Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

During the day lowland tapirs remain hidden in thick cover, emerging only at night to browse on leaves of small plants, shrubs, lianas and saplings of trees, as well as tree bark, reeds and fruits (2) (4). Well worn tracks are followed throughout the home range to food and water sources (3). This tapir swims well and spends much of its time wallowing in water, which helps to get rid of skin parasites (3) in addition to providing protection from terrestrial predators such as jaguars and pumas (2). Tapirs will also regularly walk on river beds, searching for favoured aquatic plants (6). These tapirs are primarily solitary animals, except during the mating season (6). Females give birth to a single calf after a gestation period of 13 months (8), which then remains in intermittent contact with its mother for around seven months, becoming increasingly independent (4) (6). Lowland tapirs have been known to live up to 35 years in captivity (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

One of the most distinguishing features of tapirs is their long, flexible proboscis, formed from the upper lip and nose (3), which is used to strip leaves and pluck fruits. (2). This bristly-coated tapir varies in colour from dark brown to greyish-brown, generally with a dark underside and legs, and lighter cheeks, throat and ear tips (3) (4). Newborn tapirs have a dark brown coat with white spots and stripes, which provide good camouflage (2). A prominent, erect mane sits on top of the crest and extends from the forehead to the shoulders (6). The crest running from the top of the head down the back of the neck is much more pronounced than in other tapir species, giving it a stockier appearance (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Tapirus terrestris is found in lowland regions of northern and central South America, from Argentina, Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Suriname, and Venezuela. Historically this species was found east of the Andes and north of the Espinal grasslands and shrublands of Argentina throughout the chaco, pantanal, cerrado, llanos, caatinga and Amazonian/Orinoco forests - however, populations have been severely reduced and often limited to forest biomes and wetlands. The species has been extirpated from the caatinga and dry chaco biomes. In the northern Andes the species has been extirpated from the dry inter-Andean valleys of the northern Andes and is becoming increasingly rare along the agriculture frontiers than are sweeping through parts of the western and southern Amazon basin. The distribution in the cerrado has been diminished to a few small populations in protected areas and those in the pantanal are rapidly declining.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tapirus terrestris can be found predominantly in Brazil, but its range covers much of South America’s tropical forests. It ranges from northern Argentina to Venezuela, but is absent from Chile and locations west of the Andean Cordillera.

Biogeographic Regions: neotropical (Native )

  • Norton, J., M. Ashley. 2004. Genetic variability and population structure among wild Baird's tapirs. Animal Conservation, 7: 211-220.
  • Eisenberg, J., K. Hubbard Redford. 1999. Mammals of The Neotropics: The Central Neotropics. Chicago: University of Chicago Press.
  • Nowak, R. 1999. Mammals of the Wold, Volume 1. Baltimore: John Hopkins University Press.
  • Padilla, M., R. Dowler. 1994. Tapirus terrestris. Mammalian Species, 481: 1-8. Accessed March 31, 2011 at http://www.jstor.org/stable/350410.
  • Wilson, D., D. Reeder. 2005. Mammal Species of The World: A Taxonomic and Geographic Reference. Baltimore: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Colombia and Venezuela south to Paraguay and Argentina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Broadly distributed across most of mainland South America east of the Andes, from northern Colombia extending to southern Brazil, northern Argentina and Paraguay, including throughout Venezuela and the Guyanas, eastern Peru, and northern and eastern Bolivia (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult mass of Brazilian tapirs ranges from 150 to 250 kg. Shoulder height varies from 77 cm to 108 cm, while body length can reach 221 cm in females and 204 cm in males. Their skulls have a prominent sagittal crest that gives the top of the head a humplike projection extending from the eyes to the neck, and a short mane follows the sagittal crest projection. Adults are dark brown to red, and juveniles are brown with horizontal white stripes, which fade after seven months. Brazilian tapirs have hooves and a pronounced proboscis. The proboscis is made up entirely of soft tissue, and the snout has significantly reduced bone and cartilage compared to other ungulates. The molars are lophodont, and the dental formula is 3/3, 1/1, 4/3, 3/3 = 42.

Range mass: 150 to 250 kg.

Range length: 204 to 220 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Witmer, L., S. Sampson, N. Solounias. 1999. The Proboscis of Tapirs: a Case Study in Novel Narial Anatomy. Journal of Zoology, 249: 250-266.
  • Zoological Society of London, 1867. Proceedings. London: Zoological Society of London.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Tapirus terrestris
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): P. Hershkovitz
Year Collected: 1942
Locality: El Salado, Valledupar District, Cesar, Colombia, South America
Elevation (m): 430
  • Type: Hershkovitz, P. 1954 May 18. Proc. U.S. Nat. Mus. 103: 486.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
T. terrestris inhabits lowland South American moist and swamp forests, dry and moist shrub lands and grasslands and a wide variety of wetlands. Habitat association varies extensively, although the most important habitats tend to be moist, wet or seasonally inundated areas (Bodmer and Brooks 1997). This species has been observed to be associated with both water and salt-licks. The degree to which tapir are tolerant to habitat degradation varies regionally, but genreally species tapir are a forest dependant species. To date, no conclusion has been drawn as to why tapirs may thrive in one partially logged or disturbed area and be absent from others, however, it can be infered based on other tapir species that loalnd tapir cannot tolerate large scale habitat change and hunting pressure.

Harald Beck (pers. comm.) reports that tapirs have higher densities in Amazonian forests that contain two crucial features: Aguajales and salt licks. Aguajales are palm swamps that typically range between 0.1 ha to over 100 ha and are dominated by the Mauritia flexuosa palm. The fruits of this palm are a crucial food resource for tapirs especially during the dry season. In fact, tapirs are the prime seed dispersers for this palm, indicating the close evolutionary relationship between both species. Furthermore, Aguajales have incoming streams or small rivers which may also be crucial for other ecological requirements of tapir's including thermoregulation. Thus Aguajales are an ecological hotspot and sustain higher tapir densities. Salt licks are smaller aquatic systems and may occur in clumped spatial distribution. Tapirs, among other mammals, frequently visit salt licks to obtain essential minerals. Hunters, knowing the tapir’s fondness for salt, wait at those locations because their success is dramatically increased.

Tapir are ecologically more prone to be impacted by hunting due to long gestation and generational time. Reproduction is slow enough to make recover difficult for the species is areas where there is any prolonged hunting activity. Hunting is a serious threat along the numerous new road systems, settlement and along the agricultural fronteir in the Amazon basin. Hunting also occurs around logging camps and can completely eliminate the species from seemingly viable habitat.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Brazilian tapirs prefer tropical montane forests, but are also present in swamps and lowland forests. It can be found from sea level up to 4500 meters in elevation. They are adept mountain climbers and sometimes create paths to larger bodies of water. They prefer to live close to water, especially rivers, and are comfortable swimmers. The highest population densities are found in areas with lush vegetation and 2,000 to 4,000 mm of rainfall per year.

Range elevation: 0 to 4500 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; mountains

Wetlands: swamp

Other Habitat Features: riparian

  • Husson, A. 1978. The Mammals of Suriname. Netherlands: Brill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in moist, lowland rainforests where water is present, but habitat association varies extensively (8) (3). Seasonal movements to higher elevations during the rainy season have been reported in some areas (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brazilian tapirs browse at night, eating fruit, leaves, and other plant material. Preferred forage plants include mombins, which produces fruit similar to large plums; huito, which produces large berry-like fruit; and moriche palm, which produces palm fruit.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Brazilian tapirs are browsers and grazers. They are exceptionally common in certain area of their geographic range and make up a significant portion of the total biomass in these communities. They are frugivorous and are potential seed dispersers of many important fruit trees throughout their geographic range. Their digestion generally leaves ingested seeds undamaged, as is the case with fruit from assai palms and epena. Brazilian tapirs are host to a number of parasites including several species of ticks (Haemophysalis juxtakochi and Amblyomma ovale), numerous species of ciliated protozoa (Buisonella tapiri, Blepharocorys cardionucleata, Balantidium coli, and Prototapirella intestinalis), and roundworms (Neomurshidia monostichia and Physocephalas nitidulans). Burrowing mites sometimes cause sarcoptic mange.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Other than humans, the tapir’s main predator is the jaguar. They are sometimes taken by crocodylians. When alarmed by predators, tapirs flee to water or the nearest brush. If cornered, however, a tapir runs directly at its predator. Its semi-nocturnal tendencies may help decrease risk of predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Brazilian tapirs produce several vocalizations. A shrieking sound is used to express fear, distress, or pain. Clicking noises may be used to identify themselves to conspecifics, particularly during mating season. They show aggression with a nasal snort, and when irritated, it makes a puffing noise. Brazilian tapirs also use methods of chemical communication, as they urinate and use facial glands to demarcate territorial boundaries.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

  • Hunsaker, D., T. Hahn. 1965. Vocalization of South American Tapir Tapirus Terrestris. Animal Behavior, 13/1: 69.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information available concerning the lifespan of Tapirus terrestris. Typically, it lives for 35 years in captivity, and there is no information regarding the lifespan of wild individuals.

Average lifespan

Status: captivity:
35 years.

Average lifespan

Status: captivity:
35 years.

Average lifespan

Status: wild:
30.0 years.

Average lifespan

Status: wild:
35.0 years.

Average lifespan

Status: captivity:
35.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (captivity) Observations: A 38 year-old specimen called "George" was still alive at San Antonio Zoo (Rob Coke, pers. comm.).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of Tapirus terrestris has not yet been determined. When females are sexually receptive, males compete for the right to mate by biting one another on the feet, suggesting polygyny.

Gestation in Brazilian tapirs typically lasts for 380 days, but ranges from 335 to 439 days. Estrous occurs every 50 to 80 days and lasts for 48 hours. Most females become sexually mature between 2 and 3 years of age. The oldest female recorded to have given birth in captivity was 28 years old. Brazilian tapirs breed year round. They have 1 offspring at a time, which weighs from 3.2 to 5.8 kg at birth. Weaning is complete by 6 to 8 months of age, and most offspring are independent by 18 months of age.

Breeding season: Mating in Brazilian tapirs occurs year-round.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 335 to 439 days.

Average gestation period: 383 days.

Range birth mass: 3.2 to 5.8 kg.

Range weaning age: 6 to 10 months.

Average weaning age: 6-8 months.

Range time to independence: 10 to 18 months.

Range age at sexual or reproductive maturity (female): 23 to 36 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Female Brazilian tapirs nurse young for 6 to 10 months and continue to live with young for an additional 1 to 8 months. Males provide no parental care to offspring.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female)

  • Eisenberg, J., K. Hubbard Redford. 1999. Mammals of The Neotropics: The Central Neotropics. Chicago: University of Chicago Press.
  • Nowak, R. 1999. Mammals of the Wold, Volume 1. Baltimore: John Hopkins University Press.
  • Padilla, M., R. Dowler. 1994. Tapirus terrestris. Mammalian Species, 481: 1-8. Accessed March 31, 2011 at http://www.jstor.org/stable/350410.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tapirus terrestris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2312-09|AJ428947|Tapirus terrestris| AACCGCTGATTATTTTCAACAAACCACAAAGATATTGGTACCCTATACTTGCTATTTGGCGCCTGAGCTGGAATAGTAGGCACAGCTCTA---AGTCTCTTAATCCGTGCCGAATTAGGTCAACCAGGAACTTTATTAGGAGAT---GACCAAATCTATAATGTAGTGGTAACCGCTCATGCATTTGTAATAATTTTCTTCATAGTTATGCCAATCATAATCGGAGGATTTGGGAACTGATTAGTTCCATTAATG---ATTGGAGCACCCGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCCTTTCTGCTCCTACTAGCATCTTCAATAATTGAAGCTGGTGCAGGTACAGGCTGAACTGTCTATCCACCCCTAGCCGGTAACTTAGCACACGCAGGAGCTTCCGTTGACTTA---ACCATTTTCTCCCTCCACCTTGCAGGTGTATCCTCAATTCTAGGCGCTATTAACTTTATTACTACAATTATTAATATAAAACCACCAGCTATATCACAGTACCAAACACCTTTATTTGTTTGATCAGTCCTAATTACAGCAGTATTACTATTACTAGCACTTCCAGTTCTAGCAGCA---GGGATTACCATACTACTAACAGACCGTAACCTAAATACTACTTTCTTTGACCCTGCAGGAGGAGGGGATCCTATTCTATATCAACATCTATTTTGATTCTTTGGACATCCTGAAGTTTATATCCTCATTTTACCAGGCTTTGGAATAATCTCACATATTGTCACATATTATTCAGGTAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGAGCTATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCTCACCATATGTTTACAGTAGGCATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tapirus terrestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cde+3cde

Version
3.1

Year Assessed
2008

Assessor/s
Naveda, A., de Thoisy, B., Richard-Hansen, C., Torres, D.A., Salas, L., Wallance, R., Chalukian, S. & de Bustos, S.

Reviewer/s
Shoemaker, A. & Medici, P. (Tapir Specialist Red List Authority)

Justification
This species is considered to be Vulnerable due to an ongoing populations reduction estimated to be slightly greater than a 30% in the past 3 generations (33 years) due to habitat loss, illegal hunting and competition with livestock, and estimated on current rates of decline this rate of decline is inferred to continue for the next 3 generations (33 years). Although this rate of decline seems improbable considering the occurrence in the vast Amazon - the fact is that the species has been extirpated over large portions of its range and severely reduced in other large portions. Lowland tapir populations seem unlikely to persist anywhere humans occur at densities any greater than 1/km2. The estimated 30% decline over 3 generations takes into consideration the entire global range and was calculated using an average of reduction between a variety of biomes. Although only about 15-20% of the Amazon has been deforested in the past 30 years, 90% of the Atlantic forests have disappeared and 40% of the Pantanal has been converted to human use. Most of the Cerrado and Caatinga biomes have been converted to agriculture and cattle ranching, however, this has happened over a period greater than 3 generations. Even where habitat remains populations are reduced and dispersed due to the effects of hunting - which is greatly amplified around increasing human populations and settlement of the Amazon basin, especially along rivers and in the Andean foothills. The effects of deforestation, hunting, and competition from domestic livestock have all contributed to population declines and fragmentation in the past and are inferred to continue at the present rate (if not more) into the future. Deforestation is increasing in certain parts of the species' range, while subsistence hunting and a developing wild-meat industry may cause further declines in the future. The lowland tapir is now either completed absent or severely fragmented across much of its historic range, with the Northern Amazon and the remaining Pantanal (Bolivia, Brazil, and Paraguay) becoming important strongholds as southern, eastern and northwestern populations declining rapidly.

History
  • 2002
    Vulnerable
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Tapirus terrestris ia classified as "vulnerable" no the IUCN's Red List of Threatened Species. Although more studies are needed to determine current population densities and trends, it is widely thought that T. terrestris is declining throughout its geographic range. Major threats include over hunting, competition with livestock, and habitat loss through deforestation. It occurs in numerous protected areas throughout its range, and although it is legally protected from hunting, these laws are rarely enforced and have proven ineffective. The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) lists T. terrestris under Appendix II.

US Federal List: endangered

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

  • Naveda, A., D. Torres, B. de Thoisy, C. Richard-Hansen, L. Salas, R. Wallance, S. Chalukian, S. de Bustos. 2010.4. "Tapirus terrestris" (On-line). The IUCN Red List of Threatened Species. Accessed May 25, 2011 at http://www.iucnredlist.org/apps/redlist/details/21474/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Tapirus terrestris , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Very little is known of populations of lowland tapir. Populations are being reduced across the range of the species but numerous strongholds exist - however, there is not sufficient information to extrapolate population sizes in these regions. Recently camera-traps have been effective for detecting presence but have proven difficult to estimate densities because it is hard to distinguish individuals in photos. A variety of density estimates have been proposed ranging from 0.20 to 3.7 individuals/km² (Medici pers. comm.). The most likely reason for this variation is both sampling and study design bias as well as the fact that lowland tapir, although generally rare and elusive, can be locally common (i.e. around salt lick and permanent and seasonal water sources). In fact great variation in density likely also reflects the results of both direct and indirect threats in the form of hunting pressure, protection and seasonal variation. Additionally, it can also reflect the tapir’s ability to adapt to different habitat types and availability of resources (food and water).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threats to the species include loss of habitat through deforestation, hunting for meat and competition with domestic livestock. The impacts of hunting on populations are amplified by the very low ability of tapir to quickly repopulate impacted areas. Though several strongholds occur - populations have been severely reduced and fragmented across the entire Cerrado (Brazil), Atlantic forest (Brazil) and llanos (Venezuela/Colombia) biomes. In Argentina and both southern Brazil the species has been extirpated from the tropical and temperate grassland and shrub land - and are rapidly declining in the dry Chaco. Additionally the species has been extirpated from the entire Caatinga biome of eastern Brazil.

In the northeast, tapirs are present only inside protected areas where illegal hunting is minimal. Outside protected areas, they are still hunted, chased by dogs, and negatively impacted by competition with cattle and illegal timber activities. The species is in rapid decline along the eastern Amazon and its Southern Tributaries where extensive hunting and deforestation have reduced almost all large mammal populations. In addition populations are declining rapidly along the agricultural front spreading into western Brazil and along the Andean foothills of Ecuador and Colombia.

Although T. terrestris may be common in some areas of Argentina, it is sensitive to deforestation and human activities and the species has already disappeared in many areas of transition between montane and Chaco forests in Anta (a department of Salta Province). Although control has been more effective during the past year in this province, tapirs are still affected by illegal timber activities, hunted, chased by dogs, and negatively impacted by competition with cattle.

In Bolivia, tapirs are susceptible to hunting, and habitat degradation. While they may well be more common than expected in protected areas, as was found out in Costa Rica and elsewhere for T. bairdii, they do not fare well in the presence of hunting. In French Guiana, tapirs are regularly hunted and sold commercially for meat in markets and restaurants. Little information is available for the population in Guyana, however, tapirs are not protected here at present and are hunted by subsistence hunters as well as by a developing bush-meat industry as roads are cut into the forest for logging.

In conclusion it is difficult to calculate the overall impact of hunting on populations, but we can infer from previous studies that in the past 30 years extensive and ongoing habitat loss combined with hunting and accumulated indirect threats have been much greater than previously estimated, and much greater than would be suspected by looking at maps of remaining forest in the Amazon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Deforestation, hunting and competition with domestic livestock have all contributed to the decline and fragmentation of lowland tapir populations (1). Hunted for subsistence food and commercial sale, the large size of lowland tapir makes them a prized game mammal for native and rural people of South America (8). Hunting for tapir meat is increasing as the wild-meat industry develops, with tapir meat now frequently sold in city markets throughout South America. In Paraguay and Argentina tapirs are hunted for their hides, which are commonly used in Paraguay to make sandals that are sold to tourists as souvenirs. In Colombia the species is listed as endangered due to over-hunting (8). Tapirs have also been taken from the wild to be kept as pets by Paraguayan and Peruvian aristocracy, where they are often poorly cared for and malnourished (8). Other threats include anti-drug chemicals used by authorities against cocaine growers, which can eventually end up in the food chain and poison tapirs (7). Road-kills are also common in reserves within close proximity to human settlement (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in numerous protected areas across its range. The species is officially and legally protected in many range countries, however, hunting laws are seldom enforced and therefore these have proven ineffective. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Although protected areas do exist within the range of the lowland tapir, they are sparse in certain countries (there is only one reserve in Guyana, established in the early 1990s), and those reserves that are close to human settlements often suffer from poaching. A priority of the IUCN/SSC Tapir Specialist Group is to develop projects that will reduce hunting by establishing more reserves and promoting the sustainable harvest of wildlife by rural hunters. The second priority is to reduce habitat destruction through firmly managed agro-forestry projects. However, it is difficult to enforce hunting laws in remote areas when there is a direct economic benefit. Yet, if hunting continues at its current levels, local extinction of lowland tapir populations is almost certain (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Tapirus terrestris on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Brazilian tapirs are hunted for hide and meat, providing a significant amount of protein to the diets of various rural populations. They have been domesticated in Brazil and taught to pull plows and allow children to ride them. They are also kept in numerous zoos across the globe.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

South American Tapir

The South American tapir (Tapirus terrestris), or Brazilian tapir (from the Tupi tapi'ira) or lowland tapir or (in Portuguese) anta, is one of four species in the tapir family, along with the mountain, the Maylayan, and the Baird's tapirs.[2] It is the second-largest land mammal in South America, after the Baird's tapir.

Contents

Appearance

It is dark brown in colour, paler in the face, and has a low, erect crest running from the crown down the back of the neck. The round, dark ears have distinctive white edges. The South American tapir can attain a body length of 1.8 to 2.5 m (5.9 to 8.2 ft) with a 5 to 10 cm (2.0 to 3.9 in) short stubby tail and an average weight around 225 kg (500 lb). Adult weight has been reportedly ranged from 150 to 320 kg (330 to 710 lb).[3][4] It stands somewhere between 77 to 108 cm (30 to 43 in) at the shoulder.

Range

The South American tapir can be found near water in the Amazon Rainforest and River Basin in South America, east of the Andes. Its range stretches from Venezuela, Colombia, and the Guianas in the north to Brazil, Argentina, and Paraguay in the south, to Bolivia, Peru, and Ecuador in the West.

Behavior

Lowland tapirs are excellent swimmers and divers, but also move quickly on land, even over rugged, mountainous terrain. They have a life span of approximately 25 to 30 years. In the wild, their main predators are crocodilians (only the black caiman and Orinoco crocodile, the latter of which is critically endangered, are large enough to take these tapirs, as the American crocodile only exists in South America in the far north) and large cats such as the jaguar and cougar, which often attack tapirs at night when they leave the water and sleep on the riverbank. They are known to run to water when scared.

Diet

It is an herbivore. Using its mobile snout, this tapir feeds on leaves, buds, shoots, and small branches it tears from trees, fruit, grasses, and aquatic plants.

Mating

Brazilian tapir in northern Peru

They mate in April, May, or June, reaching sexual maturity in their third year of life. Females go through a gestation period of 13 months (390-395 days) and will typically have one offspring every two years. Newborn tapirs weigh about 15 pounds and will be weaned in about six months.

Endangered status

Young Brazilian tapir at the Dortmund Zoo

Dwindling numbers are due to poaching for meat and hide, as well as habitat destruction.

The South American tapir is generally recognized as an endangered animal species, with the species being designated as endangered by the United States Fish and Wildlife Service on June 2, 1970. It has a significantly lower risk of extinction, though, than the other three tapir species.

References

  1. ^ Naveda, A., de Thoisy, B., Richard-Hansen, C., Torres, D.A., Salas, L., Wallance, R., Chalukian, S. & de Bustos, S. (2008). Tapirus terrestris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 10 April 2009. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 634. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100043. 
  3. ^ http://animaldiversity.ummz.umich.edu/site/accounts/information/Tapirus_terrestris.html
  4. ^ http://www.perunature.com/content/tapir-tapirus-terrestris-amazon
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!