Overview

Distribution

Range Description

This species is found in China (Xinjiang to then northeast), Japan (Hokkaido); Mongolia, DPR Korea, Russia (Ural Mountains to Siberia, Kamchatka, Sakhalin, Kunashiri, and Etorofu) (Wozencraft, 2005; Abe 2005); historically west to northern Scandanavia and western Poland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Martes zibellina is found throughout northern Asia, once spanning the area from Scandinavia to northern China (Ognev, 1962). Its current distribution does not extend as far west, but it is still found throughout Siberia into northern China.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

M. zibellina shows sexual dimorphism between males and females. Males have a body length between 380 -560 mm and a tail length between 90-120 mm. The weight of males ranges between 880-1800 grams while females weigh between 700 and 1560 grams. Female body length ranges between 350 and 510 mm and their tail length is 72-115 mm (Walker, 1995). The winter pelage is longer and more luxurious than the summer coat (Ognev, 1962). Fur color ranges from light to dark brown in different sub-species with individual fur color being lighter ventrally and darker on the back and legs (Gizimek, 1990). Individuals also display a light patch of fur on their throat which may be gray, white, or a pale yellow (Ognev, 1962).

Range mass: 700 to 1800 g.

Range length: 350 to 560 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is primarily found in dense coniferous forests, but can tolerate other types of forests. It feeds on small rodents, voles, squirrels, pikas, doves and berries. On Hokkaido in Japan, the subspecies Martes zibellina brachyura chiefly inhabits cool-temperate mixed forest, preferring resting sites in "dense-tree forests with many tree species and debris probably in order to avoid predators, and strong wind and foraging in forests of climax succession which are usually rich in their prey such as voles and mice (Miyoshi and Higashi, 2005)." Analysis of scat by Murakami (2003) revealed that this subspecies feeds on small mammals such as voles, with occasional ingestion of insects and fruit in summer and autumn (Miyoshi and Higashi, 2005). In northeastern China, Buskirk et al. (1996) found that this species preferred foraging habitats with larger values of coarse woody debris (CWD) and DBH, basal area of coniferous trees and canopy trees, as also found by Miyoshi and Higashi (2005), which, according to Hale (1999), are vegetational factors that characterize old-growth forest (Miyoshi and Higashi, 2005). This species is found in habitats with well-covered canopies, presumably to avoid attacks by raptors (Miyoshi and Higashi, 2005). Similarily, "the debris-rich and dense-tree forests with a large number of tree species may be effective for the sables to avoid strong wind and predators (red foxes) which usually forage in open lands or sparse-tree forests (Miyoshi and Higashi, 2005)." The sable reaches sexual maturity at 1.5years. The gestation with delayed implantation, takes 245-298 days. Litter size can be 1-7 (usually 3) pups.

For this species in the Ob region of Russia, Monakhov (2001) found that young animals tended to live near floodplains (lowland forest), while adult animals lived on watersheds (upland forest). "The floodplain group of habitats was represented by haircap moss-sphagnum and dwarf shrub-sphagnum pine and birch-pine forests and dwarf shrub-sphagnum oligotrophic bogs; the watershed habitats included spruce-Siberian stone pine stands with fir, spruce-birch stands with fir and Siberian stone pine, and herbaceous-dwarf shrub-green moss pine forests specked with haircap moss-sphagnum high bogs (Monakhov, 2001)."

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species is found in the dense taiga forests, flatlands, and mountain regions of northern Asia (Grizimek , 1990). M. zibellina are found in the spruce and cedar forests of eastern Siberia and the larch and pine forests of western Siberia. It seems only to avoid extremely barren high mountain tops (Ognev, 1962). The species is mostly terrestrial, hunting and constructing dens on the forest floor (Ognev, 1962).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

M. zibellina are primarily carnivorous feeding on mice, chipmunks, squirrels, bird eggs, small birds, and even fish (Ognev, 1962). Individuals eat berries, cedar nuts, and vegetation when primary food sources are scare (Ognev, 1962). When weather conditions are exteme M. zibellina stores prey inside its den to sustain itself until it can hunt again (Ognev, 1962).

Animal Foods: birds; mammals; fish; eggs

Plant Foods: leaves; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Eats eggs)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

M. zibellina is a major predator of small rodents in northern Asia and Siberia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

M. zibellina is well equipped with sharp claws and sharp teeth to defend itself against non-human predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Martes zibellina is prey of:
Aves
Accipitridae
Bubo

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Martes zibellina preys on:
Actinopterygii
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

On fur farms individuals have been observed to live up to 18 years, while individuals in the wild probably have a maximum lifespan of 8 years (Tarasov, 1975). Roughly two-thirds of the wild sable population is composed of individuals under two years of age (Tarasov, 1975)

Range lifespan

Status: wild:
8 (high) years.

Range lifespan

Status: captivity:
18 (high) years.

Average lifespan

Status: captivity:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.4 years (captivity) Observations: One animal born in a fur farm and taken to Leningrad Zoo was living after 18.4 years (Richard Weigl 2005). There is usually a period of delayed implantation, so the total gestation time can take between 150 and 335 days.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males are observed to create ruts, or shallow grooves in the snow about one meter long, accompanied with frequent urination (Tarasov, 1975). Mating takes place between June 15th and August 15th, with the date varying depending on geographic locality (Gizimek, 1990; Ognev, 1962). In areas where individuals are scarce, courting rituals involve running, jumping, and "cat-like rumbling" between males and females, but in areas where male ranges overlap competition for mates can lead to violent battles (Ognev, 1962).

M. zibellina enters heat in the spring. After insemination the blastocyst does not implant into the uteran wall of the female. Implantation occurs about eight months later and embryonic development takes only 25-30 days (Gizimek, 1990). The total pregnancy lasts from 250-300 days with females giving birth to litters ranging in size from 1-7 individuals, but smaller litters of 2-3 individuals are more common. Paternal care has been observed in some individuals as males protect the females' territory and have even been observed to provide food for nursing mothers and their litters (Tarasov, 1975)

Breeding season: June 15th- August 15th

Range number of offspring: 1 to 7.

Average number of offspring: 2-3 .

Range gestation period: 250 to 300 days.

Average weaning age: 7 weeks.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; delayed implantation

Average birth mass: 30 g.

Average number of offspring: 3.

Newly born young enter the world helpless, with unopened eyes and a very thin layer of hair (Grizimek, 1990). Newborns weigh between 25 and 35 grams and average 10cm in length (Grizimek, 1990 and Ognev, 1962). M. zibellina open their eyes between 30 and 36 days and leave the nest shortly afterwards (Grizimek, 1990; Walker, 1995). Seven weeks after birth, the young are weaned and are given regurgitated food by their mother (Ognev, 1962). M. zibellina reach sexual maturity in their second year of life (Walker, 1995).

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes zibellina

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1918-09|NC_011579|Martes zibellina| AATCGATGATTATTCTCCACAAATCACAAAGACATCGGCACCCTTTACCTTTTATTTGGCGCATGAGCCGGGATAGTGGGCACTGCATTA---AGCCTATTGATTCGCGCTGAATTGGGTCAACCTGGTGCTCTACTGGGAGAT---GACCAAATTTATAATGTGATTGTAACCGCCCATGCATTTGTAATGATTTTCTTCATAGTGATGCCAATTATAATTGGGGGCTTCGGAAACTGACTAGTGCCCTTAATA---ATCGGTGCGCCTGACATGGCGTTCCCACGTATAAACAACATAAGCTTCTGACTTCTACCTCCTTCTTTCCTTCTACTTTTAGCCTCTTCCATGGTGGAAGCAGGTGCAGGAACAGGATGAACTGTATACCCCCCTCTAGCGGGAAATCTAGCACACGCAGGAGCATCCGTAGACCTG---ACAATCTTTTCTCTACACCTGGCAGGTGTCTCGTCTATCTTGGGGGCCATCAACTTTATTACAACTATCATCAATATGAAGCCTCCCGCAATATCGCAATACCAAACCCCTCTATTCGTATGATCCGTCCTAATCACAGCCGTACTTCTACTCCTATCCCTACCAGTATTAGCAGCC---GGCATTACTATACTACTTACAGACCGAAATCTAAATACTACCTTTTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTATCAACACCTGTTTTGATTTTTTGGGCACCCCGAGGTATACATCTTAATTTTACCAGGATTTGGAATCATCTCGCATGTTGTAACATATTACTCAGGAAAGAAG---GAACCATTCGGTTACATGGGCATGGTTTGAGCAATAATATCTATTGGGTTCTTGGGATTCATTGTATGAGCCCATCACATGTTTACCGTGGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Martes zibellina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Abramov, A. & Wozencraft, C.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. In the southern part of its range, the species is considered to be endangered.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN lists one subspecies, M. zibellina brachyurus (Japanese Sable) as "data deficient", but granted no special status to the species in general. was listed under appendix 1 status in 1994.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is estimated that 6,000 individuals of this species remain in China. Globally the species' population was historically fragmented due to hunting, and it has since recovered and is now fairly abundant in Siberia and the Far East (Monakhov 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is still commercially hunted, logging of primary dense coniferous habitat in Siberia and the Far East (Bakeev and Sinitsyn, 1998). The species is heavily farmed for fur (A. Abramov pers. comm. 2006). In Japan, introduced Japanese marten Martes melampus can be a competitor of endemic Martes zibellina brachyuran (T. Murakami pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In China, the species was listed as endangered in Key List 1 as e A2acd. Studies are needed on the effects of hunting on this species, in order to develop methods to control its populations and use them commercially without decreasing annual population growth, and territorial regulation is one approach to its solution (Monakhov, 2001). Monakhov (2001) drew the following conclusion: "In the Ob region, hunting should be allowed in all lowland areas, whereas reserves should be created in the upper reaches of rivers and in interfluves, covering 30-40% of these areas. However, with a low sable population density (less than 0.5 ind. per 1000 ha), reserves should cover 40-50% of the habitats occupied by this species." In Japan, selective trapping of introduced Japanese marten is needed to protect native subspecies (T. Murakami pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

M. zibellina has been hunted for its fur throughout human history and population numbers had been severely reduced because of extensive hunting early this century (Grizimek, 1990). Hunting is only allowed by licensed persons now and fur farms have been established to allow wild populations to grow. These measures have allowed M. zibellina populations to grow and reestablish the wider range that they once occupied in the taiga (Grizimek, 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sable

The sable (Martes zibellina) is a species of marten which inhabits forest environments, primarily in Russia from the Ural Mountains throughout Siberia, eastern Kazakstan, in northern Mongolia, China, North and South Korea and on Hokkaidō in Japan.[2] Its range in the wild originally extended through European Russia to Poland and Scandinavia.[3] It has historically been harvested for its highly valued fur, which remains a luxury good to this day. While hunting of wild animals is still common in Russia, most fur in the market is now commercially farmed.[citation needed]

Contents

Etymology

The name sable appears to be of Slavic origin and to have entered most Western European languages via the early medieval fur trade.[4] Thus the Russian соболь (sobol) and Polish soból became the German Zobel, Dutch Sabel; the French zibelline Spanish cibelina, cebellina, Finnish soopeli, Portuguese zibelina and Mediaeval Latin zibellina derive from the Italian form (zibellino). The English and Medieval Latin word sabellum comes from the Old French sable or saible.

The term has become a generic description for some black-furred animal breeds, such as sable cats or rabbits, and for the colour black in heraldry.

Description

Males measure 38–56 centimetres (15–22 in) in body length, with a tail measuring 9–12 centimetres (3.5–4.7 in), and weighing 880–1,800 grams (1.9–4.0 lb). Females have a body length of 35–51 centimetres (14–20 in), with a tail length of 7.2–11.5 centimetres (2.8–4.5 in).[5] The winter pelage is longer and more luxurious than the summer coat.[3] Different subspecies display geographic variation in fur colour: fur color ranges from light to dark brown, with individual fur color being lighter ventrally and darker on the back and legs.[6] Japanese sables (known locally as クロテン or kuroten)[7] in particular are marked with black on their legs and feet.[8] Individuals also display a light patch of fur on their throat which may be gray, white, or a pale yellow.[3] The fur is softer and silkier than that of American martens.[9] Sables greatly resemble pine martens in size appearance, but have more elongated heads, longer ears and proportionately shorter tails.[10] Their skulls are similar to those of pine martens, but are larger and more robust with more arched zygomatic arches.[11]

Behaviour

A Japanese sable, as illustrated in The Illustrated Natural History, 1865

Sables inhabit dense forests dominated by spruce, pine, larch, cedar, and birch in both lowland and mountainous terrain. They defend home territories that may be anything from 4 to 30 square kilometres (1.5 to 12 sq mi) in size, depending on the local terrain and availability of food. However, when resources are scarce they may move considerable distances in search of food, with travel rates of 6 to 12 kilometres (3.7 to 7.5 mi) per day having been recorded.[12]

Sables live in burrows near riverbanks and in the thickest parts of woods. These burrows are commonly made more secure by being dug among tree roots.[8] They are good climbers of cliffs and trees.[13] They are primarily crepuscular, hunting during the hours of twilight, but become more active in the day during the mating season. Their dens are well hidden, and lined by grass and shed fur, but may be temporary, especially during the winter, when the animal travels more widely in search of prey.[12]

Sables are omnivores, and their diet varies seasonally. In the summer, they eat large numbers of hares and other small mammals. In winter, when they are confined in their retreats by frost and snow, they feed on wild berries, rodents, hares, and even small musk deer.[12] They also hunt ermine, small weasels and birds. Sometimes, sables follow the tracks of wolves and bears and feed on the remains of their kills.[8] They eat molluscs such as slugs, which they rub on the ground in order to remove the mucus. Sables also occasionally eat fish, which they catch with their front paws.[13]

They hunt primarily by sound and scent, and they have an acute sense of hearing. Sables mark their territory with scent produced in glands on the abdomen.[12] Predators on the sable include a number of larger carnivores, such as wolves, foxes, wolverines, tigers, lynxes, eagles and large owls.[12]

Reproduction

Mating generally occurs between June–August 15, though the date varies geographically.[3][6] When courting, sables run, jump and "rumble" like cats. Males dig metre long shallow grooves in the snow, frequently accompanied with urination.[14] Males fight violently with each other for females.[3] Females enter estrus in spring. Mating can last as long as eight hours. After insemination, the blastocyst does not implant into the uterine wall of the female. Instead, implantation occurs eight months later; although gestation lasts 245 to 298 days, embryonic development requires only 25–30 days.[6] Sables birth in tree hollows, where they build nests composed of moss, leaves, and dried grass.[8] Litters number one to seven young, although litters of two or three are most common. Males assist females by defending their territories and providing food.[14]

Sables are born with eyes closed and skin covered in a very thin layer of hair. Newborn cubs weigh between 25 and 35 grams (0.88 and 1.2 oz) and average 10 to 12 centimetres (3.9 to 4.7 in) in length.[3][6][12] They open their eyes after 30 to 36 days, and leave the nest shortly afterwards.[5][6] At seven weeks old, the young are weaned and given regurgitated food.[3] They reach sexual maturity at the age of two years.[5] They have been reported to live for up to twenty two years on fur farms, and up to eighteen years in the wild.[12]

Sables can interbreed with pine martens. This has been observed in the wild, where the two species overlap in the Ural Mountains, and is sometimes deliberately encouraged on fur farms. The resulting hybrid, referred to as a kidus, is slightly smaller than a pure sable, with coarser fur, but otherwise similar markings, and a long bushy tail. Kiduses are typically sterile, although there has been one recorded instance of a female kidus successfully breeding with a male pine marten.[12]

Distribution

A Russian sable, as illustrated in The Trapper's Guide, 1867. Russian sables are the most valued geographical variation for their fur[9]

In Russia, the sable's distribution is largely the result of mass reintroductions involving 19,000 animals from 1940 to 1965. Their range extends northward to the limit of trees, and extends southward to 55–60° latitude in western Siberia, and 42° in the mountainous areas of eastern Asia. Their western distribution encompasses the Ural mountains, where they are sympatric with European pine martens. They are also found on Sakhalin.[2]

In Mongolia, sables occur in the Altai Mountains and in the surrounding forests of Lake Hovsgol, the latter being contiguous with the Trans-Baikal boreal forest region from where the most valuable sable pelts come from.[2] In China, sables occur in a limited area of the Xinjiang Uygur Autonomous Region. In northeastern China, sables are now limited to the Daxinganling Mountains. In eastern Heilongjiang, the persistence of sables is suspected in the Xiaoxinganling Mountains.[2] Sables also occur in Hokkaido and on the Korean peninsula.[2]

Because of the variable appearance of the sable in different geographic localities, there has been some debate over the exact number of subspecies that can be clearly identified. Mammal Species of the World recognises seventeen different subspecies,[15] but other recent scholarly sources have identified anything from seven to thirty.[12]

History of fur use and status

The Queen is shown wearing a dress and a pouf trimmed with sable.

Sable fur has been a highly valued item in the fur trade since the early Middle Ages, and is generally considered to have the most beautiful and richly tinted pelt among martens. Sable fur is unique because it retains its smoothness in every direction it is stroked. The fur of other animals feels rough stroked opposite the grain.[16] A wealthy 17th century Russian diplomat once described the sable as "A beast full marvelous and prolific ... a beast that the Ancient Greeks and Romans called the Golden Fleece."[17] Russian sables would typically be skinned over the mouth with no incision being made on the body. The feet would be retained, so as to keep as much fur as possible. Byzantine priests would wear sable for their rituals.[18]

In England, sable fur was held with great estimation. Henry I was presented with a wreath of black sable by the Bishop of Lincoln, for no less than £100, a considerable sum at the time.[9] Sable fur was a favourite of Henry VIII, who once received five sets of sable fur worth £400 from Emperor Charles V.[18] Henry later decreed that sable fur was to be worn only by nobles exceeding the rank of viscount.[19] The Russian conquest of Siberia was largely spurred by the availability of sables there. Ivan Grozny once demanded an annual tribute of 30,000 sable pelts from the newly conquered Kazan Tatars, though they never sent more than a thousand, as Russia at the time was unable to enforce the tribute due to wars with Sweden and Poland.[17] The best skins were obtained in Irkutsk, Kamchatka, and Lapland.

According to the Secret History of the Mongols, when Genghis Khan married his first wife, Börte Ujin, his mother Hoelun received a coat of sable furs from the girl's parents. This was reportedly a very noble gift, serving not only an aesthetic need but also a practical one.[20]

Sable fur-skins in Milan. The price corresponds with the upper coat's abundance of glossy blackness[9]

According to Atkinson's Travels in Asiatic Russia, Barguzin, on Lake Baikal, was famed for its sables. The fur of this population is a deep jet black with white tipped hair. Eighty to ninety dollars were sometimes demanded by hunters for a single skin.[8] Sable fur would continue to be the most favoured fur in Russia, until the discovery of sea otters in the Kamchatka peninsula, whose fur was considered even more valuable.[17] Sable furs were coveted by the nobility of the Russian Empire, with very few skins ever being found outside the country during that period. Some however would be privately obtained by Jewish traders and brought annually to the Leipzig fair.[8] Sometimes, sable hunting was a job given to convicts exiled to Siberia.[10]

Imperial Russian fur companies produced 25,000 skins annually, with nearly nine tenths of the produce being exported to France and Germany. The civic robes of the Lord Mayor and Corporation of London, which were worn on State occasions, were trimmed with sable.[9] As with minks and martens, sables were commonly caught in steel traps.[8] Intensified hunting in Russia in the 19th and early 20th century caused a severe enough decline in numbers that a five year ban on hunting was instituted in 1935, followed by a winter-limited licensed hunt. These restrictions together with the development of sable farms have allowed the species to recolonize much of its former range and attain healthy numbers.[6]

The Soviet Union allowed Old Believer communities to continue their traditional way of life on the condition that they hand over all sable skins they produced.[21] The dissolution of the Soviet Union led to an increase of hunting and poaching in the 1990s, in part because wild caught Russian furs are considered the most luxurious and demand the highest prices on the international market.[22] Currently, the species has no special conservation status according to the IUCN, though the isolated Japanese subspecies M. zibellina brachyurus is listed as "data-deficient".[1]

Because of its great expense, sable fur is typically integrated into various clothes fashions: to decorate collars, sleeves, hems and hats (see, for example the shtreimel). The so-called Kolinsky sable-hair brushes used for watercolor or oil painting are not manufactured from sable hair, but from that of the Siberian weasel.

See also

References

  1. ^ a b Abramov, A. & Wozencraft, C. (2008). Martes zibellina. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b c d e Harrison, D. J. (editor) (2004). Martens and Fishers (Martes) in Human-Altered Environments: An International Perspective. Springer-Verlag. ISBN 0-387-22580-3. 
  3. ^ a b c d e f g Ognev, S. (1962). Mammals of Eastern Europe and Northern Asia. Jerusalem: Israel Program for Scientific Translations.
  4. ^ “sable, n., etymology of” The Oxford English Dictionary. 2nd ed. 1989. OED Online. Oxford University Press. http://dictionary.oed.com/. Accessed: 11-2-2008
  5. ^ a b c Walker's mammals of the world, Volume 1, Ronald M. Nowak, published by JHU Press, 1999, ISBN 0-8018-5789-9
  6. ^ a b c d e f (1990) Grizimek's Encyclopedia of Mammals Volume 3. New York: McGraw-Hill.
  7. ^ WILD WATCH: SABLES AND THEIR ILK, Cuteness belies killers' true nature By MARK BRAZIL
  8. ^ a b c d e f g The trapper's guide: a manual of instructions for capturing all kinds of fur-bearing animals, and curing their skins; with observations on the fur-trade, hints on life in the woods, and narratives of trapping and hunting excursions by Sewell Newhouse, edited by John Humphrey Noyes, published by Oneida Community, 1867
  9. ^ a b c d e The Friend: A Religious and Literary Journal, Volume 32, 1859
  10. ^ a b General zoology, or, Systematic natural history, by G. Shaw, 1800
  11. ^ Catalogue of the contents of the Museum of the Royal College of Surgeons in London, Volume 7. Printed by R. Taylor, 1853
  12. ^ a b c d e f g h i Monakhov, V.G. (2011). "Martes zibellina (Carnivora: Mustelidae)". Mammalian Species 43 (1): 75–86. doi:10.1644/876.1. 
  13. ^ a b The Fur Bearing Mammals of the Soviet Union, produced by London's Hudson Bay, in association with v/o sojuzpushnina
  14. ^ a b Tarasov, P. 1975. Intraspecific Relations in Sable and Ermine. Pp. 45-54 in C. King, ed. Mustelids: Some Soviet research. Boston Spa: British Library Lending Division.
  15. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001258. 
  16. ^ A Natural History of Animals by John Bigland, published by Grigg, Elliot & Co., 1844
  17. ^ a b c The conquest of a continent: Siberia and the Russians by W. Bruce Lincoln, published by Cornell University Press, 2008, ISBN 0-8014-8922-9
  18. ^ a b Furs and Fur Garments by Richard Davey, published by READ BOOKS, 2008, ISBN 1-4097-1942-1
  19. ^ A Cyclopedia of Commerce and Commercial Navigation by Isaac Smith Homans, published by Harper & Brothers, 1859
  20. ^ Dschingis Khan, by Reinhold Neumann-Hoditz, published by Rowohlt Verlag GmbH, ISBN 90-5466-910-1
  21. ^ Lost and Found in Russia: Encounters in a Deep Heartland by Susan Richards, published by I B Tauris & Co Ltd (13 May 2009), ISBN 1-84885-023-9
  22. ^ Tyler, P. E. (2000-12-27). "Behind the $100,000 Sable Coat, a Siberian Hunter". The New York Times. http://query.nytimes.com/gst/fullpage.html?res=9802E6DA1038F934A15751C1A9669C8B63. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!