Overview

Distribution

Range Description

This species is known from Japan, where it is found on Honshu, Kyushu, Shikoku, and Awaji, and introduced on Sado Island and Hokkaido (Abe, 2005), as well as Tsushima Island (S. Roy pers. comm.). Distribution in southern Korean Peninsula is reported but not confirmed (Abe, 2005). It is found from sea level to 2,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Martes melampus melampus is found on the islands of Honshu, Shikoku, and Kyushu in Japan. M. melampus melampus was introduced from Honshu to Sado and Hokkaido Islands in Japan by 1949 to increase fur products (Hosoda et al. 1999). Its distribution is southwestern Hokkaido, specifically the low altitude areas of the Oshima Peninsula and Ishikari, but research is needed to confirm its distribution (Murakami and Ohtaishi 2000). Martes melampus tsuensis is sparsely distributed on the Tsushima Islands of Japan (Buskirk 1994). Martes melampus coreensis is found on the mainland of South Korea into North Korea.

Biogeographic Regions: palearctic (Introduced , Native )

  • Anderson, E. 1970. Quaternary evolution of the genus *Martes* (Carnivora, Mustelidae). Acta Zoologica, 130: 132.
  • Buskirk, S., A. Harestad, M. Raphael, R. Powell. 1994. Martens, sables, and fishers: biology and conservation. Ithaca, New York, U.S.A: Cornell University Press.
  • Hosoda, T., H. Suzuki, M. Iwasa, M. Hayashida, S. Watanabe. 1999. Genetic relationships within and between the Japanese marten *Martes melampus* and the sable *Martes zibellina*, based on variation of mitochondrial DNA and nuclear ribosomal DNA. Mammal Study, 24: 25-33.
  • Murakami, T., N. Ohtaishi. 2000. Current distribution of the sable and introduced Japanese marten in Hokkaido. Mammal Study, 25: 149-152.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The head and body length is 470 to 545 mm (Anderson 1970). The tail length is 170 to 223 mm. Age of martens is determined by tooth eruption and wear. Sexes are significantly different in size, with males being larger (Tatara and Doi 1994). Mass varies from 500 to 1,700 g for adults. Nine live-captured males averaged 1,563 g and 4 females averaged 1,011 g (Tatara and Doi 1994). Pelage coloration varies from yellowish brown to dark brown throughout with a white to cream-colored neck patch.

Range mass: 500 to 1700 g.

Average mass: 250.5 g.

Range length: 470 to 545 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in forests, and can occur in suburban areas with sufficient trees. It "plays a key role as a relatively long-distance seed disperser for major component species with large and flesh-rich fruits in the subalpine shrubland (Otani, 2002)." It forages on a wide variety of fruits (Otani, 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Japanese martens are found along valleys, primarily in broad-leaved forests (dominated by Quercus serrata and Castanopsis cuspidata). This species will use conifer plantations and open fields (Tatara and Doi 1994). It will use dens in trees and ground burrows (Nowak 1999). Characteristics of the Tsushima Islands include: 88% forested, mean low January temperature of 4°C, mean high August temperature of 26°C, uncommon and light snowfall, and a low human population (Buskirk 1994).  The habitat of this species is similar to that of Martes zibellina (Otsu 1972).

Range elevation: 0 to 1807 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore, Maryland, U.S.A: The John's Hopkins University Press.
  • Otsu, S. 1972. Winter food of Japanese yellow marten, *Martes melampus melampus* (Temminck and Schlegel), in Yamagata prefecture. Japenese Journal of Applied Entomology and Zoology, 16: 75-78.
  • Tatara, M., T. Doi. 1994. Comparative analyses on food habits of Japanese marten, Siberian weasel, and leopard cat in the Tsushima Islands, Japan. Ecological Research, 9: 99-107.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Scat analyses indicate that M. melampus is omnivorous. However, it may be characterized as an opportunistic generalist. It eats a highly diverse array of food through the year. Important foods are fruits and berries from spring to autumn, insects in summer and autumn, and small mammals and birds all year round. It likely competes with other carnivores for small mammals (Tatara and Doi 1994).

Foods eaten include plants (mostly berries and seeds): Diospyros kaki, Actinidia arguta, Rubus hirsutus, Elaeagnus pungens, E. umbellata, Vitis ficifolia, Ficus electa, Morus australis, Rhus spp., Stauntonia hexaphylla, and Camellia japonica, rabbits and other small mammals: Lepus brachyurus angustidens, Petaurista leucogenys niddonis, Clethrionomys rufocanus andersoni, Apodemus speciosus, Apodemus argenteus, Mus musculus, and Rattus, birds and their eggs: Phasianus soemmeringii scintillans, Phasianus colchicus karpowi, Turdus naumanni eunomus, and Emberiza cioides ciopsis, invertebrates: Coleoptera and Mantodea centipedes and spiders, Scolopendra subspinipes, frogs and their eggs: Rana tsushimensis, earthworms, fish, gastropods, and crustaceans: Ligia exotica and Sesarma haematocheir.

Japanese martens adapt their fruit and berry foraging to local plant phenology. In the presence of interspecific competitors or human disturbance, they change to alternative food resources, making them more adaptable than Mustela sibirica and Felis bengalensis, which are more prey specific (Tatara and Doi 1994).

Animal Foods: mammals; amphibians; fish; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: fruit

Primary Diet: omnivore

  • Obara, I. 1970. Stomach contents of a Tsushima marten, *Martes melampus tsuensis*. Mammalogical Society of Japan Journal, 5: 79-80.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Little is known about the ecology of the M. melampus (Buskirk 1994). It may be surmized from its predatory feeding habits, however, that populations of M. melampus affect local populations of small mammals and birds, thereby affecting seed dispersal, etc.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Den selection is the most obvious adaptation to protection from predation. Martes melampus rests in tree and ground dens. Five adults were found killed by feral dogs and 38 killed by vehicle collisions between 1986 and 1989 (Tatara and Doi 1994). Humans also trap them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Martes melampus is prey of:
Homo sapiens
Canis lupus familiaris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Martes melampus preys on:
Actinopterygii
Annelida
Mollusca
Arthropoda
Insecta
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Information on lifespan in Japanese martens is unavailable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one specimen lived 12.3 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Information on mating behaviors of Japanese martens is unavailable.

Martes melampus reach sexual maturity between one and two years of age. They are seasonal breeders, mating from late March through Mid-May, and giving birth between mid-July and early August. Embryonic diapause probably occurs in M. melampus (Buskirk 1994). Japanese martens produce 1 to 5 offspring per litter, with a mean of 1.5. They are iteroparous.

Breeding interval: Japanese martens breed once yearly.

Breeding season: Breeding occurs in late March to mid-May.

Range number of offspring: 1 to 5.

Average number of offspring: 1.50.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Young are altricial, and are cared for by the mother. As in all mammals, the mother produces milk with which to feed her young. Japanese Marten kits are born deaf, blind, and furred (Macdonald 1999). Young martens can kill prey by 3 to 4 months and leave their mother shortly thereafter.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Buskirk, S., A. Harestad, M. Raphael, R. Powell. 1994. Martens, sables, and fishers: biology and conservation. Ithaca, New York, U.S.A: Cornell University Press.
  • Imaizumi, Y. 1949. The natural history of Japanese mammals. Tokyo, Japan: Yoyo shobo.
  • Kuroda, N. 1940. A monograph of the Japanese mammals. Tokyo, Japan: Sanseido.
  • Macdonald, D. 1999. The encyclopedia of mammals. New York, New York, U.S.A: Facts on File, Incorporated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes melampus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCCACAAATCACAAAGACATCGGCACTCTTTACCTCTTATTTGGCGCATGAGCCGGAATAGTGGGCACTGCATTAAGCCTATTGATTCGCGCTGAATTAGGTCAACCTGGCGCTTTGCTGGGAGAT---GATCAAATTTATAATGTGATTGTAACCGCCCATGCATTTGTAATGATTTTCTTCATAGTGATACCCATTATAATTGGGGGCTTCGGAAACTGACTAGTGCCCTTAATAATCGGTGCACCTGACATGGCATTCCCACGTATAAACAACATAAGCTTCTGACTTCTACCTCCTTCTTTCCTTCTACTTTTAGCCTCTTCCATAGTGGAAGCAGGTGCAGGAACAGGATGAACCGTATACCCCCCTCTAGCGGGAAATCTAGCACACGCAGGAGCATCCGTAGACCTGACAATCTTTTCTCTACACCTGGCAGGTGTCTCATCTATCTTGGGGGCCATCAATTTTATTACAACCATCATCAATATGAAGCCTCCTGCAATATCGCAATACCAAACCCCTCTATTCGTATGATCCGTCCTAATCACAGCCGTACTTCTTCTACTTTCCCTACCAGTATTAGCAGCCGGCATTACTATACTACTTACAGACCGAAATCTAAATACTACCTTTTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTATCAACACCTGTTTTGATTTTTTGGGCACCCCGAGGTATACATCTTAATTTTACCAGGATTCGGAATCATCTCGCACGTTGTAACATATTACTCAGGAAAGAAGGAACCATTCGGTTACATGGGCATGGTTTGAGCAATAATATCTATTGGGTTCTTGGGATTCATTGTATGAGCCCATCACATGTTTACCGTGGGAATGGACGTTGACACACGAGCATACTTCACCTCAGCCACTATAATCATCGCAATTCCAACAGGGGTAAAAGTATTTAGCTGACTAGCCACCCTCCATGGGGGA---AAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Martes melampus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Abramov, A. & Wozencraft, C.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in light of its large populations size, occurrence in protected areas, and although it has a relatively small distribution its populations are not currently in decline.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Martes melampus is a species of concern due to pressure from human activities in recent years, which has brought drastic changes in the natural environment of Japan. It is decreasing in numbers due to excessive trapping for its fur and because of the harmful effects of agricultural insecticides. As a result, females are protected from trapping (Otsu 1972).

Martes melampus tsuensis was designated a vulnerable Natural Monument Species by the Japanese Agency of Cultural Affairs in 1971 (Buskirk 1994), which supported its classification as vulnerable by the IUCN (Hilton-Taylor 2000). This subspecies is now legally protected on the Tsushima Islands (Schreiber et al. 1989). Although the Tsushima Islands are 88% forested, 34% of the forest is conifer plantation. This poses a challenge, because important foods of M. melampus tsuensis may not be common in these plantations (Tatara and Doi 1994). Between 1986 and 1989, 38 M. melampus tsuensis were found killed by vehicles and another 5 were found killed by feral dogs. The conservation plan for this subspecies should consider further habitat degredation by forestry practices and road development, as well as a method to control feral dogs (Buskirk 1994).

If there are no mating isolation mechanisms between endemic M. zibellina and introduced M. melampus in Hokkaido, natural hybridization between them may be possible (Hosoda et al. 1999). Hosoda suggests protection of M. zibellina from gene contamination by introduced M. melampus. Fortunately, there is no documentation of hybridization yet. However, mating isolation mechanisms between them have not been studied. Further research should evaluate whether there are different pre- and post-mating isolation mechanisms, in order to maintain the endemism of M. zibellina.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Schreiber, A., R. Wirth, M. Riffel, H. Van Rompaey. 1989. Weasels, civits, mongooses, and their relatives: an action plan for the conservation of mustelids and viverrids. Gland, Switzerland: IUCN.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout its known range, and increasing on Tsushima Island.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat of this species in Tushima was deteriorated by timber cutting (Tatara, 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Commercial forestry should consider reducing habitat loss for this species (Tatara, 1994). Conservation of deciduous forest is especially important (Nakamura et al. 2001). It is present in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These martens may consume insects that are beneficial to agriculture (Otsu 1972).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Martes melampus is trapped for fur from 1 December through 31 January (Nowak 1999) except on Hokkaido and the Tsushima Islands, where it is protected (Buskirk 1994). It is illegal to harvest females (Otsu 1972), a restriction that helps to preserve the population. Martes melampus predation of Lepus brachyurus is beneficial to the timber industry, because L. brachyurus browsing may destroy tree quality (Otsu 1972).

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese marten

The Japanese marten (Martes melampus) is a mammal in the marten genus most closely related to the sable. It is half a meter (1½ feet) in length on average, not counting a 20-centimeter-long tail (7.9 in), and between 1,000 and 1,500 grams (2.2 and 3.3 lb) in weight. Males are generally larger than females. The pelage varies in color from dark brown to dull yellow with a cream-colored throat.

Both males and females are territorial, the size of each individual's territory depending on food availability. The Japanese marten is omnivorous, preferring meat from fish, frogs, and small birds and mammals, but consuming insects, fruit, and seeds when necessary. It sleeps in a den in a hollow tree or a ground burrow.

There are three subspecies of Japanese marten:

Legends

In the Iga region, Mie Prefecture, there is the saying, "the fox has seven disguises, the tanuki has eight, and the marten has nine," and there is a legend about how the marten has great ability in shapeshifting than the fox (kitsune) or tanuki. In the Akita Prefecture and the Ishikawa Prefecture, it is said that if a marten crosses in front of someone, it is an omen for bad luck (the weasel has the same kind of legend), and in the Hiroshima Prefecture, it is said that if one kills a marten, one would encounter a fire. In the Fukushima Prefecture, they are also called heko, fuchikari, komono, and haya, and they are said to be those who have died in avalanches in disguise.[2]

In the collection of yōkai depictions, the Gazu Hyakki Yagyō by Sekien Toriyama, they were depicted under the title "鼬," but this was read not as "itachi" but rather "ten,"[3] and "ten" are weasels that have reached several years of age and became yōkai that have acquired supernatural powers.[4] In the depiction, several martens have gathered together above a ladder and created a column of fire, and one thing that was feared about them was that if martens that have gathered together in this form appear next to a house, the house would catch on fire.[5]

References

  1. ^ Abramov, A. & Wozencraft, C. (2008). Martes melampus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ 村上健司編著 『妖怪事典』 毎日新聞社、2000年、230頁。ISBN 978-4-6203-1428-0
  3. ^ 高田衛監修 稲田篤信・田中直日編 『鳥山石燕 画図百鬼夜行』 国書刊行会、1992年、50頁。ISBN 978-4-336-03386-4
  4. ^ 少年社・中村友紀夫・武田えり子編 『妖怪の本 異界の闇に蠢く百鬼夜行の伝説』 学習研究社〈New sight mook〉、1999年、123頁。ISBN 978-4-05-602048-9
  5. ^ 多田克己 『幻想世界の住人たち IV 日本編』 新紀元社、1990年、249頁。ISBN 978-4-9151-4644-2

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!