, Dietland (2003). The Beaver: Natural History of a Wetlands Engineer. Ithaca, NY: Cornell University Press. pp. 97–98. ISBN 0-8014-4098-X. ; but note that to arrive at this figure he assumed a population density throughout the range equivalent to that in Algonquin Park
  39. ^ Outwater, Alice (1997). Water:A Natural History. New York, NY: Basic Books. p. 89. ISBN 0-465-03780-1. 
  40. ^ Parks, Mike (March 1, 2012). "South Charlotte Weekly: Beavers damaging Park Road Park; must go". Thecharlotteweekly.com. 
  41. ^ "Beavers: Wetlands & Wildlife: Solutions to Beaver/Human Conflicts". Beaversww.org. Retrieved March 16, 2013. 
  42. ^ Agar, Charles (March 24, 2008). "Beaver Deceiver expert coming to Pitkin County". The Aspen Times (Aspen, Colorado). Retrieved Nov 22, 2009. 
  43. ^ Wright, J.P.; Jones, C.G.; Flecker, A.S. (2002). "An ecosystem engineer, the beaver, increases species richness at the landscape scale". Oecologia 132 (1): 96–101. doi:10.1007/s00442-002-0929-1. Retrieved March 1, 2010. 
  44. ^ a b c Rosell F, Bozser O, Collen P, Parker H (2005). "Ecological impact of beavers Castor fiber and Castor canadensis and their ability to modify ecosystems". Mammal Review 35 (3–4): 248–276. doi:10.1111/j.1365-2907.2005.00067.x. Retrieved March 1, 2010. 
  45. ^ Hood, Glynnis A. and Bayley, Suzanne E. (2008). "Beaver (Castor canadensis) mitigate the effects of climate on the area of open water in boreal wetlands in western Canada". Biological Conservation: 556–567. doi:10.1016/j.biocon.2007.12.003. 
  46. ^ "Busy Beavers Can Help Ease Drought". Science Daily. February 26, 2008. Retrieved February 23, 2011. 
  47. ^ Correll, David L.; Jordan, Thomas E. and Weller, Donald E. (June 2000). "Beaver pond biogeochemical effects in the Maryland Coastal Plain". Biogeochemistry 49 (3): 217–239. doi:10.1023/A:1006330501887. JSTOR 1469618. 
  48. ^ Muskopf, Sarah (October 2007). The Effect of Beaver (Castor canadensis) Dam Removal on Total Phosphorus Concentration in Taylor Creek and Wetland, South Lake Tahoe, California (Thesis). Humboldt State University, Natural Resources. Retrieved February 27, 2011. 
  49. ^ a b Skinner, Quentin D.; Speck, John E.; Smith, Michael and Adams, John C. (March 1984). "Stream Water Quality as Influenced by Beaver within Grazing Systems in Wyoming". Journal of Range Management 37 (2): 142–146. doi:10.2307/3898902. JSTOR 3898902. 
  50. ^ Gaywood, Martin; Batty, Dave and Galbraith, Colin (2008). "Reintroducing the European Beaver in Britain". British Wildlife. Retrieved March 26, 2011. 
  51. ^ Erlandsen, S. L., and Bemrick, W. J. (1988). Waterborne giardiasis: sources of Giardia cysts and evidence pertaining to their implication in human infection in P. M. Wallis and B. R. Hammond (ed.), Advances in Giardia research. Calgary, Alberta, Canada: University of Calgary Press. pp. 227–236. 
  52. ^ Erlandsen SL, Sherlock LA, Bemrick WJ, Ghobrial H, Jakubowski W (January 1990). "Prevalence of Giardia spp. in Beaver and Muskrat Populations in Northeastern States and Minnesota: Detection of Intestinal Trophozoites at Necropsy Provides Greater Sensitivity than Detection of Cysts in Fecal Samples". Applied and Environmental Microbiology 56 (1): 31–36. PMC 183246. PMID 2178552. Retrieved March 26, 2011. 
  53. ^ Thompson, R. C. A. (November 2000). "Giardiasis as a re-emerging infectious disease and its zoonotic potential". International Journal of Parasitology 30 (12–13): 1259–1267. doi:10.1016/S0020-7519(00)00127-2. PMID 11113253. 
  54. ^ Nygård, Karin; Schimmer, Barbara; Søbstad, Øystein; Walde, Anna; Tveit, Ingvar; Langeland, Nina; Hausken, Trygve and Aavitsland, Preben (2006). "A large community outbreak of waterborne giardiasis-delayed detection in a non-endemic urban area". BMC Public Health. Retrieved November 26, 2011. 
  55. ^ Bromley, Chantal K. and Hood, Glynnis A. (2013). "Beavers (Castor canadensis) facilitate early access by Canada geese (Branta canadensis) to nesting habitat and areas of open water in Canada's boreal wetlands". Mammalian Biology 78 (1): 73–77. doi:10.1016/j.mambio.2012.02.009. Retrieved February 14, 2013. 
  56. ^ McKinstry, M. C.; Caffrey, P. and Anderson, S. H. (2001). "The Importance of Beaver to Waterfowl and Wetlands Habitats in Wyoming". Journal of the American Water Resources Association 37 (6): 1571. doi:10.1111/j.1752-1688.2001.tb03660.x. 
  57. ^ Brenner, F.J. (1960). "Canada geese nesting on a beaver lodge". The Auk 77 (4): 476–477. doi:10.2307/4082428. Retrieved Mar 1, 2010. 
  58. ^ Mitchell, C.D. (1994). A. Poole and F. Gill, ed. Trumpeter Swan (Cygnus buccinator). In The Birds of North America No. 105. Philadelphia: The Academy of Natural Sciences. p. 10. 
  59. ^ McKelvey RW, Denningtonz MC, Mossop (March 1983). "The Status and Distribution of Trumpeter Swans (Cygnus buccinator) in the Yukon". Arctic: 76–81. Retrieved Mar 1, 2010. 
  60. ^ Hilfiker, E.L. (1991). Beavers, Water, Wildlife and History. Interlaken, New York: Windswept Press. p. 198. ISBN 978-1-55787-067-4. 
  61. ^ Rosell, Frank; Bozser, Orsolya; Collen, Peter and Parker, Howard (2005). "Ecological impact of beavers Castor fibre and Castor canadensis and their ability to modify ecosystems". Mammal Review 35 (3–4): 248. doi:10.1111/j.1365-2907.2005.00067.x. 
  62. ^ Bulluck, Jason F. and Rowe, Matthew P. (2006). "The Use of Southern Appalachian Wetlands by Breeding Birds, with a Focus on Neotropical Migratory Species". The Wilson Journal of Ornithology 118 (3): 399. doi:10.1676/04-116.1. 
  63. ^ Longcore, Travis; Rich, Catherine and Muller-Schwarze, Dietland (February 2007). "Management by Assertion: Beavers and Songbirds at Lake Skinner (Riverside County, California)". Environmental Management 39 (4): 460–471. doi:10.1007/s00267-005-0204-4. PMID 17318698. 
  64. ^ Cooke, Hilary A. and Zack, Steve (2008). "Influence of Beaver Dam Density on Riparian Areas and Riparian Birds in Shrubsteepe of Wyoming". Western North American Naturalist 68 (3): 365–373. doi:10.3398/1527-0904(2008)68[365:IOBDDO]2.0.CO;2. Retrieved February 16, 2013. 
  65. ^ Grover, A.M. & Baldassarre, G.A. (1995). "Bird species richness within beaver ponds in south-central New York". Wetlands 15 (2): 108–118. doi:10.1007/BF03160664. 
  66. ^ a b c Pollock, M. M.; Pess, G. R. and Beechie, T. J. (2004). "The Importance of Beaver Ponds to Coho Salmon Production in the Stillaguamish River Basin, Washington, USA". North American Journal of Fisheries Management 24 (3): 749–760. doi:10.1577/M03-156.1. Retrieved Feb 28, 2010. 
  67. ^ Swales, S. and Levings, C. D. (1989). "Role of Off-Channel Ponds in the life Cycle of Coho Salmon (Oncorhynchus kisutch) and Other Juvenile Salmonids in the Coldwater River, British Columbia". Canadian Journal Fisheries Aquatic Sciences 46 (2): 232–242. doi:10.1139/f89-032. 
  68. ^ a b Gard R (1961). "Effects of beaver on trout in Sagehen Creek, California". Journal of Wildlife Management 25 (3): 221–242. doi:10.2307/3797848. JSTOR 3797848. 
  69. ^ Hägglund, Å. & Sjöberg, G. (1999). "Effects of beaver dams on the fish fauna of forest streams". Forest Ecology and Management 115 (2–3): 259–266. doi:10.1016/S0378-1127(98)00404-6. 
  70. ^ Rutherford, W.H. (1955). "Wildlife and environmental relationships of beavers in Colorado forests". Journal of Forestry: 803–806. Retrieved Feb 28, 2010. 
  71. ^ Murphy, M.L., Heifetz, J., Thedinga, J.F., Johnson, S.W. & Koski, K.V. (1989). "Habitat utilisation by juvenile Pacific salmon (Onchorynchus) in the glacial Taku River, southeast Alaska". Canadian Journal of Fisheries and Aquatic Science 46 (10): 1677–1685. doi:10.1139/f89-213. 
  72. ^ J. M. Niles, K. J. Hartman, and P. Keyser (2013). "Short-Term Effects of Beaver Dam Removal on Brook Trout in an Appalachian Headwater Stream". Northeastern Naturalist 20 (3): 540–551. doi:10.1656/045.020.0317. Retrieved 2013-11-17. 
  73. ^ a b Pollock, Michael M.; Heim, Morgan and Werner, Danielle (2003). "Hydrologic and Geomorphic Effects of Beaver Dams and Their Influence on Fishes". American Fisheries Society Symposium 37. Retrieved Jan 17, 2010. 
  74. ^ a b Kemp, Paul S.; Worthington, Tom A.; Langford, Terence E. L.; Tree, Angus R. J. and Gaywood, Martin J. (June 2011). "Qualitative and quantitative effects of reintroduced beavers on stream fish". Fish and Fisheries 13 (2): 158. doi:10.1111/j.1467-2979.2011.00421.x. 
  75. ^ Ryan L. Lokteff, Brett B. Roper, Joseph M. Wheaton (2013). "Do Beaver Dams Impede the Movement of Trout?". Transactions of the American Fisheries Society. Retrieved 2013-12-23. 
  76. ^ Bryant, M. D. (1984). "The Role of Beaver Dams as Coho Salmon Habitat in southeast Alaska Streams". In Walton, J.M. and Houston, D.B. Proceeding, Olympic Wild Fish Conferences (Port Angeles, Washington: Peninsula College, Fisheries Technology program): 183–192. 
  77. ^ Leidholt-Bruner, Karen; Hibbs, David E. and McComb, William C. (1992). "Beaver Dam Locations and Their Effects on Distribution and Abundance of Coho Salmon Fry in Two Coastal Oregon Streams". Northwest Science. Retrieved April 16, 2011. 
  78. ^ a b c Collen P, Gibson RJ (2001). "The general ecology of beavers (Castor spp.), as related to their influence on stream ecosystems and riparian habitats, and the subsequent effects on fish – a review". Reviews in Fish Biology and Fisheries: 439–461. Retrieved Mar 2, 2010. 
  79. ^ Sigourney, D. B.; Letcher, B. H. and Cunjak, R. A. (2006). "Influence of Beaver Activity on Summer Growth and Condition of Age-2 Atlantic Salmon Parr". Transactions of the American Fisheries Society 135 (4): 1068–1075. doi:10.1577/T05-159.1. 
  80. ^ Mills, Enos A. (1913). In Beaver World. Kessinger Publishing. p. 280. ISBN 978-0-7661-9387-1. 
  81. ^ Burchsted, Denise; Daniels, Melinda; Thorson, Robert and Vokoun, Jason (2010). "The River Discontinuum: Applying Beaver Modifications to Baseline Conditions for Restoration of Forested Headwaters". BioScience 60 (11): 908–922. doi:10.1525/bio.2010.60.11.7. 
  82. ^ Eric J. Billman, Joshua D. Kreitzer, J. Curtis Creighton, Evelyn Habit, Brock McMillan, and Mark C. Belk (2013). "Habitat enhancement and native fish conservation: can enhancement of channel complexity promote the coexistence of native and introduced fishes?". Environmental Biology of Fishes 96: 555–566. doi:10.1007/s10641-012-0041-2. Retrieved 2013-06-13. 
  83. ^ Hood, W. Gregory (2009). "An Overlooked Ecological Web: Sweetgale, Beaver, Salmon, and Large Woody Debris in the Skagit River Tidal Marshes". Skagit River Cooperative. Retrieved June 22, 2010. 
  84. ^ Beier, Paul and Barrett, Reginald H. (1987). "Beaver Habitat Use and Impact in Truckee River Basin, California". Journal of Wildlife Management 51 (4): 794–799. doi:10.2307/3801743. JSTOR 3801743. 
  85. ^ Benson Ayers, Michael (1997). Aerial Multispectral Videography for Vegetation Mapping and Assessment of Beaver Distribution within Selected Riparian Areas of the Lake Tahoe Basin (Thesis). University of Nevada at Reno. p. 71. Retrieved August 26, 2010. 
  86. ^ Pollock, Michael M.; Beechie, Timothy J. and Jordan, Chris E. (2007). "Geomorphic changes upstream of beaver dams in Bridge Creek, an incised stream channel in the interior Columbia River basin, eastern Oregon". Earth Surface Processes and Landforms. doi:10.1002/esp.1553. 
  87. ^ Demmer, Rick and Beschta, Robert L. (September 2008). "Recent History (1988–2004) of Beaver Dams along Bridge Creek in Central Oregon". Northwest Science 82 (4): 309–318. doi:10.3955/0029-344X-82.4.309. 
  88. ^ Eric Collier (1959). Three Against the Wilderness. Victoria, British Columbia: Touchwood. p. 288. ISBN 1-894898-54-0. 
  89. ^ Ruedemann, Rudolf and Schoonmaker, W. J. (December 2, 1938). "Beaver-Dams as Geologic Agents". Science 88 (2292): 523–525. Bibcode:1938Sci....88..523R. doi:10.1126/science.88.2292.523. PMID 17840531. 
  90. ^ Groc, Isabelle (April 19, 2010). "Beavers Sign up to Fight Effects of Climate Change". Discover. Retrieved July 27, 2010. 
  91. ^ "The Beaver Solution: Solving our Water Storage Dilemma in Eastern Washington". The Lands Council. March 2010. Retrieved July 27, 2010. 
  92. ^ Utah Beaver Management Plan (Report). Utah Division of Wildlife Resources. January 6, 2010. pp. 25. http://wildlife.utah.gov/furbearer/pdf/beaver_plan_2010-2020.pdf. Retrieved August 29, 2010.
  93. ^ "New York City Beaver Returns". Science Daily. December 20, 2008. 
  94. ^ Miller, Peter (September 2009). "Manhattan Before New York: When Henry Hudson first looked on Manhattan in 1609, what did he see?". National Geographic. 
  95. ^ O'Connor, Anahad (February 23, 2007). "After 200 Years, a Beaver Is Back in New York City". New York Times. Retrieved Dec 4, 2009. 
  96. ^ Trotta, Daniel. "Beaver Returns to New York City After 200 Years." World Environment News. Dec 26, 2007.
  97. ^ Design Trust for Public Space (June 17, 2009). "Bronx River Crossing". Retrieved Dec 4, 2009. 
  98. ^ Paddock, Barry (September 19, 2010). "Another beaver makes Bronx River home – doubles total beaver population". New York Daily News. Retrieved September 19, 2010. 
  99. ^ Newman, Andy (February 7, 2013). "Beaver Gets Busy at Botanical Garden". New York Times. Retrieved February 13, 2013. 
  100. ^ a b Boehm, Kiersten (Nov 14, 2008). "Lincoln Park Beaver Relocated". Inside at Your News Chicago, IL Edition. Retrieved Dec 4, 2009. 
  101. ^ Holingue, Scott (Jan 1, 1994). Tales from an Urban Wilderness: Wildlife's Struggle for Survival in a Park Where City & Wilderness Meet. Chicago, IL: Chicago Historical Bookworks. p. 140. ISBN 0-924772-25-5. 
  102. ^ "Park District Kills Beaver in Lincoln Park". MyFoxChicago. April 2009. Retrieved December 4, 2009. 
  103. ^ Greenfield, John (May 7–13, 2009). "Why are there signs that claim the Park District murdered a beaver?". Time Out Chicago. Retrieved Dec 4, 2009. 
  104. ^ Jones, Carolyn (April 16, 2008). "Moment of truth for Martinez beavers". San Francisco Chronicle. 
  105. ^ "Worth a Dam website". 
  106. ^ George, Aleta (2008). "Martinez Beavers". Bay Nature (Bay Nature Institute). Retrieved Nov 6, 2009. 
  107. ^ DeRobertis-Theye, Nicola. "Beavers and More in Martinez:New Habitat Thanks to Beavers". Bay Nature (Bay Nature Institute). Retrieved Nov 6, 2009. 
  108. ^ Farnham, Thomas Jefferson (1857). Life, adventures, and travels in California. Blakeman & Co. p. 383. 
  109. ^ Aiken, Jonathan (April 7, 1999). "Beaver is bad guy at cherry blossom time". CNN.com. Retrieved Nov 22, 2009. 
  110. ^ Wheeler, Linda (April 7, 1999). "Beaver Chomps Into Cherry Blossom Season". Washington Post. Retrieved Nov 22, 2009. 
  111. ^ a b Anderson, Christopher B.; Pastur, Guillermo Martinez; Lencinas, Maria Vanessa; Wallem, Petra K.; Moorman, Michelle C. and Rosemond, Amy D. (2009). "Do introduced North American beavers Castor canadensis engineer differently in southern South America? An overview with implications for restoration". Mammalian Review. Retrieved March 17, 2012. 
  112. ^ Vila, I., Fuentes, L.S. & Saavedra, M. (1999). "Ictiofauna en los sistema límnicos de la Isla Grande, Tierra del Fuego, Chile". Revista Chilena de Historia Natural: 273–284. 
  113. ^ a b Moorman, Michelle C.; Eggleston, David B.; Anderson, Christopher B.; Mansilla, Andres and Szejner, Paul (2009). "Implications of Beaver Castor canadensis and Trout Introductions on Native Fish in the Cape Horn Biosphere Reserve, Chile". Transactions of the American Fisheries Society 138 (2): 306–313. doi:10.1577/T08-081.1. 
  114. ^ Wallem, P.K., Jones, C.G., Marquet, P.A. & Jaksic, F.M. (2007). "Identificación de los mecanismo subyacentes a la invasión de Castor canadensis (Kuhl 1820, Rodentia) en el archipiélago de Tierra del Fuego, Chile". Revista Chilena de Historia Natural: 309–325. 
  115. ^ "Argentina eager to rid island of beavers". CNN. Retrieved May 20, 2010. 
  116. ^ Poirier, Nelson (November 27, 2010). "Our symbolic beaver overcomes challenges of past". Moncton, New Brunswick: Times & Transcript. Retrieved November 18, 2010. 
  117. ^ a b The Beaver Heritage Canada
  118. ^ The HBC Coat of Arms, Hbc Heritage

Further reading[edit]

  • "Castor canadensis". Integrated Taxonomic Information System. Retrieved March 18, 2006. 
  • Müller-Schwarze, Dietland and Sun, Lixing (2003). The beaver: natural history of a wetlands engineer. Cornell University Press. p. 190. ISBN 978-0-8014-4098-4. 
  • Mills, Enos (1913). In Beaver World. Kessinger Publishing. p. 255. ISBN 978-0-7661-9387-1. 
  • Collier, Eric (2007). Three Against the Wilderness. Touchwood Editions. p. 288. ISBN 978-1-894898-54-6. 
  • Long, Kim (2000). Beavers: A Wildlife Handbook. Boulder: Johnson Books. p. 37. ISBN 1-55566-251-X. 
  • Dugmore, A. Radclyffe (1914). The Romance of the Beaver; being the history of the beaver in the western hemisphere. Illustrated with photographs from life and drawings by the author. Publisher: Philadelphia, J.B. Lippincott company; London, W. Heinemann (a searchable facsimile at the University of Georgia Libraries)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!