Overview

Brief Summary

Biology

Red pandas are predominately solitary, and are most active at dawn and dusk (5). They have semi-retractable claws, which allow them to be efficient climbers and when not foraging, pandas are usually found in the trees. Males occupy territories that overlap those of several females, especially in the mating season (4), and territories of both sexes are marked with anal secretions (5). Red pandas mate on the ground but the female gives birth, usually to two young, within a hollow tree nest cavity (5). Young are born blind and helpless, opening their eyes after 18 days; their coat is initially grey-buff in colour (5). Red pandas are one of the few animals whose diet is composed almost entirely on bamboo; they grasp stems with their forepaws and shear the leaves off with sharp teeth (4). Bamboo is poor in nutrients; to compensate, red pandas are only active for around 56 % of the day (4) and have an extremely slow metabolism, which is comparable to that of the sloth (7). Other foods such as roots and fruit as well as small lizards and bird's eggs are also eaten (2). Red pandas have an ungainly walk on the ground but are much more agile in the trees, using their tail for balance although it is not prehensile; on the ground the tail is carried horizontally away from the body (5). After eating or resting the red panda will tend to groom itself thoroughly (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The classification of the red panda has caused continued controversy since it was first described in 1825 (1), due to similarities with both the bear family and the procyonids such as racoons (4). Today it is placed with the racoons, but in its own separate subfamily, the Ailurinae (4). The lustrous coat is a rich reddish brown colour on the back and black on the legs; longer coarse guard hairs cover the dense woolly undercoat, which provides warmth (4). The coat provides effective camouflage amongst the trees where branches are often swathed in reddish-brown moss (5). The face is rounded and predominantly white with reddish brown 'tear marks' running from the corner of each eye to the mouth (5). The long bushy tail is marked with 12 alternating red and buff rings and the soles of the feet are covered with thick white hair to provide warmth (5). Currently two subspecies of the red panda exist; Ailurus fulgens fulgens is smaller and lighter (especially in the facial region) than the related A. f. styani (6). Like the giant panda (Ailuropoda melanoleuca), red pandas also posses a modified wrist bone that acts as a sixth digit or thumb, although it is smaller than that of the better-known giant panda (4). Red pandas have a wide range of vocalisations, the most peculiar of which is a 'quack-snort' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

The distribution of Ailurus fulgens in the wild is poorly known, but its range is known to include Nepal, India, Bhutan, Myanmar, and southern China, with a disjunct population on the Meghalaya Plateau of northeastern India (Choudhury 2001). The westernmost limit of this species is from the Annapurana Range in Nepal, and the easternmost is from the Qing Ling Mountains of the Shaanxi Province in China. The distribution range of this species should be considered disjunct, rather than continuous (Roberts and Gittleman 1984). It is found from the southern part of the Gaoligong Shan on the Myanmar-China border (25ºN), to Minshan Mountains and upper Min Valley, Sichuan (33ºN) (Ellerman and Morrison-Scott 1966, Macdonald 1984, Corbet and Hill 1992, Choudhury 1997). Although Roberts and Gittleman (1984) record it as occurring only above 2,200 m, it can be found from 1,500 to 4,800 m, and on the Meghalaya Plateau it is found from 700 to 1,400 m (Choudhury 1997), sometimes as low as 200 m (Surajit Roy pers. comm.). Pradhan et al. (2001) found that this species' preferred altitudinal range in Singhalila National Park in eastern Himalayas was 2,800 to 3,100 m, and it was relatively more abundant between 2,800 to 3,600 m.

In China, the Red Panda is found in the Minshan, Qionglai, Liangshan, Bigger Xiangling, and Lesser Xiangling Mountains in western Sichuan, China (Wei et al.1999a, 1999b, 2000), but former assertions of occurrence in far southern Yunnan, in Xishuangbanna (e.g. Wang Yingxiang 1987) have not been corroborated (e.g. Wei Fuwen et al. 1998). It is believed to have gone extinct from the rest of its historical range in China, e.g. Guizhou, Gansu, Shaanxi, and Qinghai provinces (Wei et al. 1999).

In Myanmar it is known only from the northernmost state, Kachin, and is locally distributed even there (Than Zaw et al. in prep.).

The red panda was reported as occurring in northern Lao PDR by Deuve (1972) (citing Cheminaud 1942), though recent village interviews around Phongsali in 1996 and 2003–2004 yielded no positive indication of its occurrence. Additionally, re-examination of the historical basis for occurrence reveals significant internal inconsistencies and flaws. Hence, there is no evidence that red panda has ever occurred in Lao PDR, although it may still be found to occur there is future surveys (Duckworth et al. 1999; in prep).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Red pandas are found throughout the Himalayan mountains between 2,200 and 4,800 meters in elevation in northern Burma, Nepal, Sikkim region of India, and the districts of western Sichuan and Yunnan in China. Their geographic range is bounded in the north by the Namlung Valley in the Mugo District and the Lake Rara region of northern Nepal, in the south by the Liakiang Range of western Yunnan, and the northern and eastern boundary is the upper Min Valley of western Sichuan. (Roberts and Gittleman 1984)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Red pandas are found in the Himalayas and mountainous regions of northern Myanmar, and China in western Sichuan and Yunnan Provinces (7). The Brahmaputra River at the eastern end of the Himalayas is thought to represent a physical barrier between the two subspecies (6), with A. f. fulgens found to the west in Nepal and northeastern India and A. f. styani to the east (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red pandas are approximately 560 to 625 mm long, with relatively long, furry tails, from 370 to 472 mm long. The tails are marked with about 12 alternating red and buff rings, and are not prehensile. The head is round; the rostrum is shortened; and the ears are large, erect, and pointed. Long, coarse guard hairs cover the body, and the undercoat is soft, dense, and woolly. The body is darker in eastern specimens. The face is predominantly white with reddish-brown "tear" marks under the eyes. The fur on the upper side of its body is reddish-brown, while ventrally it is glossy black. The legs are black and the soles of its feet are covered with dense, white hair. There is no sexual dimorphism in color or size between males and females. Front legs are angled inward, leading to its waddling walk. The feet are plantigrade.

The red panda has a robust skull with a poorly developed zygomatic arch, sagittal crest, and postorbital process. The palatines extend beyond the level of the most posterior molar, the mesopterygoid fossa is constricted anteriorly, and the auditory bullae are small. The post glenoid process is large and anteriorly recurved, and an alisphenoid canal is present.

The mandible is robust but relatively short, and the mandibular symphysis is constricted. The coronoid process is strongly hooked posteriorly, and the mandibular condyles are large.

Premolar one and molar one and two are wider than they are long and have accessory cusplets. Each upper premolar has more than one cusp, and premolar three has a well developed paracone and hypocone.

(Morris 1965, Vaughan 1972, Roberts and Gittleman 1984)

Range mass: 3.7 to 6.2 kg.

Range length: 560 to 625 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 4.898 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Red Panda is found closely associated with temperate forest having bamboo-thicket understories (Roberts and Gittleman 1984). This species is sympatric with the Giant Panda in the Minshan, Qionglai, Liangshan, Bigger Xiangling, and Lesser Xiangling Mountains in western Sichuan, China (Wei et al.1999a, 1999b, 2000). In a study of microhabitat use by this species in Sichuan Province, China, it was found that this species spends most of its time in Bashania faberi bamboo forest, and prefers microhabitats containing higher densities of fallen logs and tree stumps (Zhang et al. 2006). "Bamboo leaves are the main winter food resource for red pandas (Wei et al. 1999c, 2000). Because of their small body size, red pandas may utilize fallen logs and tree stumps to gain access to bamboo leaves (Zhang et al. 2006). It is found in tropical and subtropical forests on the Meghalaya Plateau of India, while elsewhere it is found in subtropical and temperate forests (Choudhury 2001). Red panda diet is largely vegetarian, and consists chiefly of young leaves and shoots of bamboo, yet also includes fruit, roots, succulent grasses, acorns, lichens, bird eggs, insects, and grubs (Choudhury 2001). This species is largely arboreal (Choudhury 2001). Pradhan et al. (2001) found 79% of records to be 0 to 100 m from the presence of water bodies, indicating that the presence of water may be an important habitat requisite for this species.

The mean gestation in captivity is reported by Roberts and Gittleman (1984) as 134.2 days, with litter sizes ranging from one to four, and young are sexually mature at 18 month.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Red pandas live in temperate climates in deciduous and coniferous forests. There is usually an understory of bamboo and hollow trees. The average temperature is 10 to 25 degrees Celsius, and the average annual rainfall is 350 centimeters. (Glatston 1994, Roberts and Gittleman 1984)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in temperate montane forests at elevations between 2,200 and 4,800 metres above sea level where there is a thick bamboo understory (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red pandas eat berries, blossoms, bird eggs, bamboo leaves, and the small leaves of other plants. Bamboo (the leaves of which are the red panda's primary food source) is bent down to bring the leaves within reach of the mouth. Food is grasped in a forepaw and brought to the mouth while sitting, standing, or lying on the back. Food grasped in this manner is inserted in the side of the mouth, sheared, then chewed extensively before it is swallowed.  (Glatston 1994, Roberts and Gittleman 1984)

Animal Foods: eggs

Plant Foods: leaves; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

If threatened, red pandas climb a tree or strike out with their semi-retractile claws. One of their primary predators is the snow leopard (Uncia uncia).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red pandas exhibit several visual displays during intraspecific interactions, including arching the tail and back, the slow raising and lowering of the head while emitting a low intensity puffing, turning the head while jaw-clapping, shaking the head from side to side, a bipedal posture with forelegs extended above the head, and staring.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum lifespan of the red panda is 14 years, but the average is eight to ten.

Range lifespan

Status: wild:
14 (high) years.

Typical lifespan

Status: wild:
8 to 10 years.

Average lifespan

Status: captivity:
13.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: One captive specimen lived for 19 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Adult red pandas rarely interact with each other outside of the mating season. During the mating season, scent-markings increase, and the female invites the male to mount her on the ground. Males leave their scent by urinating or rubbing their anogenital area on trees. Both males and females may mate with more than one partner in a season.

Mating System: polygynandrous (promiscuous)

Mating season is early winter. Births occur in the spring and summer, with most newborns arriving in June. Litters range from one to four young. The gestation period of the red panda is approximately 134 days. Females become noticeably heavy and lethargic around six weeks before parturition. Several days before parturition, the female begins to carry nest materials (sticks, grass, leaves) to a suitable nest site. In the wild, a nest may be a hollow tree or a rock crevice. In captivity, a box, hollow logs, or other artificial dens can serve as a nest. All births take place between 4 PM and 9 AM, which is the period of highest activity.

The young attain adult size at around 12 months, and are sexually mature at around 18 months.

(Roberts and Gittleman 1984)

Breeding interval: Red pandas breed once yearly.

Breeding season: Mating occurs in early winter.

Range number of offspring: 1 to 4.

Average gestation period: 134 days.

Average time to independence: 18 months.

Average age at sexual or reproductive maturity (female): 18 months.

Average age at sexual or reproductive maturity (male): 18 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 100 g.

Average gestation period: 116 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
550 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
550 days.

After birth, females quickly clean their young and remain with them for 60 to 90 % of the time for the first few days. Mothers recognize their young by olfactory cues established shortly after birth. After one week, females spend more time away from the nest, returning every few hours to nurse and groom their young, and to keep the nest clean. The young remain nest-bound for around 90 days. They make their first excursion from the nest at night. The young and mother share a close relationship until the young becomes aggressive at the onset of the next breeding season. Males have a small or nonexistent role in raising and caring for the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ailurus fulgens

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA726-07|NC_009691|Ailurus fulgens| AACCGATGATTATTTTCCACAAATCATAAAGACATTGGCACCCTTTATCTTTTATTTGGTGCATGAGCTGGAATAGTTGGAACTGCCTTA---AGTCTGTTAATCCGCGCTGAACTAGGTCAACCCGGCACCCTGTTAGGAGAT---GATCAGATTTATAATGTAATCGTAACTGCTCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGATTCGGGAACTGACTCGTACCACTAATA---ATTGGTGCCCCTGATATAGCATTTCCTCGAATAAACAATATAAGTTTCTGACTTTTACCTCCTTCTTTCCTTCTTCTTCTGGCCTCCTCTATAGTAGAAGCAGGCGCAGGAACCGGATGAACAGTATATCCTCCCTTAGCAGGTAATCTAGCCCATGCAGGGGCATCCGTAGATCTA---ACAATCTTTTCTCTCCACTTAGCAGGAGTTTCATCTATTCTAGGTGCTATCAACTTTATCACCACTATTATTAATATAAAACCCCCTGCAATGTCACAATATCAAATCCCCTTATTTGTATGATCTGTATTAATTACAGCGGTTTTACTACTTCTATCCCTTCCAGTTCTAGCAGCT---GGCATCACCATACTATTAACAGATCGTAATCTAAATACAACTTTCTTTGATCCTGCTGGAGGAGGAGACCCCATCTTGTACCAGCACTTATTCTGATTTTTTGGGCACCCTGAAGTTTATATCCTTATCCTTCCAGGTTTTGGAATAATTTCACACATCGTAACATACTATTCAGGAAAAAAA---GAACCTTTTGGATATATAGGGATAGTATGAGCAATAATATCTATTGGGTTTCTAGGTTTTATTGTATGAGCTCACCATATATTTACTGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ailurus fulgens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Wang, X., Choudhury, A., Yonzon, P., Wozencraft, C. & Than Zaw

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Vulnerable because its population is estimated at less than 10,000 mature individuals with a continuing decline of greater than 10% over the next 3 generations (estimated at 30 years). The population decline in the last three generations (30 years) is estimated to be less than 30%, and therefore the species does not qualify under criteria A.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Red pandas are threatened by deforestation and other human activities. Deforestation eliminates nesting sites and sources of food, and isolates populations into small fragments separated by inhospitable habitats. Ailurus fulgens is the occasional target of game hunting, and it is often found in traps set for musk deer. Red pandas are also outcompeted by local livestock for food. Expanding human populations in Asia and the increasing need for land and lumber are significant threats to the survival of this species. Red pandas are protected and listed in Appendix II of the Convention on the International Trade in Threatened and Endangered Species, and were declared endangered in March 1988. (Glatston 1994, Roberts and Gittleman 1984)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
“It is estimated to be more common in the eastern part of its range, especially along the Myanmar-Yunnan border, yet it cannot be considered a common species” (Roberts and Gittleman 1984). An estimate based on the lowest recorded average density (one individual per 4.4 km²) and the total area of potential habitat (142,000 km², with only about half of this actually being used by the species) suggests that the global population of this species is about 10,000 individuals (Choudhury and Yonzon pers. comm.) Observation of this species is difficult due to its shy and secretive nature, and its largely nocturnal habits (Choudhury 2001). There is an estimate of one animal per 3.9 km² for Singalila National Park and adjacent areas (Bahuguna et al. 1998). Yonzon and Hunter (1991) estimate a density of one animal per 2.0 to 11.0 km², with averages of 2.8 in 1986 and 4.4 in 1987, in Langtang National Park in Nepal. Choudhury (2001) reports a lower population density in the western part of its distribution in Nepal, as compared areas in the east such as Arunachal Pradesh. Anecdotal evidence based on local villager captures suggests the species may be common in the northernmost parts of Myanmar, especially in the Hkakaborazi National Park, however, recent camera-trapping surveys did not capture any red pandas in the area (Rabinowitz and Khaing, 1998, Than Zaw et al. in prep.) Pradhan et al. (2001) reports a crude density of 1 individual per 1.67 km² in Singhalila National Park in India. It has been found to be relatively common in Tawang and northern West Kameng Districts and in Mishmi Hills, especially Dibang Valley and Lohit Districts (Choudhury 2001). It is estimated that their numbers may have decreased by as much as 40% over the last 50 years due to massive habitat loss, increased human activity and poaching (Wei et al. 1999 which?). Wei et al. (1999) estimated 3,000 to 7,000 total individuals in China, while Choudhury (2001) estimates 5,000-6,000 in India.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Red Panda is threatened by habitat loss and fragmentation, poaching, and inbreeding depression (Wei et al. 1998). Habitat loss is considered to be the biggest threat to this species, while poaching is the next biggest threat in the Indian portion of its range and some localized areas (Choudhury 2001), whereas poaching and hunting pose a greater threat in areas of China and Myanmar, particularly in Hkakaborazi and adjacent areas. The ultimate cause of these threats to the red panda is the high growth rate in human populations within the species' range and in surrounding nearby areas (Choudhury 2001). The growth rate of the local human population has almost doubled between 1971 and 1991, causing increased pressure on land for both housing and farming, as well as increased demand for firewood (Choudhury 2001).

The major causes of habitat loss are commercial logging, demand for firewood (especially in the cold Himalaya), clearing for habitation and farming, jhum (slash-and-burn shifting cultivation) by hill tribes, grazing of domestic stock, monoculture forest plantation, and various developmental activities (Choudhury 2001). Due to human encroachment in suitable forest habitat and the unusual biology of bamboos, the red panda may be near extinction in the western part of its range, especially in Nepal (Roberts and Gittleman 1984). Both legal and illegal felling of old-growth trees is occurring throughout its range in India, and in the Khast Hills of Meghalaya some of the best habitat is privately owned, potentially making conservation efforts difficult (Choudhury 2001).

Deforestation, which causes fragmentation, is the fundamental threat to this species long-term survival (Wei et al. 1999 ). Between 1980 and 1995 the number of tourists visiting Sikkim annually rose from 1000 to 100,000 (Mahapatra 1998), causing increased pressure on this species due to accelerating habitat loss for firewood (for cooking and heating) (Choudhury 2001). Similar threats are occurring in the Singalila area of Darjeeling and in Nepal (Choudhury 2001). Habitat is effectively stable in northernmost Myanmar (Renner et al. 2007), but elsewhere in Kachin where the panda might occur there are indications of rapid habitat degradation through deforestation in this area (B.F. King pers. comm. 1998, cited in Collar et al. 2001).

Road construction in Sikkim and Arunachal Pradesh over the past two decades has led to large-scale felling of trees and erosion, and sometimes landslides, also opening up formerly inaccessible areas for both legal and illegal logging (Choudhury 2001). Increased fragmentation of habitat leads to inbreeding and loss of genetic variation, which may significantly impact localized populations, as well as possible increased pressure from hunting (Choudhury 2001).

Hunting does not appear to be as serious a threat to the Red Panda as habitat loss, since hunters do not appear to deliberately hunt this species, but rather is shot opportunistically and caught accidentally in snares during hunting for wild pig, deer, goat-antelopes (serow, goral, and takin) and primates (Choudhury 2001). In Bhutan, the red panda is hunted for making fur caps or hats (Yonten, 2004). In China, Red Panda pelts can be found in many local markets (Glatson 1994). Wei et al (1998) report data which indicate that hunting and poaching pressures are severe in China, especially to a declining population, which has led to increased declines, and extinctions in some areas. Poaching is considered one of the most serious threats in China (Wang pers. comm.).

Cub mortality of the species is high in areas surrounding cattle grazing activities, estimated at up to 74% (Yonzon pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Red pandas have suffered from habitat loss throughout their range; forests have been cleared for timber extraction, agriculture and development. In China the species is thought to have undergone a decline of around 40% over the last 50 years (8) and A. fulgens fulgens is equally threatened in Nepal (9). The panda has also been exploited for its pelt; hats made from the lustrous fur are still desired in Yunnan in China for newlyweds, as it traditionally symbolises a happy marriage (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Red Panda is covered under CITES Appendix I (Duckworth et al. 1999), and Schedule I of the Indian Wild Life (Protection) Act 1972, the highest protection possible for a species in India (Choudhury 2001). It is also legally protected in Bhutan, China (where it is classed as a category II species under the Wild Animal Protection Law (Wei et al. 1999a), and Nepal (Glatston 1994). In China, the species is Red Listed as Vulnerable A2ace. The species is protected in Myanmar by the Wildlife Act of 1994 and is found in at least one, probably several, protected areas (Than Zaw et al. in prep.).

There are 20 protected areas in India that have known or possible populations of this species, yet these protected areas cover only about one-third of the total potential habitat for this species (Choudhury 2001). Protection of this species is more or less adequate in the protected areas of India, due more to their remoteness and difficulty of terrain, rather than actual enforcement of laws (Choudhury 2001). Enforcement of protective legislation, especially outside of protected areas, is virtually non-existent (Choudhury, 2001). Outside of India, China has 35 protected areas (Wei et al. 1998) covering about 42.4% of this species habitat in China, Nepal has eight, and Bhutan has five that support known or reported populations of this species (Choudhury 2001). The red panda has been recorded from Singalila National Park (Bahuguna et al. 1998), and Langtang National Park in Nepal (Yonzon and Hunter 1991).

Choudhury (2001) provides the following conservation recommendations: expansion and strengthening of the protected area network, prevention of illegal felling, control of jhum cultivation and overgrazing, regulation of tourism, public awareness of threatened status of this species, and enforcement of existing legal protections. The population of the species, reported at 200 m, is a research priority in order to study how a temperate species has survived in a subtropical habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The red panda is protected in all of the countries in which it is found with the exception of Myanmar (5), and it is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). In China the species occurs within many of the reserves that were established to protect the giant panda (5). An international breeding programme exists, and red pandas are bred in more than 30 zoos world wide; in North America alone the captive population was 182 individuals in 2001 and these are maintained and managed under the Species Survival Plan (SSP) (5 + 6). Protection of the remaining habitat of this appealing and unobtrusive mammal is the key to the survival of the already rare red panda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red pandas have no negative impact on humans. (Glatston 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red pandas are important socially, scientifically and economically. They are the national animal of Sikkim and the mascot of the International Tea Festival in Darjeeling. Red panda skins are used to used for hats and their tails as dusters. Furthermore, red panda skin may still be worn by the bridegroom in a local Chinese wedding. Red pandas have been pivotal in research on the taxonomy of the families Ursidae and ProcyonidaeAilurus fulgens is illegally hunted and sold to zoos or killed for their skin. Very few zoos purchase these illegal specimens, making this a fairly unproductive business, but skins can be found in local villages and are used in cultural ceremonies.

(Glatston 1994)

Positive Impacts: body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red panda

The red panda (Ailurus fulgens, or shining-cat), is a small arboreal mammal native to the eastern Himalayas and southwestern China.[2] It is the only extant species of the genus Ailurus. Slightly larger than a domestic cat, it has reddish-brown fur, a long, shaggy tail, and a waddling gait due to its shorter front legs. It feeds mainly on bamboo, but is omnivorous and may also eat eggs, birds, insects, and small mammals. It is a solitary animal, mainly active from dusk to dawn, and is largely sedentary during the day.

The red panda has been classified as Vulnerable by IUCN because its population is estimated at fewer than 10,000 mature individuals. Although red pandas are protected by national laws in their range countries, their numbers in the wild continue to decline mainly due to habitat loss and fragmentation, poaching, and inbreeding depression.[2]

The red panda has been previously classified in the families Procyonidae (raccoons) and Ursidae (bears), but recent research has placed it in its own family Ailuridae, in superfamily Musteloidea along with Mustelidae and Procyonidae.[4] Two subspecies are recognized.

Contents

Physical characteristics

Red panda descending head first

The head and body length of red pandas averages 56 to 63 cm (22 to 25 in), and their tails about 37 to 47 cm (15 to 19 in). Males weigh 3.7 to 6.2 kg (8.2 to 14 lb) and females 4.2 to 6.0 kg (9.3 to 13 lb).[5] They have long, soft reddish-brown fur on the upper parts, blackish fur on the lower parts, and a light face with tear markings and robust cranial-dental features. The light face has white badges similar to those of a raccoon, but each individual can have distinctive markings. Their roundish head has medium-sized upright ears, a black nose, and very dark eyes: almost pitch black. Their long bushy tail with six alternating yellowish red transverse ochre rings provides balance and excellent camouflage against its habitat of moss- and lichen-covered trees. The legs are black and short with thick fur on the soles of the paws. This fur serves as thermal insulation on snow-covered or ice surfaces and conceals scent glands which are also present on the anus.[6]

The red panda is specialized as a bamboo feeder with strong, curved and sharp semi-retractile claws [5] standing inward for grasping of narrow tree branches, leaves and fruit. Like the giant panda, it has a “false thumb” that is an extension of the wrist bone. When descending a tree headfirst, the red panda rotates its ankle to control its descent, one of the few climbing species to do so.[7]

Distribution and habitat

A Red panda lies sleeping on a branch high in a tree, with tail stretched out behind and legs dangling on each side of the branch
Red panda sleeping

The red panda is endemic to the temperate forests of the Himalayas, and ranges from the foothills of western Nepal to China in the east.[8] Its easternmost limit is the Qinling Mountains of the Shaanxi Province in China. Its range includes southern Tibet, Sikkim and Assam in India, Bhutan, the northern mountains of Burma, and in southwestern China, in the Hengduan Mountains of Sichuan and the Gongshan Mountains in Yunnan. It may also live in southwest Tibet and northern Arunachal Pradesh, but this has not been documented. Locations with the highest density of red pandas include an area in the Himalayas that has been proposed as having been a refuge for a variety of endemic species in the Pleistocene. The distribution range of the red panda should be considered disjunct, rather than continuous.[5] A disjunct population inhabits the Meghalaya Plateau of northeastern India.[9]

During a survey in the 1970s, signs of red pandas were found in Nepal's Dhorpatan Hunting Reserve.[10] Their presence was confirmed in spring 2007 when four red pandas were sighted at elevations ranging from 3,220 to 3,610 m (10,560 to 11,840 ft).[11] The species' westernmost limit is in Rara National Park located farther west of the Dhorpatan Hunting Reserve.[12] Their presence was confirmed in 2008.[13]

The red panda lives between 2,200 and 4,800 meters (7,200 and 15,700 ft) altitude, inhabiting areas of moderate temperature between 10 and 25 °C / 50 and 77 °F with little annual change. It prefers mountainous mixed deciduous and conifer forests, especially with old trees and dense understories of bamboo.[5][8]

The effective population size of the Sichuan population is larger and more stable than that of the Yunnan population, implying a southward expansion from Sichuan to Yunnan.[14]

In August 2010, archaeologists uncovered red panda fossil remains in Washington County in the US state of Tennessee. Although none are known to exist in the wild in North America today, it is believed the red panda thrived in the mountains of eastern Tennessee approximately 4.5 million years ago.[15]

The red panda has become extirpated from the Chinese provinces of Guizhou, Gansu, Shaanxi and Qinghai.[16]

Distribution of subspecies

Distribution of the red panda is disjointed, and there are two extant subspecies:

Ailurus fulgens styani has been described by Thomas in 1902 based on one skull from a specimen collected in Szechwan.[18] Pocock distinguished styani from fulgens by its longer winter coat and more abundant blackness in the pelage, bigger skull, more strongly curved forehead, and more robust teeth. His description is based on skulls and skins collected in Szechwan, Myitkyina close to the border of Yunnan, and Upper Burma.[6]

The Styan's red panda is supposedly larger and darker in color than its Western cousin, but there is considerable variation in both subspecies, and some individuals may be brown or yellowish brown rather than red.[8]

The Brahmaputra river is often considered the natural division between the two subspecies, where it makes a curve around the eastern end of the Himalayas. Although some authors suggest that A. f. fulgens extends farther eastward, into China.

Biology and behavior

Behavior

Red panda twittering.ogg
Sounds of red panda twittering

Red pandas are territorial. Adults are solitary except during mating season. They are generally quiet except for some twittering, tweeting, and whistling communication sounds. They have been reported to be both nocturnal and crepuscular, sleeping on tree branches or in tree hollows during the day and increasing their activity in the late afternoon and early evening hours. They sleep stretched out on a branch with legs dangling when it is hot, and curled up with its tail over the face when it is cold.[5] They are very heat sensitive, with an optimal “well-being” temperature between 17 and 25 °C (63 and 77 °F), and cannot tolerate temperatures over 25 °C (77 °F).

Red panda standing

Shortly after waking, red pandas clean their fur like a cat, licking their front paws and then rubbing their back, stomach and sides. They also rub their back and belly along the sides of trees or rocks. Then they patrol their territory, marking it with urine and a weak musk-smelling secretion from their anal gland. They search for food running along the ground or through the trees. Red pandas may alternately either use their forepaw to bring food to their mouth or place food directly into the mouth.[5]

Predators of the red panda include the snow leopard, martens (Mustelidae), and humans. If they feel threatened or sense danger, they may try to escape by climbing a rock column or tree. If they can no longer flee, they stand on their hind legs to make themselves appear larger and use the sharp claws on their front paws to defend themselves.

Diet

Ailurus fulgens 01.ogv
Red panda gnawing

Red pandas are excellent climbers, and forage largely in trees. They eat mostly bamboo, and may eat small mammals, birds, eggs, blossoms, and berries. In captivity, they were observed to eat birds, blossoms, acer and morus leaves, bark and the fruits of acer, beech and morus.[5]

Like the Giant Panda, they cannot digest cellulose, so they must consume a large volume of bamboo to survive. Their diet consists of about two-thirds bamboo, but they also eat mushrooms, roots, acorns, lichen, and grasses. Occasionally, they supplement their diet with fish and insects. They do little more than eat and sleep due to their low-calorie diet.[citation needed]

Bamboo shoots are more easily digested than leaves, exhibiting the highest digestibility in summer and autumn, intermediate digestibility in the spring, and lowest digestibility in the winter. These variations correlate with the nutrient contents in the bamboo. Red pandas process bamboo poorly, especially the cellulose and cell wall components. This implies that microbial digestion plays only a minor role in their digestive strategy. In order to survive on this poor-quality diet, they have to eat the high-quality sections of the bamboo plant such as the tender leaves and shoots in large quantities, over 1.5 kilograms / 3.3 pounds of fresh leaves and 4 kilograms / 8.8 pounds of fresh shoots daily. This food passes through the digestive tract fairly rapidly (~2–4 hours) so as to maximize nutrient intake.[19] Red pandas can taste artificial sweeteners such as aspartame, the only known non-primate to be able to do so.[20]

Reproduction

Red panda cubs playing

Red pandas are able to reproduce at around 18 months of age, and are fully mature at 2–3 years. Adults rarely interact in the wild except to mate. Both sexes may mate with more than one partner during the mating season from mid-January to early March.[21] A few days before birth, females begin to collect material, such as brushwood, grass, and leaves, to build a nest, which is normally located in a hollow tree or a rock crevice. After a gestation period of 112 to 158 days, the female gives birth in mid-June to late July to about one to four blind and deaf cubs weighing 110 to 130 grams (3.9 to 4.6 oz) each.[5]

After birth, the mother cleans the cubs and can then recognize each by their smell. At first, she spends 60% to 90% of her time with the cubs. After the first week, the mother starts spending more time outside the nest, returning every few hours to nurse and groom the cubs. She moves the young frequently among several nests, all of which she keeps clean. The cubs start to open their eyes at about 18 days of age. By about 90 days, they have achieved full adult fur and coloring, and begin to venture out of the nest. They also start eating solid foods at this point, weaning at around 6–8 months of age. The cubs stay with their mother until the next litter is born in the following summer. Males rarely help raise the young, and only if they live in pairs or in small groups.[5]

The average lifespan is 8–10 years, but individuals have been known to reach 15 years.

Threats

A red panda in the Parco Natura Viva, Bussolengo near Verona, Italy

The primary threats to red pandas are direct harvest from the wild, live or dead, competition with domestic livestock resulting in habitat degradation, and deforestation resulting in habitat loss or fragmentation. The relative importance of these factors is different in each region, and is not well understood.[8] For instance, in India the biggest threat seems to be habitat loss followed by poaching, while in China the biggest threat seems to be hunting and poaching.[2] A 40% decrease in red panda populations has been reported in China over the last 50 years, and populations in western Himalayan areas are considered to be lower.[16]

Deforestation can inhibit the spread of red pandas and exacerbate the natural population subdivision by topography and ecology, leading to severe fragmentation of the remaining wild population. Fewer than 40 animals in 4 separate groups share resources with humans in Nepal's Langtang National Park, where only 6% of 1,710 square kilometres (660 sq mi) is preferred red panda habitat. Although direct competition for food with domestic livestock is not significant, livestock can depress bamboo growth by trampling.[22]

Small groups of animals with little opportunity for exchange between them face the risk of inbreeding, decreased genetic diversity, and even extinction. In addition, clearcutting for firewood or agriculture, including hillside terracing, removes old trees that provide maternal dens and decreases the ability of some species of bamboo to regenerate.[8]

In Southwest China, red pandas are hunted for their fur, especially for the highly valued bushy tails from which hats are produced. In these areas, the fur is often used for local cultural ceremonies, and in weddings the bridegroom traditionally carries the hide. The "good-luck charm" red panda-tail hats are also used by local newlyweds.[16]

In the past, red pandas were captured and sold to zoos. Glatston reports that "in International Zoo News, Munro (1969) reported he personally had handled 350 red pandas in seventeen years."[23]

Thanks to CITES this number has decreased substantially in recent years, but poaching continues, and red pandas are often sold to private collectors at exorbitant prices. In some parts of Nepal and India, red pandas are kept as pets.[24]

The red panda has a naturally low birth rate (usually single or twin births per year), and a high death rate in the wild.

Conservation

The red panda has been confused with other animals
Red panda in Gangtok Zoo, Sikkim

The red panda is listed in CITES Appendix I.[25] The species has been classified as vulnerable in the IUCN Red List since 2008 because the global population is estimated at about 10,000 individuals, with a decreasing population trend; only about half of the total area of potential habitat of 142,000 km2 (55,000 sq mi) is actually being used by the species. Due to their shy and secretive nature, and their largely nocturnal habits, observation of red pandas is difficult. Therefore, population figures in the wild are determined by population density estimates and not direct counts.[2]

Worldwide population estimates range from fewer than 2,500 individuals[21] to between 16,000 and 20,000 individuals.[9] In 1999, the total population in China was estimated at between 3,000 and 7,000 individuals.[16] In 2001, the wild population in India was estimated at between 5,000 and 6,000 individuals.[9] Estimates for Nepal indicate only a few hundred individuals.[26] There are no records from Bhutan or Burma.

Reliable population numbers are hard to find, partly because other animals have been mistaken for the red panda. For instance, one report from Burma stated that red pandas were still fairly common in some areas, and was accompanied by a photograph of a "red panda" as proof. The photograph in question depicted a species of civet.[27]

The red panda is protected in all range countries, and hunting is illegal.[2] Beyond this, conservation efforts are highly variable between countries:

In situ initiatives

A community-managed forest in Ilam District of eastern Nepal is home to 15 red pandas who generate household income through tourism activities including home stay. Villagers in the high‐altitude areas of Arunachal Pradesh have formed the Pangchen Red Panda Conservation Alliance comprising five villages with a community‐conserved forest area of 200 km2 (77 sq mi) at an altitude of 2,500 m (8,200 ft) to over 4,000 m (13,000 ft).[29]

In captivity

Red Panda National Zoo.ogv
A red panda moves around its enclosure at the National Zoo in Washington, DC.

The red panda is quite adaptable to living in captivity, and is common in zoos worldwide. By 1992, there had been more than 300 births in captivity, and there were more than 300 individuals living in 85 institutions worldwide.[30] By 2001, there were 182 individuals in North American zoos alone.[31] As of 2006, the international studbook listed more than 800 individuals in zoos and parks around the world. Out of these, 511 individuals of subspecies fulgens were kept in 173 institutions[32] and 306 individuals of subspecies styani were kept in 81 institutions.[33]

The International Studbook is currently managed at the Rotterdam Zoo in the Netherlands. In cooperation with the International Red Panda Management Group, they coordinate the Species Survival Plan in North America, the European Endangered Species Programme in Europe and other captive breeding programs in Australia, India, Japan and China.[33][34] In 2009, Sarah Glass, Curator of red pandas and Special Exhibits at the Knoxville Zoo in Knoxville, Tennessee, was appointed as coordinator for the North American Red Panda Species Survival Plan. The Knoxville Zoo has the largest number of captive red panda births in the Western Hemisphere (101 as of August 2011). Only the Rotterdam Zoo in the Netherlands has had more captive births worldwide.[32][33]

Successes in red panda captive breeding includes:

Because the red panda is considered a very attractive animal, and is not much larger than a house cat, it would seem to be ideal for a pet. Despite this, and despite reports that Indira Gandhi kept red pandas as pets when she was a child, there does not seem to have ever been widespread adoption of these animals as pets.[47] Due to its listing in CITES Appendix I, obtaining a red panda as a pet would now be quite difficult. Interestingly, due to the red panda's high levels of captive breeding and recent successful efforts of domestication by selective breeding of the red fox, domestication could be possible. However, because of their low tolerances for high temperature areas, the red panda if ever domesticated may not be suitable as pets in some areas or special care would be needed to keep them happy. Though there is growing interest in the general public of the availability of this animal as a pet, there does not appear to be any person or group attempting to domesticate the red panda through any process including selective breeding. Domestication may also be a viable method of successful conservation though it should not be the only form.[48]

Phylogenetics

The taxonomic classification of the red panda has been controversial since it was discovered. French zoologist Frédéric Cuvier initially described the red panda in 1825, and classified it as a close relative of the Raccoon (Procyonidae), even though he gave it the genus name Ailurus "cat" based on superficial similarities with domestic cats. The specific epithet is the Latin adjective fulgens "shining".[49] At various times it has been placed in Procyonidae, Ursidae, with Ailuropoda in Ailuridae, and in its own family, Ailuridae. This uncertainty comes from difficulty determining whether certain characteristics of Ailurus are phylogenetically conservative or are derived and convergent with species of similar ecological habits.[5]

A Red panda gnawing on an exfoliated bamboo bush.

Evidence based on the fossil record, serology, karyology, behavior, anatomy, and reproduction reflect closer affinities with Procyonidae than Ursidae. However, ecological and foraging specializations and distinct geographical distribution in relation to modern Procyonids support classification in the separate family Ailuridae.[1][5][50]

Recent molecular-systematic DNA research also places the red panda into its own family Ailuridae, which is in turn part of the broad superfamily Musteloidea that also includes skunk, raccoon, and weasel families.[4][50][51]

It is not a bear, nor closely related to the giant panda, nor a raccoon, nor a lineage of uncertain affinities. Rather it is a basal lineage of musteloid, with a long history of independence from its closest relatives (skunks, raccoons, and otters/weasels/badgers).
—Flynn et al., Whence the Red Panda,[4] p197

The name Ailurus fulgens refulgens is sometimes incorrectly used for A. f. styani. This stems from a lapsus made by Henri Milne-Edwards in his 1874 paper "Recherches pour servir à l'histoire naturelle des mammifères comprenant des considérations sur la classification de ces animaux",[52] making A. f. refulgens a nomen nudum.[6][17] The most recent edition of "Mammal Species of the World" still shows the subspecies as A. f. refulgens.[1] This has been corrected in more recent works including "A guide to the mammals of China"[53] and "Handbook of the Mammals of the World, Volume 1: Carnivores."[3]

Evolutionary history

The red panda is considered a living fossil and only distantly related to the Giant Panda (Ailuropoda melanoleuca). Their common ancestor can be traced back to the Early Tertiary Period tens of millions of years ago, with a wide distribution across Eurasia. Fossils of the red panda Parailurus anglicus have been unearthed from China in the east to Britain in the west.[54]

In 1977, a single tooth of the extinct panda Parailurus was discovered in the Pliocene Ringold Formation of Washington State. This first North American record is almost identical to European specimens and indicates the immigration of this species from Asia.[55] In 2004, a tooth from a red panda species never before recorded in North America was discovered at the Gray Fossil Site in Tennessee. The tooth dates from 4.5–7 million years ago.[56] This species described as Pristinailurus bristoli indicates that a second, more primitive ailurine lineage inhabited North America during the Miocene. Cladistic analysis suggests that Parailurus and Ailurus are sister-taxa.[54][57]

The discovery in Spain of the postcranial remains of Simocyon batalleri, a Miocene relative to the red panda, supports a sister-group relationship between red pandas and giant pandas. The discovery suggests that the red panda's "false thumb" was an adaptation to arboreal locomotion — independent of the giant panda's adaptation to manipulate bamboo — one of the most dramatic cases of convergent evolution among vertebrates.[58]

Taxonomic history

Red panda at Munich Zoo, Germany

The first known written record of the red panda occurs in a 13th-century Chinese scroll depicting a hunting scene between hunters and the red panda.[30][47]

Major General Thomas Hardwicke’s 1821 presentation of an article titled "Description of a new Genus of the Class Mammalia, from the Himalaya Chain of Hills Between Nepaul and the Snowy Mountains" at the Linnean Society in London is usually regarded as the moment the red panda became a bona fide species in Western science. Hardwicke proposed the name "Wha" and explained: "It is frequently discovered by its loud cry or call, resembling the word ‘Wha’, often repeating the same : hence is derived one of the local names by which it is known. It is also called Chitwa." Hardwicke's paper was not published until 1827, by which time Frédéric Cuvier had published his description and a figure. Hardwicke's originally proposed taxonomic name was removed from the 1827 publication of his paper with his permission, and naming credit is now given to Cuvier.[59]

Frédéric Cuvier had received the specimen he described from his brother's stepson Alfred Duvaucel who had sent it "from the mountains north of India".[60] He was the first who used both the binomial Ailurus fulgens and the vernacular name Panda in reference to the species in his description published in 1825 in Histoire Naturelle des Mammifères.[61][62] Ailurus is adopted from the ancient Greek word αἴλουρος meaning cat.[63] Fulgens is Latin for shining, bright.[64] Panda is the French name for the Roman goddess of peace and travelers, who was called upon before starting a difficult journey.[65] Whether this is the origin of the French vernacular name Panda remains uncertain. In later publications, the name is claimed to be adopted from a Himalayan language.

Local names

Red Panda in Padmaja Naidu Himalayan Zoo, Darjeeling, India

The red panda's local names differ from place to place. The Lepcha people call it sak nam. In Nepal, the species is called bhalu biralo (bear-cat) and habre. The Sherpa people of Nepal and Sikkim call it ye niglva ponva and wah donka.[66] The word wậː is Sunuwari meaning bear; in Tamang language, a small, red bear is called tāwām.[67] In the Kanchenjunga region of eastern Nepal, the Limbus know red pandas as Kaala, which literally means dark because of their underside pelage; villagers of Tibetan origin call them Hoptongar.[68]

Additionally, Pocock lists the vernacular names Ye and Nigálya ponya (Nepal); Thokya and Thongwa (Limbu); Oakdonga or Wakdonka and Woker (Bhotia); Saknam Sunam (Lepcha).[6] Nigálya may originate from the Nepali word निङालो niṅālo or nĩgālo meaning a particular kind of small bamboo, namely Arundinaria intermedia, but also refers to a kind of small leopard, or cat-bear.[69] The word pónya may originate from the Nepali word पञ्जा pajā meaning claw, or पौँजा paũjā meaning paw of an animal.[70] Nigálya pónya may translate to 'bamboo claw' or 'bamboo paw'.

Nigálya pónya, nyala ponga,[citation needed] and poonya[citation needed] are said to mean eater of bamboo.[citation needed] It could be that the name panda originates from panjā.[71]

In English, the red panda is also called lesser panda, though due to the pejorative implications of this name, "red" is generally preferred.[2] Many other languages use red panda, or variations of shining/gold or lesser/small in their names for this species. For instance, червена панда in Bulgarian, panda roux in French, and panda rojo in Spanish all mean red panda. Since at least as far back as 1855, one of its French names has been panda éclatant (shining panda).[72] In Finnish, it is called kultapanda ("gold panda"). Variations of lesser panda occur in French petit panda ("small panda"), in Spanish panda menor ("lesser panda"), in Dutch kleine panda ("small panda"), in Russian «малая панда» (malaya panda, "small panda"), in Korean 애기판다 (aeki panda, "baby panda"), in Japanese ressā panda (レッサーパンダ transliteration of English "lesser panda"?).

Other names attributed to this species include fire cat, bright panda and common panda.[30]

In Chinese language, the red panda is called 小熊貓 (xiǎo​xióng​māo​, lesser panda or small panda),[73] and 红熊猫/紅熊貓 (hóng​xióng​māo, red panda).[74]

Note: The Giant Panda is called 熊猫/熊貓 (xióngmāo) OR 大熊猫/大熊貓 (dàxióngmāo), in which literally means "giant" or "big" and 熊猫/熊貓 literally means "bear cat".[75]

The English name firefox is often claimed by English sources to be a literal translation of the Chinese name for the red panda.[76][77][78][79][80] But the Chinese word 火狐 huǒ​hú​ refers to the Firefox web browser.[81][82][83]

Cultural depictions

The red panda was recognized as the state animal of Sikkim, India in the early 1990s,[84] and was the mascot of the Darjeeling Tea Festival.[47]

In southwest China red pandas are hunted for their fur, especially for the highly valued bushy tails from which hats are produced. In these areas the fur is often used for local cultural ceremonies. In weddings the bridegroom traditionally carries the hide. The "good-luck charm" red panda-tail hats are also used by local newlyweds.[16] This practice may be quite old, as the red panda seems to be depicted in a 13th century Chinese pen and ink scroll showing a hunting scene. There is little or no mention of the red panda in the culture and folklore of Nepal.[47]

The Firefox browser is said to have been named after a Chinese name for red panda: 火狐, or "fire fox." However, Mozilla's documents don't mention the red panda among their motivations:

It's similar to Firebird. It's easy to remember. It sounds good. It's unique. We like it. And we weren't able to find any other project or company even remotely similar to a web browser that uses the same name.
—Mozilla.org, Why change the name?[85]

In addition, an article on its branding by the artist says that although a firefox is a red panda, the logo design is a red fox.[86] Despite these statements, Mozilla says that Firefox is another name for Red Panda (citing a mirror of the Wikipedia red panda article as its source[87]), and in 2010 the Firefox Web site started linking to a "live feed of firefox cubs"[88] (red pandas[89]).

An anthropomorphic red panda was featured as Master Shifu, the Kung Fu teacher, in the 2008 film Kung Fu Panda and its 2011 sequel Kung Fu Panda 2. Some of the comments about this film indicate the lack of awareness about the red panda in the United States when the first film was released. Although most of the reviewers got the species correct, some nevertheless mistook it for a tiny wolf,[90] a rodent,[91] and a lemur.[92] In an interview, Dustin Hoffman also indicated that he did not know much about the animal when he first agreed to voice the character.[93][94]

In 2005, Babu, a male red panda at Birmingham Nature Centre in Birmingham, England, escaped[95] and briefly became a media celebrity,[95][96] before being recaptured. He was subsequently voted "Brummie of the Year", the first animal to receive this honor.[95][96]

Footnotes

  1. ^ a b c Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001690. 
  2. ^ a b c d e f g h i j k Wang, X., Choudhry, A., Yonzon, P., Wozencraft, C., Than Z. (2008). "Ailurus fulgens". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/714. Retrieved 26 June 2010. 
  3. ^ a b Don E. Wilson, Russell A. Mittermeier, ed. (2009). Handbook of the Mammals of the World, Volume 1: Carnivores. Lynx Edicions. p. 503. ISBN 978-84-96553-49-1. 
  4. ^ a b c Flynn, J. J.; Nedbal, M. A.; Dragoo, J. W.; Honeycutt, R. L. (2000). "Whence the Red Panda?". Molecular Phylogenetics and Evolution 17 (2): 190–199. doi:10.1006/mpev.2000.0819. PMID 11083933. http://www.msb.unm.edu/mammals/publications/Flynn2000.pdf. Retrieved 2009-09-23. 
  5. ^ a b c d e f g h i j k Roberts, M. S.; Gittleman, J. L. (1984). "Ailurus fulgens". Mammalian Species (222): 1–8. http://si-pddr.si.edu/dspace/bitstream/10088/4231/1/Roberts1984.pdf. 
  6. ^ a b c d Pocock, R.I. (1941). Fauna of British India, including Ceylon and Burma. Mammalia. – Volume 2.. Taylor and Francis, Ltd., London. pp. 250–264. http://www.archive.org/stream/PocockMammalia2/pocock2#page/n273/mode/2up. 
  7. ^ Fisher, R. E.; Adrian, B.; Clay, E.; Hicks, M. (2008). "The phylogeny of the red panda (Ailurus fulgens): evidence from the hindlimb". Journal of Anatomy 213 (5): 607–28. doi:10.1111/j.1469-7580.2008.00987.x. PMC 2667555. PMID 19014366. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2667555. 
  8. ^ a b c d e Glatston 1994:20
  9. ^ a b c Choudhury, A. (2001). "An overview of the status and conservation of the red panda Ailurus fulgens in India, with reference to its global status". Oryx (Flora & Fauna International) 35 (3): 250–259. doi:10.1046/j.1365-3008.2001.00181.x. 
  10. ^ Wegge, P. (1976) Himalayan shikar reserves: surveys and management proposals. Field Document No. 5. FAO/NEP/72/002 Project, Kathmandu.
  11. ^ Sharma, H.P., Belant, J.L. (2009) Distribution and observations of Red Pandas Ailurus fulgens fulgens in Dhorpatan Hunting Reserve, Nepal. Small Carnivore Conservation, Vol. 40, April 2009: 33–35
  12. ^ Bolton, M. (1976) Lake Rara National Park management plan. Working Document No. 3. FAO/UNDP National Parks and Wildlife Conservation Project, Nepal
  13. ^ Sharma, H. P. (2008) Distribution and conservation status of Red PAilurus fulgens) in Rara National Park, Nepal. Final Report to People’s Trust for Endangered Species, London, U.K.
  14. ^ Bing Su, Yunxin Fu, Wang, Y., Li Jin, Chakraborty, R. (2001). "Genetic Diversity and Population History of the Red PAilurus fulgens) as Inferred from Mitochondrial DNA Sequence Variations". Molecular Biology and Evolution (2001) 18 (6): 1070–1076. PMID 11371595. http://mbe.oxfordjournals.org/cgi/content/full/18/6/1070. 
  15. ^ Exclusive: Traces of Red Panda Found in Tennessee. AOl News, August 9, 2010. Retrieved on 2011-11-23.
  16. ^ a b c d e Wei, F.; Feng, Z.; Wang, Z.; Hu, J. (1999). "Current distribution, status and conservation of wild red pandas Ailurus fulgens in China". Biological Conservation 89 (89): 285–291. doi:10.1016/S0006-3207(98)00156-6. 
  17. ^ a b Glover, A. M. (1938). The Mammals of China and Mongolia. New York: American Museum of Natural History. pp. 314–317. http://www.archive.org/stream/mammalsofchinamo01alle#page/314/mode/2up. 
  18. ^ Thomas, O. (1902). "On the Panda of Sze-chuen". Annals and Magazine of Natural History (London: Gunther, A.C.L.G., Carruthers, W., Francis, W.) X: pp. 251–252. http://www.archive.org/stream/s7annalsmagazine10londuoft#page/251/mode/1up 
  19. ^ Wei, F, Feng, Z., Wang, Z., Zhou, A., Hu, J. (1999). "Use of the nutrients in bamboo by the red panda Ailurus fulgens". Journal of Zoology 248 (4): 535–541. doi:10.1111/j.1469-7998.1999.tb01053.x. 
  20. ^ "Pandas opt for low-cal sweeteners". 2008-04-16. http://news.bbc.co.uk/2/hi/science/nature/8002978.stm. Retrieved 2008-05-08. 
  21. ^ a b R. M., Nowak (1999). Walker’s Mammals of the World. 2 (sixth ed.). Baltimore: Johns Hopkins University Press. pp. 695–696. ISBN 0-8018-5789-9. 
  22. ^ Yonzon, P. B., Hunter Jr., M. L. (1991). "Conservation of the red panda Ailurus fulgens". Biological Conservation 58 (57): 85. doi:10.1016/0006-3207(91)90046-C. 
  23. ^ Glatston 1994:11
  24. ^ World Wildlife Fund. "I'm a good luck charm. That's my bad luck.". http://www.wwfindia.org/red_panda.cfm. Retrieved 2009-09-26. 
  25. ^ "Appendices I, II and III". cites.org. CITES. http://www.cites.org/eng/app/appendices.shtml. Retrieved 8 December 2010. 
  26. ^ Massicot, P. (2006). "Animal Info: Red Panda". http://www.animalinfo.org/species/carnivor/ailufulg.htm. Retrieved 2008-09-02. 
  27. ^ Glatston 1994:viii
  28. ^ Bhuju, U.R., Shakya, P.R., Basnet, T.B., Shrestha, S. (2007) Nepal Biodiversity Resource Book. Protected Areas, Ramsar Sites, and World Heritage Sites. International Centre for Integrated Mountain Development, Ministry of Environment, Science and Technology, in cooperation with United Nations Environment Programme, Regional Office for Asia and the Pacific. Kathmandu, ISBN 978-92-9115-033-5 pdf
  29. ^ Ghimire, N., Bhatta, S. D. (eds.) (2010) Red Pandas from Choyatar Headlines Himalaya No. 138, December 08‐14, 2010[dead link]
  30. ^ a b c Roberts, M. (1992). "Red Panda: The Fire Cat". http://nationalzoo.si.edu/Publications/ZooGoer/1992/2/redpandasfirecat.cfm. Retrieved 2009-11-26. 
  31. ^ ARKive (2008). "Red Panda". http://www.arkive.org/species/GES/mammals/Ailurus_fulgens/more_info.html. Retrieved 2008-09-02. 
  32. ^ a b Glatston 2007a
  33. ^ a b c Glatston 2007b
  34. ^ a b "National Studbook of Red PAilurus fulgens) Data till May 2009". http://www.cza.nic.in/redpandastudbook.pdf. Retrieved 2009-09-26. 
  35. ^ "Birth of Rare Red Pandas". Valley Zoo. 2008-05-26. http://www.valleyzoo.ca/pages/ValleyZoo/News.aspx?id=705. Retrieved 2008-09-06. 
  36. ^ "Rare panda newest resident at Edmonton zoo". Valleyzoo.ca. http://www.valleyzoo.ca/pages/ValleyZoo/News.aspx?id=919. Retrieved 2010-04-24. 
  37. ^ "Edmonton zoo's red panda cub dies". CBC News. September 10, 2010. http://www.cbc.ca/canada/edmonton/story/2010/09/10/edmonton-zoo-red-panda-dies.html. Retrieved 2010-09-10. 
  38. ^ "Endangered Red Panda Gives Birth to Quaduplets at Denver Zoo". Denver Zoo. August 13, 2009. http://www.denverzoo.org/about/stories2009.asp#pandas. Retrieved 2009-10-03. 
  39. ^ "Triplets at the Red River Zoo". Redriverzooredpandas.blogspot.com. 2009-06-11. http://redriverzooredpandas.blogspot.com. Retrieved 2010-04-24. 
  40. ^ "Red River Zoo welcomes new arrivals". WDAY-TV. 2011-08-02. http://www.wday.com/event/article/id/49986/. Retrieved 2011-08-02. 
  41. ^ "Newborns: Red Panda Bear Triplets Born at Cleveland MetroParks Zoo". 19ActionNews.com. September 11, 2009. http://www.woio.com/global/story.asp?s=11112684. Retrieved 2009-10-24. 
  42. ^ "Newborn panda cubs in the zoo". nrk.no. June 22, 2010. http://www.nrk.no/nyheter/norge/1.7180866. Retrieved 2010-06-23. 
  43. ^ "International Red Panda Day". zgzoo.com. November 13, 2010. http://www.zgzoo.com/en/news-and-events/events/international-red-panda-day/. Retrieved 2010-11-13. 
  44. ^ "NEWS RELEASE: Double the cuteness; double the fun! Two red panda cubs come out to play". 2010-10-06. http://calgaryzoo.org/images/stories/pdf/news/News%20Release-RedPandaCubsDebut2010.pdf. Retrieved 2010-12-15. 
  45. ^ http://nationalzoo.si.edu/Animals/AsiaTrail/RedPanda/2011cubs.cfm/
  46. ^ http://boston.cbslocal.com/2011/08/08/franklin-park-zoo-welcomes-twin-red-panda-cubs/
  47. ^ a b c d IUCN/SSC Mustelid, Viverrid, and Procyonid Specialist Group (1994). A. R. Glatston. ed. The Red Panda, Olingos, Coatis, Raccoons, and Their Relatives. Gland, Switzerland: IUCN. ISBN 2-8317-0046-9. http://data.iucn.org/dbtw-wpd/edocs/1994-015_en.pdf. Retrieved 2010-01-09. 
  48. ^ Brant Abbott & G. Cornelis van Kooten, 2008. "Can Domestication of Wildlife Lead to Conservation? The Economics of Tiger Farming in China," Working Papers 2009-01, University of Victoria, Department of Economics, Resource Economics and Policy Analysis Research Group.
  49. ^ Simpson DP (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd.. ISBN 0-304-52257-0. 
  50. ^ a b Flynn, J. J.; 2, J. A.; Zehr, S.; 3, J.; Nedbal, M. A. (2005). "Molecular phylogeny of the carnivora (mammalia): assessing the impact of increased sampling on resolving enigmatic relationships". Systematic Biology 54 (2): 317–337. doi:10.1080/10635150590923326. PMID 16012099. http://sysbio.oxfordjournals.org/cgi/reprint/54/2/317. Retrieved 2009-10-08. 
  51. ^ Flynn, J. J.; Nedbal, M. A. (1998). "Phylogeny of the Carnivora (Mammalia): Congruence vs incompatibility among multiple data sets". Molecular Phylogenetics and Evolution 9 (3): 414–426. doi:10.1006/mpev.1998.0504. PMID 9667990. 
  52. ^ Milne-Edwards, H. (1874). Recherches pour servir à l'histoire naturelle des mammifères comprenant des considérations sur la classification de ces animaux. G. Masson, Paris. p. 394. 
  53. ^ Smith, A. T.; Yan Xie, ed. (2008). A guide to the Mammals of China. Princeton, N.J: Princeton University Press. ISBN 978-0-691-09984-2. http://books.google.de/books?id=ka-9f68nPT4C&printsec=frontcover#v=onepage&q&f=false. 
  54. ^ a b Naish, Darrin (2008-04-05). "The once mighty red panda empire". Tetrapod Zoology. http://scienceblogs.com/tetrapodzoology/2008/04/red_panda_empire.php. Retrieved 9 January 2010. 
  55. ^ Tedford, R.H., Gustafson, E.P. (1977). "First North American record of the extinct panda Parailurus". Nature 265 (5595): 621–623. doi:10.1038/265621a0. 
  56. ^ "Rare find uncovered at Gray Fossil Site". ETSU Accent. The Faculty-Staff Newsletter of East Tennessee State University. http://www.etsu.edu/univrel/accent/ac021904.pdf. Retrieved 2010-11-25. 
  57. ^ Wallace, Steven C.; Wang, Xiaoming (30 September 2004). "Two new carnivores from an unusual late Tertiary forest biota in eastern North America". Nature 431 (7008): 556–559. doi:10.1038/nature02819. PMID 15457257. 
  58. ^ Salesa, Manuel J.; Mauricio, Antón; Peigné, Stéphane; Morales, Jorge (2006). "Evidence of a false thumb in a fossil carnivore clarifies the evolution of pandas". PNAS 103 (2): 379–382. doi:10.1073/pnas.0504899102. PMC 1326154. PMID 16387860. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1326154. 
  59. ^ Hardwicke, T. (1827). "Description of a new Genus of the Class Mammalia, from the Himalaya Chain of Hills between Nepaul and the Snowy Mountains" (in Latin and English). The Transactions of the Linnean Society of London. (Linnean Society of London) XV: 161–165. http://www.archive.org/stream/transactionsofli15182627linn#page/160/mode/2up. 
  60. ^ Cuvier, G. (1829). Le règne animal distribué d'après son organisation. Tome 1. Chez Déterville, Paris. pp. 138: Le Panda éclatant. http://www.archive.org/stream/lergneanimaldi01regn#page/138/mode/2up/search/panda. 
  61. ^ Cuvier, F. (1825) "Ailurus. Ailurus fulgens. Panda." 3 pages, 1 plate. In: Geoffroy Saint-Hilaire, E.; Cuvier, F. (eds.) Histoire naturelle des Mammifères, avec des figures originales, coloriées, dessinées d'après des animaux vivans: publié sous l'autorité de l'administration du Muséum d'Histoire naturelle (50). A. Belin, Paris
  62. ^ "Panda". NYPL Digital Gallery. 25 June 2010. http://digitalgallery.nypl.org/nypldigital/dgkeysearchdetail.cfm?trg=1&strucID=114503&imageID=106776&total=1&e=w. Retrieved 26 November 2010. 
  63. ^ Perseus Digital Library. Greek Dictionary αἴλουρος Headword Search Result
  64. ^ Perseus Digital Library. Latin Dictionary fulgens Headword Search Result
  65. ^ Larousse, P. (1866–77) Grand dictionnaire universel du XIXe siècle : français, historique, géographique, mythologique, bibliographique, littéraire, artistique, scientifique Panda ou Pantica Larousse et Boyer, Paris
  66. ^ Shrestha, T. K. (2003) Wildlife of Nepal: a study of renewable resources of Nepal Himalayas Steven Simpson Books book preview
  67. ^ Hale, Austin (ed.) (1973) Clause, sentence, and discourse patterns in selected languages of Nepal 4: Word lists. Summer Institute of Linguistics Publications in Linguistics and Related Fields, 40(4). Norman: Summer Institute of Linguistics of the University of Oklahoma. vii, 314 p. online : see page 110
  68. ^ Yonzon, P.B. (1996) Status of wildlife in the Kanchenjunga region. A reconnaissance study report. WWF Nepal Program, Kathmandu
  69. ^ Turner, R.L.. "A Comparative and Etymological Dictionary of the Nepali Language". http://dsal.uchicago.edu/cgi-bin/philologic/search3advanced?dbname=turner&query=nigalo&matchtype=exact&display=utf8. Retrieved 10 December 2010. 
  70. ^ Turner, R.L.. "A Comparative and Etymological Dictionary of the Nepali Language". http://dsal.uchicago.edu/cgi-bin/philologic/search3advanced?dbname=turner&query=panja&matchtype=exact&display=utf8. Retrieved 10 December 2010. 
  71. ^ Catton, Chris (1990). Pandas. pp. 4–5. ISBN 0-8160-2331-X. 
  72. ^ Gervais, M. Paul (1855) (in French). Histoire Naturelle des Mammifères, Avec L'Indication De Leurs Moeurs, Et De Leurs Rapports, Avec Le Arts, Le Commerce, et L'Agriculture. 2. L. Curmer. p. 23. http://books.google.com/?id=RD8AAAAAQAAJ&printsec=frontcover. Retrieved 2009-12-04. 
  73. ^ "小熊貓". MDBG Chinese-English Dictionary. 2011. http://www.mdbg.net/chindict/chindict.php?page=worddict&wdrst=1&wdqb=%E5%B0%8F%E7%86%8A%E8%B2%93. 
  74. ^ "紅熊貓". MDBG Chinese-English Dictionary. 2011. http://www.mdbg.net/chindict/chindict.php?page=worddict&wdrst=1&wdqb=%E7%B4%85%E7%86%8A%E8%B2%93. 
  75. ^ "The Online Chinese-English English-Chinese Dictionary". dict.cn. 2008. http://dict.cn/en/. Retrieved 29 November 2009. 
  76. ^ Garrity, S., Markham, G., Goodger, B., Decrem, B. et al. 1998–2011 What's a Firefox? — A "Firefox" is another name for the red panda. Mozilla.org
  77. ^ "Red Panda Network: Fun facts". Red Panda Network. 2008. Archived from the original on June 5, 2008. http://web.archive.org/web/20080605122005/http://www.redpandanetwork.org/forkids/funfactsactivities.php. Retrieved 18 December 2009. 
  78. ^ "Red Pandas". Wellington Zoo. 2008. http://www.wellingtonzoo.com/net/explore/animals.aspx?id=20. Retrieved 18 December 2009. 
  79. ^ "Animals & Exhibits: Red Panda". Lincoln Children's Zoo. http://lincolnzoo.vipasuite.com/animals/mammals/panda. Retrieved 18 December 2009. [dead link]
  80. ^ Species Survival Commission (1995). Racoons and their Relatives. IUCN – The World Conservation Union. p. 4. ISBN 2-8317-0051-5. 
  81. ^ "火狐". MDBG Chinese-English Dictionary. 2011. http://www.mdbg.net/chindict/chindict.php?page=worddict&wdrst=1&wdqb=%E7%81%AB%E7%8B%90. 
  82. ^ "Chinese-English Talking Dictionary". YellowBridge. http://www.yellowbridge.com/chinese/chinese-dictionary.php. Retrieved 5 December 2009. 
  83. ^ "English / Chinese / English Online Dictionary". CIN. 2008. http://www.asinah.net/chinese.html. Retrieved 5 December 2009. 
  84. ^ "The Official Website of the Government of Sikkim". Government of Sikkim. http://www.sikkim.gov.in/. Retrieved 15 November 2010. 
  85. ^ "Why change the name?". mozilla.org. http://www.mozilla.org/projects/firefox/firefox-name-faq.html. Retrieved 8 December 2009. 
  86. ^ Hicks, Jon (2004-08-02). "Branding Firefox". HickDesign. http://hicksdesign.co.uk/journal/branding-firefox. Retrieved 8 December 2009. 
  87. ^ "Red panda (Ailurus fulgens)". BBC. http://www.bbc.co.uk/nature/species/Red_Panda. Retrieved 12 December 2009. 
  88. ^ "Firefox 3.6.13 update page". mozilla.org. http://www.mozilla.com/en-US/firefox/3.6.13/whatsnew/. Retrieved 27 December 2010. 
  89. ^ "Red Panda webcam on FirefoxLive". mozilla.org. http://firefoxlive.mozilla.org/. Retrieved 27 December 2010. 
  90. ^ Keller, Louise (2008). "Kung Fu Panda". urbancinefile.com.au. Urban Cinefile. http://www.urbancinefile.com.au/home/view.asp?a=14440&s=video_files. Retrieved 2 May 2010. 
  91. ^ Boyce, Maree (30 June 2008). "No Extra Cost for Kung Fu Panda’s ‘awesomeness’". media-culture.org.au. MC Culture. http://reviews.media-culture.org.au/modules.php?name=News&file=article&sid=2645. Retrieved 2 May 2010. 
  92. ^ Pappas, Jim (2 June 2008). "Movie Review: Kung Fu Panda". the-trades.com. The Trades. http://www.the-trades.com/article.php?id=10328. Retrieved 2 May 2010. 
  93. ^ Symkus, Ed (4 June 2008). "Dustin Hoffman on his new role as the voice of a red panda". wickedlocal.com. Wicked Local Watertown. http://www.wickedlocal.com/watertown/fun/entertainment/arts/x572597095/Dustin-Hoffman-on-his-new-role-as-the-voice-of-a-red-panda. Retrieved 2 May 2010. 
  94. ^ Vigil, Delfín (1 June 2008). "Hoffman's Challenge: Playing a New Species". sfgate.com. San Francisco Chronicle. http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2008/05/30/PKKO10U6KL.DTL. Retrieved 2 May 2010. 
  95. ^ a b c "Red panda boosts visitor numbers". BBC Online. 2006-01-24. http://news.bbc.co.uk/1/hi/england/west_midlands/4642784.stm. Retrieved 12 January 2011. 
  96. ^ a b Bounds, Jon. "Brummie of the Year 2005". Birmingham: It's Not Shit. http://www.birminghamitsnotshit.co.uk/award/brummie-of-the-year-2005. Retrieved 12 January 2011. 

References

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!