Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Kangaroo Mice have fat deposits in the middle of their tails. The fat deposits change in size according to the season, being largest when the animals go into hibernation and smallest when they emerge in the spring. Individuals with the largest fat deposits have a better chance of surviving hibernation. No other small mammals in North America have such fat deposits in their tails, but there are small desert-dwelling mammals in Africa and Australia that do. As with other members of their family, the Heteromyidae, kangaroo Mice do not drink water, instead getting what they need from the seeds and insects they eat. They conserve water by restricting their activity to night, when it is cooler, and by producing concentrated urine and dry feces.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Merriam, C.H., 1891.  Description of a new genus and species of dwarf kangaroo rat from Nevada, (Microdipodops megacephalus) p. 115.  North American Fauna5:115-117.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Range Description

This species is found in the western United States; from southeastern Oregon, northeastern and central-eastern California, Nevada, the tip of southwestern Idaho, and west-central Utah.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

These kangaroo mice are found in the Great Basin region of western United States, including Oregon, Utah, California, and Nevada. Nowak (1991), O'Farrell and Blaustein (1974).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Western United States; southeastern Oregon, northeastern and central-eastern California, Nevada, southwestern Idaho, and west-central Utah.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Total length measures 140-177 mm, head and body length is 66-77 mm, tail length 68-103 mm, and the hind foot is 23-27 mm long. The head is large in proportion to their body size due to the inflation of the tympanic bullae that extends to the upper portion of the cranium. The neck is fairly short. Upper parts are brownish to grayish black. Compared to the similar looking species, M. pallidus, M. megacephalus have basally plumbeous and white-tipped underparts, and the end of the tail is blackish. The distal half of the tail is darker than the proximal. The tail is not crested nor does it end in a tassle; however, it is thick and stores fat. The fat in the tail is used as a source of energy during dormancy.

The pelage is relatively long, silky, and lax. The hind feet are covered with stiff hairs on the sides, which increases the surface of the fine and soft feet. The undersurface of the hind feet are also well furred. The feet functions similar to a sand shoe in a desert.

Kangaroo mice utilize their forelegs more than kangaroo rats when running.

Compared to those of kangaroo rats, the molars of kangaroo mice do not constantly regrow. The base of the zygomatic arch is not enlarged as it is in kangaroo rats.

Several features, including long hind legs, relatively small forelegs, long vibrissae, and enlarged auditory bullae are probably adaptations to the jumping mode of locomotion.

O'Farrell and Blaustein (1974), Nowak (1991), Grizmek (1990).

Average mass: 13.4 g.

Average basal metabolic rate: 0.168 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 18 cm

Weight: 17 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 160 mm
Range: 138-177 mm

Weight:
Average: 13.1 g
Range: 10-16.9 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Dark kangaroo mice prefer loose sands and gravel. They are found in Shadscale Scrub, Sagebrush Scrub, and Alkali Sink plant communities in the Upper Sonoran life zone. They may occur in sand dunes near the margins of their range. They remain underground when inactive. They are possibly polyestrous (Hall ,1946). The majority of young are born in May and June. Litter size is two to seven (average 3.9). Predators include owls, foxes, badgers. In west-central Nevada the mean yearly circular home range for males was 6,613sqm and for females, 3,932sqm (O'Farrell and Blaustein, 1974).

Seeds are the primary food source. They also eats some insects. They do not appear to utilize free water. They are believed to store food in seed caches within burrow system (O'Farrell and Blaustein, 1974). Activity observed March-October. Peak nocturnal activity occurs in first two hours after sunset. Moonlight and ambient temperature influence activity (O'Farrell and Blaustein, 1974).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Kangaroo mice are found among bushes growing in soils covered with gravel or on sand dunes. The altitude of the habitat is around 1,190-2,455 meters. Burrows are constructed in soft ground with the entrance near a shrub. Burrows have simple, unbranched tunnels, elaborate nests, and a food storage room. A small territory is maintained near the burrow, but an individual's home ranges may overlap with those of several other individuals. Average home range for males is 6,613 square meters and 3,932 for females. O'Farrell and Blaustein (1974), Nowak (1991)

Terrestrial Biomes: desert or dune

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In loose sands and gravel. Found in Shadscale Scrub, Sagebrush Scrub, and Alkali Sink plant communities in the Upper Sonoran life zone. May occur in sand dunes near margins of range. Underground when inactive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These kangaroo mice are normally granivorous, although they feed on insects, particularly during summer when their activity reaches its maximum. The shift in diet may be caused by competition for food with pocket mice. Kangaroo mice store food in seed caches found in their burrows. O'Farrell and Blaustein (1974), Nowak (1991), Grizmek (1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Seeds are the primary food source. Also eats some insects. Does not appear to utilize free water. Believed to store food in seed caches within burrow system (O'Farrell and Blaustein 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Predators include owls, foxes, badgers. In west-central Nevada mean yearly circular home range for males was 6613 sq m; for female, 3932 sq m (O'Farrell and Blaustein 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Activity observed March-October. Peak nocturnal activity occurs in first 2 hours after sunset. Moonlight and ambient temperature influence activity (O'Farrell and Blaustein 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
5.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but wild-trapped specimens have been kept in captivity for 5.4 years (O'Farrell and Blaustein 1974).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females are polyestrous. Pregnant individuals have been found from March to September. The majority of the young are born in May and June. Litter size ranges from 2 to 7 with an average of 3.9. A study done in west-central Nevada showed that the population consisted of 2:1 sex ratio favoring males. A successful reproduction has yet to be recorded in captivity. Maximum longevity (of an individual trapped in the wild) is five years and five months. O'Farrell and Blaustein (1974), Nowak (1991), Grizmek (1990).

Average number of offspring: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Possibly polyestrous (Hall 1946); majority of young are born in May and June. Litter size is 2-7 (average 3.9).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Microdipodops megacephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1830-08|EF156846|Microdipodops megacephalus| AATCGTTGATTATTCTCAACAAACCATAAAGACATTGGAACGCTCTATATGATCTTTGGTGCCTGAGCAGGTATAGTAGGCACAGGACTA---AGCATTCTAATCCGAGCCGAACTAGGCCAGCCAGGAGCATTATTAGGAGAT---GACCAGATCTATAATGTGATTGTCACTGCTCATGCTTTCGTTATAATCTTTTTCATGGTAATACCTATTCTTATCGGAGGCTTCGGAAACTGACTTGTTCCTTTAATA---ATTGGAGCACCCGATATAGCCTTTCCACGAATAAACAATATAAGTTTTTGACTTCTTCCCCCCTCTTTTCTTCTTCTCCTGGCATCCTCTATAGTTGAAGCCGGAGCAGGAACAGGCTGAACAGTGTACCCCCCATTAGCAGGCAATCTAGCCCACGCAGGAGCATCAGTTGACCTA---ACAATTTTCTCACTCCACCTCGCAGGAGTGTCATCTATCCTAGGAGCCATTAATTTCATCACTACAATCCTCAATATAAAACCTCCAGCAATATCCCAATATCAAACCCCCCTATTCGTATGATCAGTCTTAATTACAGCTGTGTTATTACTTCTGTCCCTTCCTGTCCTAGCCGCA---GGCATTACTATACTATTAACAGATCGAAACCTCAACACAACATTTTTTGATCCTGCTGGAGGAGGCGACCCAGTTCTGTACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTACATTCTCATTCTCCCTGGTTTTGGAATAATCTCCCACATCGTAACCTACTATTCAGGAAAAAAA---GAGCCATTTGGGTATATGGGAATGGTCTGGGCTATAATATCAATCGGATTCTTAGGCTTTATCGTATGAGCTCACCATATGTTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Microdipodops megacephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because it is relatively widespread, although there have been some declines and loss of habitat within its range, its extent of occurrence is still much greater than 20,000 km², and the declines are not fast enough to qualify for listing in a more threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although not endangered, their number has decreased due to destruction of habitat by modern agriculture and land development. Predators include the kit fox and snakes; however, humans are the biggest threat.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The subspecies M. megacephalus atrirelictus (Owyhee River kangaroo mouse) is Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is apparently secure within its range (NatureServe).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Some Microdipodops populations have declined as a result of the introduction of weedy grasses and extreme habitat alteration for cultivation (e.g., irrigation of dry sinks) (Hafner et al., 1998). In addition to these human-related habitat changes, apparently natural shifts in vegetative zones have resulted in the replacement of rodent communities including Microdipodops by those including Dipodomys deserti, and vice versa (J. C. Hafner, pers. obs.). Natural and human-related habitat modifications may have amplified effects on the already fragmented, patchy distribution of Microdipodops (Hafner et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Some Microdipodops populations have declined as a result of introduction of weedy grasses and extreme habitat alteration from cultivation (e.g., irrigation of dry sinks) (Hafner et al. 1998). In addition to these human-related habitat changes, apparently natural shifts in vegetative zones have resulted in the replacement of rodent communities including Microdipodops by those including Dipodomys deserti, and vice versa (J. C. Hafner, pers. obs.). Natural and human-related habitat modifications may have amplified effects on the already fragmented, patchy distribution of Microdipodops (Hafner et al. 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The dark kangaroo mouse is not known to occur in any protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Used in laboratory researches for water conservation, renal physiology, and irradiation.   http://netvet.wustl.edu/org/AWIC/misc/uncomsp.htm 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dark Kangaroo Mouse

The Dark Kangaroo Mouse (Microdipodops megacephalus) is a species of rodent in the Heteromyidae family. It is endemic to California, Idaho, Nevada, Oregon and Utah in the United States.[1]

References

  1. ^ a b Linzey, A.V. & NatureServe (Hammerson, G.) (2008). Microdipodops megacephalus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: Hall's (1981) suggestion that subspecies leucotis may warrant specific status was not supported by Hafner and Hafner (1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!