Articles on this page are available in 2 other languages: Spanish (12), Dutch (1) (learn more)

Overview

Brief Summary

Every dune has its bunny! In reality, rabbits haven't been found in the Netherlands all that long. They were imported during the Middle Ages for their fur and meat. In 1950, rabbits were very common in Dutch dunes. But because they ate so much and dug holes, people were not thrilled with all those rabbits. They were hunted and combatted. However, when diseases such as myxomatosis and VHS practically decimated the population around 1990, nature managers suddenly realized how useful the rabbits could also be. They can keep grass short and thereby help to fight overgrowth in the dunes. Fortunately, rabbits are making a come back in many places.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Rabbits tend to be active during the evening and night, but in areas where they are undisturbed by humans they become more active during the day (5). They feed on a wide range of vegetation, including grasses, tree bark, crops, and herbs (5). They live in groups numbering between a single pair and up to 30 individuals, inside burrow systems known as 'warrens' (4). Burrowing is carried out solely by females (3). Within a warren, two distinct hierarchies operate, one amongst bucks, the other amongst does; an individual's status is set during play-fighting as a young rabbit (3). Fighting may occur between two males over a receptive doe (3). Scent marking known as 'chinning', because the scent glands are located underneath the chin, is exhibited by both sexes but is more frequent in males than females. This behaviour reinforces the social ranking of an individual (3). Sexual maturity is reached at 3.5 months in does and 4 months of age in bucks, and breeding tends to occur between January and August. Courtship involves males chasing females, and spraying them with urine (3). Mating is a brief affair, lasting just a few seconds, but is repeated frequently while the female is receptive. Gestation takes about 30 days, and one litter is usually produced each month, each litter consisting of 2-7 blind, helpless and naked young (kittens), which are born in a nest lined with fur from the mother's belly (3). Foxes, mink, stoats, polecats, and wildcats prey upon all ages of rabbit; badgers, weasels, buzzards and domestic cats prey on juveniles (5). Rabbits are very alert mammals, with a keen sense of smell. When feeding, they periodically rear up on their back legs to look for danger; they warn other rabbits of danger by thumping their back legs on the ground and raising the white tail, signals that cause other rabbits to bolt back to the safety of the warren (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

One of our best-known wild mammals, the rabbit was introduced to Great Britain during the Twelfth century AD by the Normans (3). Its hopping gait (2), long mobile ears and short 'bob-tail' have endeared this species to children and adults alike, and domesticated rabbits are popular pets (3). The coat is normally greyish-brown, but can range from sandy yellow to totally black. The belly and underside of the tail are white (3). Rabbits are smaller than hares, and have comparatively shorter legs (3). Males (bucks) and females (does) are similar in appearance, but bucks tend to weigh more and have slightly broader heads (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: Apparently native throughout southwestern Europe and northwestern Africa. Introduced to many other regions including: Great Britian; Ukraine; New Zealand; Australia; South America; islands of the central Pacific Ocean (Hawaii: presently on Manana and Lehua); and North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Oryctolagus cuniculus, also called a European, an Old World, or a domestic rabbit, is the only species in its genus. The last Ice Age confined the species to the Iberian peninsula and small areas of France and northwest Africa, but due to human action and adaptability of this species, European rabbits today exist in the wild on every continent except Asia and Antarctica. Domesticated O. cuniculus may be found worldwide.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

  • Parker, S. 1990. Grzimek's Encyclopedia of Mammals. New York, NY: McGraw-Hill, Inc..
  • Wilson, D., D. Reeder. 1993. Mammal Species of the World: A Taxonomic and Geographic Reference. Washington, D.C: The Smithsonian Institution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Original distribution after last ice age included Iberian Peninsula (Spain and Portugal) to western France and northern Africa, and the introduction throughout western Europe is thought to have occurred as early as the Roman period (Gibb 1990, Mitchell-Jones et al. 1999).

Currently ranges through all Western European countries, Ireland and the UK (including islands), Austria, parts of Sweden, Poland, the Czech Republic, Hungary, Romania, Ukraine, and Mediterranean islands Sicily, Corsica, Sardinia, Crete, the Balearics (Thompson and King 1994), Croatia, and Slovakia (Mitchell-Jones et al. 1999). Introduced to Australia, in 1788 and again in 1859, where it is now widespread (Thompson and King 1994). Introduced to South America unsuccessfully several times since the mid-nineteenth century, successfully in about 1936 where it maintains limited range in Argentina and Chile (Thompson and King 1994). Found in many islands in the Pacific, off the African coast, New Zealand, and the Caribbean (Thompson and King 1994).

O. cuniculus is usually found below 1,500 m in elevation (Fa et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Rabbits originate from southwest Europe and north-west Africa, but they have been introduced to many countries including South Africa, Australia, New Zealand, and North and South America, for a range of reasons, not least the need for a ready supply of meat (3). Rabbits are at present widespread and common throughout Britain and Ireland (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Wild O. cuniculus weigh between 1.5 and 2.5 kg, and are from 38 to 50 cm long. Domestic individuals may be larger. The coat is generally grayish, with black and brown (and sometimes red) sprinkled throughout. The underside of the body is paler gray, and the underside of the tail is white. Melanistic specimens are not unusual. (Macdonald, 1984)

This species (and rabbit species generally) have smaller ears and shorter, less powerful legs than their hares.

Oryctolagus cuniculus is the ancestor of all domestic rabbits (about 80 varieties!). Domesticated O. cuniculus vary tremendously in size, fur type, coloration, and general appearance. (Nowak, 1999)

Range mass: 1.5 to 2.5 kg.

Range length: 38 to 50 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Average basal metabolic rate: 7.395 W.

  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File Publications.
  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The John's Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 60 cm

Weight: 2300 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Oryctolagus cuniculus prefers a mixed habitat of Mediterranean oak savanna or scrub-forest, or areas with around 40% cover for shelter from predators and open areas that support their diet of grasses and cereals (Thompson and King 1994; Ward 2005). O. cuniculus builds warrens in soft soil, but find shelter in scrub in rocky areas, though predation risk is higher in above ground dwellings. The natural range of the Iberian peninsula and northern Africa is warm and dry (Angulo 2003), rarely occurring above 1,500 m (Fa et al. 1999). The rabbits are territorial and tend to live and forage in colony groups of up to 20 adults (Mitchell-Jones et al. 1999), and are crepuscular (Ward 2005).

O. cuniculus can breed throughout the year (uncommon in lagomorphs), though this is limited by climate and resource availability (Bell and Webb 1991). They raise altricial young between three and six at a time, which leave the warren in under a month (Gibb 1990). Females reach sexual maturity on average in 3.5 months, males 4 months, and can live up to 9 years (Macdonald and Barrett 1993), though many succumb to predation and other perils much earlier. Up to 75% of young rabbits are killed by predators before they establish a territory (Chapman and Flux 1990, Angulo 2004). Annual mortality was 30% in a studied island population (Macdonald and Barrett 1993). The head-body length of O. cuniculus is 34-50 mm (Macdonald and Barrett 1993).

O. cuniculus is a keystone species, composing the diet of over forty species, several of which specialize in O. cuniculus (Delibes and Hiraldo 1981). The diet of the Iberian lynx consists of 80-100% rabbits (Delibes et al. 2000), the Imperial eagle consumes 40-80% of its diet in rabbits, and the decline of O. cuniculus has been linked to the near extinction of these two predators (Zofio and Vega 2000).

O. cuniculus is responsible for landscape modelling that supports vegetation growth typical to Spain and Portugal and creates habitat for invertebrate species (Virgos et al. 2005), increases species richness, and increase soil fertility (Willott et al. 2000).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The preferred habitats of this species include dry areas near sea level with soft, sandy soil (for easy burrowing). Brushy fields are preferred for the cover they provide, but forests are also inhabited. Cultivated land was once well-suited, but this is no longer the case due to modern plowing techniques which destroy rabbit burrows. Particularly in central Europe, O. cuniculus has learned to coexist with humans in cities, making its home in parks and cemeteries as well as gardens and lawns. Human activities, particularly the spread of agriculture, have often inadvertently helped this species to colonize new areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily found in short grasses, agricultural pastures, and scrub areas. Digs extensive burrow systems. Young are born in underground burrows in nests lined with vegetation and the mother's belly fur.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A highly adaptable species, rabbits tend to prefer areas where the soil is loose and free draining, with cover such as scrub or rocks. Favoured habitats include small fields of arable or pasture with hedgerows, as well as sand dunes. They tend to avoid coniferous woodlands, damp areas, and very rarely occur above the tree line (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Oryctolagus cuniculus is a generalized herbivore, eating a diverse diet of grasses, leaves, buds, tree bark, and roots. Gardeners know them to eat lettuce, cabbage, root vegetables, and grains.

Although the diet is relatively low in nutritional value, and high in indigestible material, O. cuniculus is one of several rabbit species that are known to reingest feces (coprophagy) to obtain extra nourishment from their food. The species has a very large caecum, in which bacterial fermentation of otherwise indigestible material occurs. Periodically, the contents of the caecum are defecated and reingested. These rabbits are thought to depend upon this process for some essential nutrients, which are released or produced by bacteria and absorbed on this second pass through the digestive system. (Macdonald, 1984; Vaughan, 2000)

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: dung

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Grasses and other herbaceous plants. Also may eat bark and twigs of woody plants and agricultural crops.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / carrion / dead animal feeder
gymnothecium of Actinodendron verticillatum feeds on dead bone of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Actinomucor elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Agrocybe pediades is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
larva of Aphodius brevis feeds on dung/debris usually part dried dung of Oryctolagus cuniculus
Other: major host/prey

Plant / resting place / within
imago of Aphodius coenosus may be found in dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium leporinum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium macrotheca is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium mendax is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus boudieri is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus brassicae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious apothecium of Ascobolus ciliatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus crenulatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus degluptus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus mancus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus minutus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus stercorarius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary or gregarious apothecium of Ascodesmis microscopica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile, densely gregarious apothecium of Ascophanus bresadolae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus crouanii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus cunicularius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus parvisporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus subhirtus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus woolhopensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea bombardioides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea serignanensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea stercoris is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Cephalotrichum dematiaceous anamorph of Cephalotrichum nanum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Cephalotrichum dematiaceous anamorph of Cephalotrichum purpureofuscum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Echinobotryum dematiaceous anamorph of Cephalotrichum stemonitis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / associate
sporangiophore of Chaetocladium brefeldii is associated with dung of Oryctolagus cuniculus

Animal / associate
sporangiophore of Chaetocladium jonesii is associated with dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Chaetomium atrobrunneum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium aureum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium bostrychodes is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium crispatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium elatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Chaetomium globosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium murorum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium quadrangulatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
sessile apothecium of Cheilymenia raripila is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite
Cheyletiella parasitivorax ectoparasitises body of Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Chorioptes cuniculi is ectoparasitoid of Oryctolagus cuniculus

Animal / parasite / endoparasite
tapeworm of Cittotaenia denticulata endoparasitises intestine of Oryctolagus cuniculus

Animal / parasite / endoparasite
tapeworm of Cittotaenia pectinata endoparasitises intestine of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta hansenii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta ligniaria is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta saccardoi is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta scatigena is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Coprinopsis filamentifer is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Coprinus sterquilinus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinus tuberosus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus albidus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus glaucellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus niveus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus rhyparobioides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Coprotus sexdecimsporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

In Great Britain and/or Ireland:
Animal / dung saprobe
fruitbody of Cyathus stercoreus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia chaetomoides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia consociata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia didyma is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia furfuracea is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia marchalii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia myriaspora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia niesslii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia winteri is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Plant / resting place / within
Diastictus vulneratus may be found in entrance to burrow of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
sporangiophore of Dispira cornuta is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / endoparasite
Eimeria stiedae endoparasitises very swollen, with large yellowish white areas of dead tissue liver of Oryctolagus cuniculus

Animal / dung associate
larva or puparium of Fannia manicata inhabits dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria hepatica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria leporum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria theioleuca is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / endoparasite
worm of Graphidium strigosum endoparasitises stomach of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Hebeloma radicosum is saprobic in/on dung or excretions of nest of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra brefeldii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra equorum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra merdaria is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra planispora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Iodophanus carneus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Oryctolagus cuniculus

Animal / dung saprobe
apothecial stroma of Lanzia cuniculi is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor genevensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor mucedo is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor racemosus f. sphaerosporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Mycocalia denudata is saprobic in/on dung or excretions of wet, weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Mycocalia duriaeana is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / pathogen
Myxoma virus infects Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Notoedres is ectoparasitoid of crusty manged eye of Oryctolagus cuniculus

Animal / parasite / ectoparasite
Notoedres cati ectoparasitises ear, then rest of body of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
colony of Onychophora anamorph of Onychophora coprophila is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Fungus / feeder
Oryctolagus cuniculus feeds on subterranean ascoma of Elaphomyces granulatus

Animal / parasite / endoparasite
Passalurus ambiguus endoparasitises caecum of Oryctolagus cuniculus

Animal / dung saprobe
coremium of Penicillium dematiaceous anamorph of Penicillium claviforme is saprobic in/on dung or excretions of dung Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Peziza bovina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
substipitate or sessile apothecium of Peziza fimeti is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
colony of Oedocephalum anamorph of Peziza vesiculosa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary or clustered, sessile apothecium of Pezizella albula is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilaira anomala is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilaira moreaui is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. crystallinus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. kleinii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung associate
sporangiophore of Piptocephalis cylindrospora inhabits dung of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Piptocephalis freseniana is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Piptocephalis lepidula is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
Podops inuncta feeds on dung/debris dung of Oryctolagus cuniculus
Remarks: Other: uncertain

Animal / dung saprobe
long rooted, perithecial stroma of Podosordaria leporina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
long rooted, perithecial perithecium of Podosordaria tulasnei is saprobic in/on dung or excretions of buried dung of Oryctolagus cuniculus
Remarks: captive: in captivity, culture, or experimentally induced

Animal / dung saprobe
superficial perithecium of Podospora appendiculata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora collapsa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora communis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
immersed, neck protruding perithecium of Podospora curvicolla is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora decipiens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora granulostriata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora gwynne-vaughaniae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora perplexens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora pleiospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
stalked stroma of Poronia erici is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung associate
larva of Potamia littoralis inhabits dung of Oryctolagus cuniculus

Virus / infection vector
Potato Mosaic virus X is spread by Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Psoroptes communis is ectoparasitoid of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Pyxidiophora petchii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered, often immersed apothecium of Ryparobius dubius var. dubius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious, partly immersed apothecium of Ryparobius pachyascus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary, superficial, sessile apothecium of Saccobolus caesariatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus dilutellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered, superficial, sessile apothecium of Saccobolus globuliferellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious, superficial, sessile apothecium of Saccobolus obscurus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus versicolor is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite
burrowing mite of Sarcoptes scabei ectoparasitises lesioned face of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium glutinans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium nanum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium pilosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium squamulosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium tetrasporum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
gymnothecium of Shanorella spirotricha feeds on dung/debris fur of Oryctolagus cuniculus

Animal / dung saprobe
gregarious perithecium of Sordaria fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly grouped perithecium of Sordaria humana is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
grouped perithecium of Sordaria macrospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered perithecium of Sordaria polyspora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
grouped perithecium of Sordaria superba is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Sphaeronaemella fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite / blood sucker
adult of Spilopsyllus cuniculi sucks the blood of young of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella antarctica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella bipartis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella corynespora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella heptamera is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella intermedia is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella leporina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella octomera is saprobic in/on dung or excretions of old dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pulchella is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnema of Stilbella anamorph of Stilbella erythrocephala is saprobic in/on dung or excretions of old dung of Oryctolagus cuniculus
Other: major host/prey

Animal / parasite / endoparasite
Cysticercus larva of Taenia pisiformis endoparasitises liver of Oryctolagus cuniculus

Animal / parasite / endoparasite
Coenurus larva of Taenia serialis endoparasitises muscle of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Thamnidium elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious apothecium of Thelebolus microsporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Thelebolus nanus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, sessile apothecium of Thelebolus polysporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
cleistothecium of Thielavia wareingii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / associate
fruitbody of Trechispora clancularis is associated with disused burrow of Oryctolagus cuniculus

Animal / parasite / endoparasite
worm of Trichostrongylus retortaeformis endoparasitises ilium (anterior part) of Oryctolagus cuniculus

Animal / associate
imago of Typhaeus typhoeus is associated with dung of Oryctolagus cuniculus

Animal / dung saprobe
superficial, stromatal perithecium of Wawelia octospora is saprobic in/on dung or excretions of incubated dung of Oryctolagus cuniculus
Remarks: captive: in captivity, culture, or experimentally induced

Animal / dung saprobe
scattered, superficial cleistothecium of Zopfiella erostrata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Rabbits are preyed upon by a wide variety of carnivores, including canines, felines, mustelids, hawks and owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious. "Warrens" (extensive burrow systems with many entrances) may occupy an area of more than 1 hectare. Predators include domestic cats, foxes, weasels, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Oryctolagus cuniculus is generally nocturnal, spending its days underground and foraging from evening until morning. Though generally silent, rabbits are capable of making loud screams when frightened or injured. They communicate with each other through scent cues and touch, and thump their hindlimbs on the ground to warn of danger. (Nowak, 1999; Parker, 1990)

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: vibrations

Perception Channels: visual ; infrared/heat ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Domestic rabbits can live to be up to nine years old. However, mortality during the first year of life in wild populations is generally quite high, and can reach as much as 90%.

Average lifespan

Status: wild:
9 years.

Average lifespan

Status: captivity:
9 years.

Typical lifespan

Status: wild:
1 (high) years.

Average lifespan

Status: wild:
less than 1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years Observations: Although in the wild females reach full sexual maturity at the age of 2 years, in domesticated animals females can reproduce when they are only three months old. There are many anecdotes concerning the longevity of rabbits. It has been estimated that both in the wild and in captivity they rarely live more than 9 years (Ronald Nowak 1999). A rabbit in Australia called "Flopsy" reportedly lived 18.8 years in captivity after being caught in the wild (http://www.guinnessworldrecords.com/), but this record cannot be confirmed. Record longevity in zoos and parks is only 7.9 years belonging to one female at Frankfurt Zoo (Richard Weigl 2005). Further studies are necessary to better estimate the maximum longevity of these animals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating in rabbits is generally polygynandrous, though males will attempt to monopolize particular females.

Mating System: polygynandrous (promiscuous)

Rabbits are well-known for their reproductive capacity. Oryctolagus cuniculus is capable of reproducing year-round, but most breeding activity takes place in the first half of the year. Gestation is about 30 days, and the average litter contains 5 to 6 young. Females experience postpartum estrus and thus may have several litters per year, though spontaneous abortions and resorption of embryos are common (possibly due to environmental or social stresses). (Vaughan, 2000; Nowak, 1999)

One reason for the reproductive success of rabbits is induced ovulation, where eggs are only released in response to copulation. (Macdonald, 1984) Rabbit placentae allow an unusually high degree of contact between maternal and fetal bloodstreams, a condition they share with humans. Thus, they are useful models for the study of human pregnancy and fetal development. (Banks, 1989)

Neonates, called kittens, are naked, blind and helpless. The mother visits the nest for only a few minutes each day to nurse them, but the milk is extremely rich. Young are weaned at four weeks of age, attain sexual maturity at about eight months, and can live up to nine years old. However, mortality rates in the first year of life frequently exceed 90%. (Nowak, 1999; Macdonald, 1984)

Breeding interval: Breeding may occur approximately monthly.

Breeding season: These animals breed throughout the year, although most breeding takes place in the first half of the year.

Range number of offspring: 1 to 14.

Average number of offspring: 6.

Range gestation period: 30 to 37 days.

Average gestation period: 30 days.

Range weaning age: 22 to 31 days.

Average weaning age: 28 days.

Average time to independence: 4 weeks.

Average age at sexual or reproductive maturity (female): 8 months.

Average age at sexual or reproductive maturity (male): 8 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous ; post-partum estrous

Average birth mass: 45 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Females provide maternal care to their altricial young. Males are not involved in caring for young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File Publications.
  • Vaughan, T., J. Ryan, N. Czaplewski. 2000. Mammology. New York, NY: Harcourt, Inc..
  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The John's Hopkins University Press.
  • Banks, R. 1989. "Rabbits: Models and Research Applications (USAMRIID Seminar Series)" (On-line). Accessed November 29, 1999 at http://netvet.wustl.edu/species/rabbits/rabtmodl.txt.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Main part of mating season occurs January-June. Gestation lasts 28-33 days. Females give birth to 3-9 young; as many as 6 litters per year. On island in Hawaii, productivity is low: average of 6.6 young/adult female/year (Dixon 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryctolagus cuniculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTTTTCTCTACCAACCACAAAGACATCGGCACTCTTTATCTCCTATTTGGAGCTTGAGCTGGGATGGTGGGAACAGCCCTCAGCCTGCTAATTCGAGCAGAATTAGGTCAGCCAGGGACTCTACTCGGGGAT---GATCAAATCTATAATGTAATCGTCACCGCACATGCCTTTGTAATAATCTTCTTTATAGTCATGCCTATTATAATTGGAGGCTTCGGGAACTGGCTTGTCCCCCTGATAATTGGGGCTCCTGACATAGCCTTCCCCCGAATAAATAATATGAGCTTCTGACTTCTCCCCCCTTCATTCCTTCTTCTACTAGCCTCCTCAATAGTAGAAGCTGGGGCGGGGACTGGCTGAACTGTTTATCCACCTCTAGCCGGTAATCTTGCACATGCTGGAGCCTCAGTGGATCTTACTATTTTCTCCCTTCACTTAGCTGGAGTATCATCTATTTTAGGGGCTATTAACTTTATTACAACTATTATTAATATGAAAGCCCCTGCAATATCTCAATATCAAACCCCCTTATTCGTATGATCTGTTCTAATCACAGCCGTACTTCTTCTTCTCTCTTTACCAGTCCTAGCTGCTGGCATTACAATGCTTTTAACAGACCGAAACTTAAATACAACCTTCTTTGATCCTGCAGGAGGAGGAGACCCTATCCTCTACCAACACCTATTCTGATTTTTCGGGCACCCCGAAGTATATATTCTTATTCTTCCAGGATTTGGAATAATTTCGCACATTGTGACATACTATTCCGGGAAAAAAGAGCCATTTGGCTATATAGGAATAGTATGAGCTATAATATCAATTGGTTTCCTTGGATTTATCGTATGGGCCCATCATATATTTACAGTAGGAATAGATGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryctolagus cuniculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Smith, A.T. & Boyer, A.F.

Reviewer/s
Ward, D. & Johnston, C.H. (Lagomorph Red List Authority)

Contributor/s

Justification
Oryctolagus cuniculus is a widespread colonizer and is considered a pest outside its natural range, where eradication of the rabbit is priority for conservation (Thompson and King 1994). However, only the natural range of Spain, Portugal, and northwestern Africa (Morocco and Algeria) are considered in this global assessment.

O. cuniculus populations within the natural range have declined an estimated 95% since 1950, and 80% in Spain since 1975 (Delibes et al. 2000), due to disease, habitat loss, and human induced mortality (Ward 2005). These numbers are based on estimates from a protected area in Spain, Donana National Park, and the relative decline elsewhere in the range (Delibes et al. 2000). O. cuniculus nearly meets the Red List Criteria for Vulnerable under A2acde. There is no evidence that the decline has escalated in recent years, though threats remain and the decline is continuing.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Few mammal species are farther from extinction than O. cuniculus. Not only is it valuable to humans as a domestic and game animal, but wild populations have established themselves successfully in many parts of the world. However, one variety of O. cuniculus found on islands in the Atlantic and Mediterranean may be at risk. (Wilson & Reeder, 1993)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not legally protected in Great Britain (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Oryctolagus cuniculus decline has escalated in recent years. In Spain the rabbit has declined to 20% of the population size from 1975 (Virgos et al. 2005). As of 2005, rabbit populations in the Iberian peninsula have declined to as little as 5% of the number from 1950, based on the decrease in Donana National Park, a protected area (Delibes et al. 2000). Density of rabbits has been recorded at a maximum of 40 per hectare in prime habitat, though the abundance has declined significantly since the arrival of new threats in the mid 20th century (Angulo 2004).

In Portugal, a population reduction of 24% was recorded between 1995 and 2002 (Alves and Ferreira 2002).

Decline has been uneven across the range, due to varying degrees of threat (Ward 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The greatest force behind the decline of Oryctolagus cuniculus has been two diseases that appeared in the 20th century. Myxomatosis is a South American virus, primarily spread by insect (mosquito and flea) vectors, that was intentionally introduced by a farmer in the mid 1950s in France to control the rabbit population (Angulo and Cooke 2002). An estimated 90% of European rabbits have perished due to myxomatosis since the 1950s (Virgos et al. 2005). After symptom onset, death results in an average of 13 days (Ward 2005). Rabbits with the virus are made more vulnerable to predators (Villafuerte et al. 1995). Juveniles are more susceptible to myxomatosis than adults. Myxomatosis cases peak during early summer to fall (Angulo 2004).

Rabbit Haemorrhagic Disease (RHD) is a virus that appeared in Europe in the late 1980’s, initially causing the death of 55-75% of rabbits in the Iberian peninsula (Villafuerte et al. 1995). RHD is primarily spread by direct contact. Death typically results within 24 hours of symptom onset, with a short incubation time of under 48 hours (Villafuerte et al. 1995). Adult rabbits are more susceptible to RHD than juveniles (unlike myxomatosis), and RHD is more prevalent in late winter and spring (Angulo 2004). Global warming may increase disease incidence by creating a warmer, drier climate in Spain and Portugal (Ward 2005).

Habitat loss and fragmentation are continuing causes of decline for O. cuniculus, which requires scrub-forest vegetation for food and shelter (Ward 2005). Modern intensive agriculture negatively impacts rabbits more than small scale mixed farming, which may have initially increased suitable habitat within the rabbit’s natural range (Delibes et al. 2000). High intensity livestock production contributes to habitat degradation and resource competition. Fallow farm land often returns to closed forest rather than scrub, which is not a suitable habitat (Ward 2005). Tree plantations planted in Spain and Portugal have replaced habitat for both rabbits and their predators and urbanization presents a threat as does increased fire danger in existing habitat, and climate change (Ward 2005).

Exploitation of O. cuniculus by humans has recently become a threat, especially as the populations are already declining due to other causes, so rabbits cannot sustain hunting and control measures as well as in the past. Farmers control rabbit populations directly by poisoning, trapping, and destroying warrens. They indirectly cause decline through habitat conversion and excessive pesticide and fertilizer use. Hunting presents a threat to rabbit populations, compounded by their existing decline from disease, possibly eliminating many rabbits that have acquired resistance to the diseases (Delibes et al. 2000). 70% of Spain is designated as hunting area. Hunter registration doubled between 1960 and 2005 (Angulo 2003), though the overall catch is declining, probably due to shrinking rabbit abundance (Ward 2005).

Future threats to the European rabbit may include a genetically modified version of the myxomatosis virus being developed in Australia to suppress rabbit fertility where the European rabbit has been introduced (ABC 2003). Unlicensed release of the modified virus to the native range could devastate the remaining populations (Ward 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In 1953 the Myxoma virus killed a massive 99% of the British rabbit population (5). A level of resistance is now apparent (4), and although the virus is still present in the population, the mortality caused has fallen substantially (5). Rabbit haemorrhagic disease (RHD) was first identified in British rabbits in 1994, and the combined effect of myxomatosis (the disease caused by the Myxoma virus) and RHD is as yet unknown (5). Rabbits are serious agricultural pests and their populations are controlled by shooting, trapping and exclusion in many areas. They can pose serious threats to sensitive habitats, yet conversely, rabbit grazing is essential for the maintenance of other threatened habitats such as calcareous grasslands (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation for Oryctolagus cuniculus was delayed for several decades after their decline became apparent. Efforts began to take shape in the late 1980's due to previous political isolation of its native range and the lack of information on the species as a keystone to Iberian ecosystems. The issue of eradication of O. cuniculus from introduced areas (e.g. Australia, New Zealand, and many islands) may have diminished the appearance of rabbit decline in its native range. Increased interest in the specialist predators that depend upon the rabbits and the issue of the sustainability of hunting populations have brought O. cuniculus into the public eye, but fail to address some issues of rabbit conservation, such as its role as an ecosystem modeler and the effects of agriculture on populations (Gibb 1990, Ward 2005).

Oryctolagus cuniculus occurs in some protected areas within its natural range, including Donana National Park in Spain (Ward 2005) and Serra da Malcata Nature reserve in Portugal (700 km²) where the Iberian lynx is protected.

Dan Ward's 2005 report outlines specific goals needed to achieve rabbit recovery:
- Establish rabbit monitoring programs to accurately describe decline directly.
- Create and implement a management plan for rabbit recovery that prioritizes critical ranges and populations. Some plans have begun for local regions, including Donana National park.
- Programs to limit the incidence and impact of new and existing diseases may be difficult in the wild, though some success has been observed in captive populations. Current vaccines do not confer total immunity to RHD or myxomatosis, have side effects such as increasing vulnerability to predators, and have short-lived effectiveness. A genetically modified live myxomatosis virus vaccine, LapinVac, is controversial because of the possibility of unpredictable evolution of the virus, and its potential spread to rabbit populations outside the natural O. cuniculus range where eradication, not conservation, is the objective. Increasing habitat quality may indirectly help rabbit disease resistance. Controlling disease vectors for myxomatosis has not been found to be effective. Preventing the spread of modified immunocontraceptive viruses engineered in Australia to control rabbit fertility may become an issue.
- Reducing hunting impact is not guaranteed to reduce decline because disease effects often outweigh hunting as a threat, and because implementation of restrictions would likely not be realistic given the prevalence of hunting in Iberia. Revisions to existing hunting seasons have been proposed and some tested, but even moving the season to summer when rabbits are most abundant has caused concern in trials because the overall catch increases and the season coincides with a peak in death from disease. A growing recognition among hunters of the issue of rabbit decline has led to some self-restraint, and though often well intentioned, uninformed management strategies are leading to inappropriate actions. Rather than focusing on hunting restraint, many hunters exert efforts to reduce rabbit predators, which are not directly responsible for decline. As a very large demographic, hunters could represent a powerful force in maintaining sustainable hunting populations, if the awareness of the issue of decline increased within this group.
- Rabbit populations affected by agriculture represent a sensitive issue, as rabbits are typically seen as a pest and an economic liability for farmers. Despite pressures from environmental groups, many farmers continue to take measures to eradicate rabbits from their land, even in areas where rabbit populations have declined dramatically. Awareness among farmers of rabbit conservation issues is low. Government policy allows farmers to control rabbits with permits, and though crop loss due to rabbit damage is economically subsidized, no requirement of those compensated is made for conservation.
- Halting and reversing habitat loss and fragmentation was aided in the 1990s by the establishment of many national parks in Spain, but much optimal rabbit habitat is on private land. A shift from high-intensity farming and monoculture forestry back to mixed agro-forestry and small scale farming would help sustain rabbit populations. Natura 2000 promotion of sustainable development and EU subsidies supporting environmentally friendly agriculture are promising but underfunded and too new to demonstrate a significant impact. Eucalyptus plantation removal has demonstrated a positive effect on rabbit populations, but may compromise other environmental issues such as erosion and conditioned bird habitat, as well as economic impact.
- Reintroductions have been a key focus of conservation efforts, with up to 500,000 released annually in Spain and France. The efforts so far have not increased rabbit populations, due to increased mortality from predation and inadvertent spread of disease, which may actually have a net negative impact. The flaws in reintroduction practices do not completely negate the importance of the efforts, which have been shown to help sustain predators and hunting populations. The success of reintroductions may be increased by fencing from predators and competitors and preventing dispersal.
- Though rabbit predators have not directly caused rabbit decline, factors that have caused initial decline (e.g. disease, habitat loss) are exacerbated by some opportunistic predators (while not caused by specialist predators like the Iberian lynx and Imperial eagle). Game keeping efforts to increase rabbit populations often focus on predator reduction, sometimes counter productively, causing decline of top predators that are already threatened. Efforts could be more productively focused on habitat protection, reduction of rabbit mortality by humans (hunting and poisoning), and reducing disease impacts.

The importance of O. cuniculus within its natural range requires that it be considered for listing in spite of its global abundance. It is a keystone to the Iberian ecosystem, as prey for specialist predators (Virgos et al. 2005) and as a landscape modeler (Delibes et al. 2000, Ward 2005). It is an important game species in Spain and Portugal (Ward 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Rabbits are not legally protected in Great Britain (4). Following the crash in rabbit numbers caused by myxomatosis, many species dependent on rabbit grazing for the maintenance of their habitats, such as the large blue butterfly (Maculinea arion) suffered greatly (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Oryctolagus cuniculus has been highly successful in most places where it has been introduced, and it is considered an agricultural pest in many areas (especially where its natural predators have been eliminated). These animals eat cultivated crops and compete with domestic animals for forage. Millions of dollars are spent annually in countries such as Australia, New Zealand, Britain, and the United States in efforts to control, confine or exterminate them. Additionally, rabbits have inflicted enormous ecological damage in some areas where they have been introduced.

Negative Impacts: crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Old World rabbits represent one of the most economically important mammal species. Wild O. cuniculus is a popular game animal, especially in Europe. Varieties of this speces are raised commercially for meat, skins and wool, and are popular as pets. These rabbits are used extensively (.5 million/year) in medical research and for testing the safety of chemicals and consumer products. (Nowak, 1999; Banks, 1989)

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Introduced populations are capable of devegetating island ecosystems (see Warner 1963 and Tomich 1986 for review of status and destructive effects in Hawaii). Introduced island populations may interfere with seabird nesting (Brown 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European rabbit

The European rabbit or common rabbit (Oryctolagus cuniculus) is a species of rabbit native to southwestern Europe (Spain and Portugal) and northwest Africa (Morocco and Algeria).[3] It has been widely introduced elsewhere, often with devastating effects on local biodiversity. However, its decline in its native range (caused by the diseases myxomatosis and rabbit calicivirus, as well as overhunting and habitat loss), has caused the decline of its highly dependent predators, the Iberian lynx and the Spanish Imperial eagle. It is known as an invasive species because it has been introduced to countries on all continents with the exception of Antarctica and sub-Saharan Africa, and caused many problems within the environment and ecosystems, as well. Australia has the most problems with European rabbits, due to the lack of natural predators there.

The European rabbit is well known for digging networks of burrows, called warrens, where it spends most of its time when not feeding. Unlike the related hares (Lepus spp.), rabbits are altricial, the young being born blind and furless, in a fur-lined nest in the warren, and they are totally dependent upon their mother. Much of the modern research into wild rabbit behaviour was carried out in the 1960s by two research centres. One was the naturalist Ronald Lockley, who maintained a number of large enclosures for wild rabbit colonies, with observation facilities, in Orielton, Pembrokeshire. Apart from publishing a number of scientific papers, he popularised his finding in a book The Private Life of the Rabbit,[4] which is credited by Richard Adams as having played a key role in his gaining "a knowledge of rabbits and their ways" that was espoused in the novel Watership Down. The other group was the Commonwealth Scientific and Industrial Research Organisation (CSIRO) in Australia, where Mykytowycz and Myers performed numerous studies of the social behaviour of wild rabbits. Since the onset of myxomatosis, and the decline of the significance of the rabbit as an agricultural pest, few large-scale studies have been performed and many aspects of rabbit behaviour are still poorly understood.

Contents

Terminology [edit]

Rabbits are known by many names. Young rabbits are known by the names 'bunny', 'kit', or 'kitten'. A male rabbit is called a 'buck', and a female rabbit is called a 'doe'. A group of rabbits is known as a 'colony' or a 'nest'.[5] Colloquially, a rabbit may be referred to as a "coney" or a "bunny", though the former is archaic. They are sometimes referred to comically as "underground mutton".

Physical description [edit]

A male and female European rabbit (profile)
A male and female European rabbit (face)

The European rabbit is a smallish, grey-brown (or sometimes black) mammal, although it ranks as medium-sized by lagomorph standards. It ranges from 34 to 50 cm (13 to 20 in) in length, not counting a tail of 4 to 8 cm (1.6 to 3.1 in). Weight can range from approximately 1.1 to 2.5 kg (2.4 to 5.5 lb).[6] As a lagomorph, it has four sharp incisors (two on top, two on bottom) that grow continuously throughout its life, and two peg teeth on the top behind the incisors, dissimilar to those of rodents (which have only two each, top and bottom). Rabbits have long ears, large hind legs, and short, fluffy tails. Rabbits move by hopping, using their long and powerful hind legs. To facilitate quick movement, a rabbit's hind feet have a thick padding of fur to dampen the shock of rapid hopping. Their toes are long, and are webbed to keep from spreading apart as the animal jumps.

Ecology and behavior [edit]

Habitat [edit]

European rabbits typically spend much of their time grazing on grass.

Rabbits are social animals, living in medium-sized colonies known as warrens. They are largely crepuscular, being most active around dawn and dusk, although they are not infrequently seen active during the day. During the day, rabbits prefer to reside in vegetated patches, which they use for protection from predators.[7] At night, they move into open prairie to feed.[7] Rabbit populations seem to be greatest in ecotone habitats and less in scrublands or grasslands.[8] Rabbits are essentially mixed-feeders, both grazing and browsing, but grass is their primary food source. They nevertheless have a diverse diet of grasses, leaves, buds, tree bark, and roots. They will also eat lettuce, cabbage, root vegetables, and grains. Birds of prey are the primary predators of rabbits in scrublands.[8] Rabbits in grasslands are preyed on by carnivores. Ecotone rabbits are preyed on by both.[8]

Social organization [edit]

Rabbit at burrow entrance

Rabbits live in warrens that contain two to 10 other individuals living in smaller groups to ensure greater breeding success.[9] Territoriality and aggression contribute greatly to the rabbits maturation process and help ensure survival of the population.[10] Mature male and females are better at fighting off predators.[10] Females tend to be more territorial than males, although the areas most frequented by females are not defended.[11] Rabbit mark their territories with dung hills.[12] They expel soft, mucus-covered pellets that are then reingested (coprophagy). They also expel larger pellets covered with secretions from the anal gland.[13] A rabbit’s success in repelling strangers depends on the potency of the pellets. When young rabbits leave their natal warrens, they either settle in pre-existing territories, unoccupied established territories or become transients.[14] Females tend to move into neighboring territories, while males tend to move further away.[14]

The rabbit mating system is rather complex. Dominant males exhibit polygyny, whereas lower-status individuals (males and females) often form monogamous breeding relationships. Rabbits signal when they are ready to copulate by marking inanimate objects while giving off odoriferous substances though their chin gland, a process known as "chinning".[15] Dominance hierarchies exist in parallel for both males and females. Social rank is based on the amount of group aggression.[16] The dominant buck has greater mobility and more aggression than the dominant doe. This is likely because males have to fight each other for the females.[11] The social hierarchy of males is also determined by a number of other factors, such as the size of his patrol area, the number of females that visit his area, resting time near females, the number of shelters he visits, and the distance he travels daily.

Rabbits can be extremely aggressive in the wild, and competition between males can often lead to severe injury and death. Although hostile displays are used, and males often squirt urine on challengers as a form of high dominance, this nearly always enrages the challenger, resulting in immediate attack.[4] Rabbits use their powerful back legs as weapons, kicking at an opponent's underside, as well as biting and scratching with the front paws.

Reproduction [edit]

European rabbit being killed by a stoat

Rabbits are famed for their reproductive capabilities. Although certainly not the strongest, fastest, or smartest of the mammals, they have carved out a strong ecological niche through their rate of impregnation, because female rabbits ovulate at the time of copulation. One striking example of rapid rabbit reproduction took place in Australia, where the 24 rabbits first introduced in 1859 had multiplied in number to over 600 million over the course of less than a century.[17][18]

The gestation cycle for a rabbit averages 31 days, although it can vary between 29 and 35 days. Litter sizes generally range between two and 12 rabbits. The young are born in a nesting burrow dug by the female, to which she returns once a day for four weeks for them to suckle.[19] The rabbit's reproductive abilities were the inspiration for the phrase "breeding like rabbits". They can reproduce from three to four months of age. They can produce four to seven litters of offspring per year; a mature female can be pregnant continuously for up to eight months. One single pair of mature rabbits is able to produce 30-40 offspring per year. Kittens are born in a nest in an isolated part of the warren. The females build, prepare and defend the nest. A doe will mark the nest with urine and fecal dropping to deter others from invading the site.[20] Does take care of the kittens without help from the bucks. However, bucks show considerable investment in the welfare of young, although much of this aspect of rabbit behavior is poorly understood. Males may be trying to enhance their social status by being surrounded by friendly individuals.[10]

A melanistic European rabbit

Humans' relationship with rabbits [edit]

Recent research has shown all European rabbits carry common genetic markers and descend from one of two maternal lines. These lines originated between 6.5 million and 12,000 years ago when glaciers isolated two herds; one on the Iberian Peninsula and the other in Mediterranean France. It can be surmised that man began hunting rabbits as a food source, but further research needs to occur. Little substantial evidence of man's relationship with the European rabbits is documented until the medieval period.[21]

Humans' relationship with the European (sometimes called "true") rabbit was first recorded by the Phoenicians prior to 1000 BC, when they termed the Iberian Peninsula i-shaphan-ím (literally, the land of the hyraxes). This phrase closely resembles related modern Hebrew: i (אי) meaning island and shafan (שפן) meaning hyrax, plural shfaním (שפנים). Phoenicians called the local rabbits 'hyraxes' because hyraxes resemble rabbits in some ways, and were probably more common than rabbits in their native land (the Levant) at the time. Hyraxes, like rabbits, are not rodents. According to one theory, Romans converted the phrase i-shaphan-ím, with influence by Greek Spania, to its Latin form, Hispania, which evolved into the modern Spanish word España, English "Spain", and such other variations of modern languages. The precise meaning of shafan remains unclear, but the balance of opinion appears to indicate the hyrax is indeed the intended meaning.[22]

The European rabbit is the only species of rabbit to be domesticated. All pet breeds of rabbits, such as dwarf lops and angoras, are of this species. However, rabbits and humans interact in many different ways beyond domestication. Rabbits are an example of an animal treated as food, pet, and pest by members of the same culture. Urbanized European rabbits descended from pets have become pest problems in some cities. For instance, one of the northernmost populations of the species is now hosted by Helsinki, Finland, with an estimated 2,500 animals at the end of 2006 and 5,000 in autumn, 2007.[23] Finland's native lagomorphs are the European hare and the mountain hare. In Iceland, populations are also found in Reykjavik and in the Vestmann Islands.

As an exotic pest [edit]

A European rabbit afflicted by myxomatosis
Feral rabbit on a farm in Victoria

The European rabbit has been introduced as an exotic species into a number of environments, with baleful results to vegetation and local wildlife. Locations include Britain, where they were first introduced by the Romans following their invasion in AD 43;[24] (as of November 2004 there were about 40 million European rabbits in the British Isles), Laysan Island (1903) and Lisianski Island in the Hawaiian Islands; Macquarie Island; Smith Island, San Juan Island(around 1900) later spreading to the other San Juan Islands; several islands off the coast of Southern Africa, one well-known example being that of Robben Island; Australia and New Zealand.[citation needed]

Twenty-four European rabbits were introduced to Australia in 1859 by estate owner Thomas Austin in Victoria. They soon spread throughout the country due to the lack of natural predators, widespread farming producing an ideal habitat, and mild Australian winters allowing them to breed year-round. Australia's equivalent to the rabbit, the bilby, was quickly pushed out by the rabbits. The bilbies are endangered, but are now making a comeback due to government protection. Between 1901 and 1907, Australia built an immense "rabbit-proof fence" to halt the westward expansion of the introduced rabbit population. The European rabbit can not only jump very high, but also burrow underground, making fencing especially futile. During the 1950s, experiments with introduction of a virus, Myxomatosis cuniiculi, provided some relief in Australia, but not in New Zealand, where the insect vectors necessary for spread of the disease were not present. Myxomatosis can also infect pet rabbits of the same species. Today's remaining wild rabbits in Australia are largely immune to myxomatosis. The rabbit haemorrhagic disease virus, which causes rabbit haemorrhagic disease, has been cleared as a safe form of biological control agent against the European rabbit in Australia.

Domesticated rabbits [edit]

The only rabbit to be widely domesticated is the European rabbit, which has been extensively domesticated for food or as a pet. It was first widely kept in ancient Rome and was refined into a wider variety of breeds during the Middle Ages.

Domesticated rabbits have mostly been bred to be much larger than wild rabbits, though selective breeding has produced a wide range of breeds, which are kept as pets and food animals across the world. They have as much colour variation among themselves as other household pets. Their fur is prized for its softness and even today, Angora rabbits are raised for their long, soft fur, which is often spun into yarn. Other breeds are raised for the fur industry, particularly the Rex, which has a smooth, velvet-like coat and comes in a wide variety of colours and sizes.

In the middle-sized breeds, the teeth grow approximately 125 mm (5 in) per year for the upper incisors and about 200 mm (8 in) per year for the lower incisors. The teeth abrade away against one another, giving them a constantly sharp edge.

Status [edit]

Portuguese National Authorities (ICNB) have classified the rabbit as Near Threatened in Portugal, whilst Spanish authorities recently reclassified the rabbit as Vulnerable in Spain.[25] In 2008, the European Rabbit was re-classified by the World Conservation Union (IUCN) as "Near Threatened" in its native range due to the extent of recent declines[26]

See also [edit]

References [edit]

  1. ^ Hoffman, R. S.; Smith, A. T. (2005). "Order Lagomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 205–206. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Smith, A. T. & Boyer, A. F. (2008). "Oryctolagus cuniculus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 26 May 2011.  Database entry includes a brief justification of why this species is Near Threatened
  3. ^ http://animaldiversity.ummz.umich.edu/site/accounts/information/Oryctolagus_cuniculus.html
  4. ^ a b RM Lockley (1964), The Private Life of the Rabbit, Andre Deutsch 
  5. ^ "The collective Noun Page". Retrieved 2008-01-30. 
  6. ^ Macdonald, D.W.; Barrett , P. (1993). Mammals of Europe. New Jersey: Princeton University Press. ISBN 0-691-09160-9. 
  7. ^ a b Moreno, S. and R. D. Villafuerte, Migues (1996). "Cover is safe during the day but dangerous at night: the use of vegetation by European wild rabbit." Canadian Journal of Zoology 74:1656-1660.
  8. ^ a b c Lombardi, L., N. Fernandez, et al. (2003). "Habitat-related Differences in Rabbit (Oryctolagus cuniculus) Abundance, Distribution, and Activity." Journal of Mammology 84(1):26-36.
  9. ^ Daly, J. C. (1981). "Effects of Social Organization and Environmental Diversity on Determining the Genetic Structure of a Population of the Wild Rabbit, Oryctolagus cuniculus." Evolution 35(4): 689-706.
  10. ^ a b c Dudzinski, M. L., R. Mykytowycz, et al. (1977). "Behavioral Characteristics of Adolescence in Young Captive European Rabbits, Oryctolagus cuniculus." Aggressive Behavior 3: 313-330.
  11. ^ a b Vastrade, F. M. (1987). "Spacing Behavior of Free-Ranging Domestic Rabbits, Oryctolagus cuniculus L." Applied Animal Behaviour Science 18:185-195.
  12. ^ Mykytowycz, R. and M. L. Dudzinski (1972). "Aggressive and Protective Behaviour of Adult Rabbits Oryctolagus cuniculus (L.) Towards Rabbits." Behaviour 43: 97-120.
  13. ^ Sneddon, I. A. (1991). "Latrine Use by the European Rabbit (Oryctolagus cuniculus)." Journal of Mammology 72(4): 769-775.
  14. ^ a b Kunkele, J. a. V. H., D. (1996). "Natal dispersal in the European wild rabbit." Animal Behavior 51:1047-1059.
  15. ^ Gonzalez-Mariscal, G., M. E. Albonetti, et al. (1997). "Transitory inhibition of scent marking by copulation in male and female rabbits." Animal Behavior 53:323-333.
  16. ^ Rodel, H. G., A. Bora, et al. (2004). "Density-dependent reproduction in the European rabbit: a consequence of individual response and age-dependent reproductive performance." Oikos 104:529-539.
  17. ^ "The virus that stunned Australia’s rabbits". Retrieved 2007-06-21. 
  18. ^ "Building a Rabbit "Bomb" in Australia". SCDWS Briefs 10 (4). January 1995. 
  19. ^ Hofmann,H: Wild Animals of Britain and Europe, HarperCollins 1995, pg.118-119 ISBN 0-00-762727-0
  20. ^ Mykytowycz, R. and M. L. Dudzinski (1972). "Aggressive and Protective Behaviour of Adult Rabbits Oryctolagus Cuniculus (L.) Towards Rabbits." Behaviour 43:97-120.
  21. ^ "History of Rabbit Domestication -- Western Europe". 
  22. ^ "The Camel, the Hare and the Hyrax, chapter 6". 
  23. ^ Kemppainen, Jouni K. (10 2007). "Kanit keskuudessamme (The rabbits among us)". Suomen Kuvalehti (in Finnish): 76–83. 
  24. ^ http://news.bbc.co.uk/1/hi/england/norfolk/4439339.stm
  25. ^ SECEM 2006 red list available at http://www.secem.es/PDFs/Lista%20roja%20SECEM.pdf
  26. ^ IUCN 2008 red list available at http://www.iucnredlist.org/apps/redlist/details/full/41291/0
  • Reversing Rabbit Decline 2005 report concerning efforts to recover rabbits in Spain and Portugal, supported by the IUCN Lagomorph and Cat Specialist Groups
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Domestic rabbit

A domestic rabbit or more commonly known as simply the rabbit is any of the several varieties of European rabbit that have been domesticated. Male rabbits are called bucks; females are called does. An older term for an adult rabbit is coney, while rabbit referred only to the young animals.[1] More recently, the term kit or kitten has been used to refer to a young rabbit. A young hare is called a leveret; this term is sometimes informally applied to a young rabbit as well.

Contents

History [edit]

Rabbits kept in cages for scientific experimentation

Phoenician sailors visiting the coast of Spain c. 12th century BC, mistaking the European rabbit for a species from their homeland (the rock hyrax Procavia capensis), gave it the name i-shepan-ham (land or island of hyraxes). A theory exists that a corruption of this name, used by the Romans, became the Latin name for Spain, Hispania – although this theory is somewhat controversial.[2] In Rome rabbits were raised in large walled colonies.

Selective breeding of rabbits began in the Middle Ages, when they were first treated as domesticated farm animals. By the 16th century, several new breeds of different colors and sizes were being recorded.

In the 19th century, as animal fancy in general began to emerge, rabbit fanciers began to sponsor rabbit exhibitions and fairs in Western Europe and the United States. Breeds were created and modified for the added purpose of exhibition, a departure from the breeds that had been created solely for food, fur, or wool. The rabbit's emergence as a household pet began during the Victorian era.

Domestic Rabbits have been popular in the United States since the late 19th century. What became known as the "Belgian Hare Boom", began with the importation of the first Belgian Hares from England in 1888 and soon after the founding of the first rabbit club in America, the American Belgian Hare Association. From 1898 to 1901, many thousands of Belgian Hares were imported to America.[3] Today, the Belgian Hare is considered one of the rarest breeds with less than 200 in the United States as reported in a recent survey.[4]

The American Rabbit Breeders Association (ARBA) was founded in 1910 and is the national authority on rabbit raising and rabbit breeds having a uniform Standard of Perfection, registration and judging system. The domestic rabbit continues to be popular as a show animal and pet. Many thousand rabbit shows occur each year and are sanctioned in Canada and the United States by the ARBA. Today, the domesticated rabbit is the third most popular mammalian pet in Britain after dogs and cats.

Rabbits have been, and continue to be, used in laboratory work such as production of antibodies for vaccines and research of human male reproductive system toxicology. The Environmental Health Perspective, published by the National Institute of Health, states, "The rabbit [is] an extremely valuable model for studying the effects of chemicals or other stimuli on the male reproductive system." According to the Humane Society of the United States, rabbits are also used extensively in the study of bronchial asthma, stroke prevention treatments, cystic fibrosis, diabetes, and cancer. Animal rights activists have opposed animal experimentation for non-medical purposes, such as the testing of cosmetic and cleaning products, which has resulted in decreased use of rabbits in these areas.[citation needed]

Breeds [edit]

Holland Lop with black patches on white ("broken") R

There are many different breeds of domestic rabbit, with various sizes, temperaments, and care requirements. As with breeds of dogs, rabbit breeds were selectively bred by humans at different times to achieve certain desired characteristics (including coat color and texture, size, and body shape). Care requirements have been greatly altered; for example, some new breeds need grooming a few times a day without fail, whereas others, such as the Holland lop, have a tendency to develop dental problems. Temperaments can vary slightly with breed and gender, as with any animal. There are over 50 rabbit breeds recognized by the American Rabbit Breeders Association in the United States. There are many more breeds of rabbits worldwide.

Most genetic defects in the domestic rabbit are due to recessive genes. These genes are carefully tracked by fanciers of the breeds who show them; just as dog fanciers carefully check for hip/eye and heart problems, rabbit fanciers extensively follow their own lines to remove unwanted defects. However, unpure dwarf-size breeds, which are bred for pets by non-fancier breeders, are not carefully screened for health problems, and may still develop these defects.[citation needed]

See: Domestic Rabbit Breeds in Pet stores

Diet [edit]

The domestic rabbit's diet depends upon whether it is a pet, a meat or a fur rabbit. Meat and fur rabbits are fed diets which will improve meat or fur production and allow for the safe delivery of large litters of healthy kits while minimising costs and producing faeces which meet waste regulations where appropriate.[5]

Commercial pellets are available in most countries in a variety of formulations, and are typically fed to adult rabbits in limited quantities to prevent obesity. Most pellets are based on alfalfa as a protein and fiber source, with other grains being used to complete the carbohydrate requirements. Minerals and vitamins geared toward specific requirements of rabbits are added during production. Many commercial rabbit raisers also feed grass hay, although this can represent a hygiene issue in rabbitries.[6]

In contrast, a pet rabbit's diet may require fewer calories and energy, while taking advantage of many home-prepared ingredients.[7] Many rabbit welfare organisations and veterinarians recommended that a pet rabbit's diet should model off an approximation of a wild rabbit's natural diet as a foraging animal.[8][9] An often recommended feeding strategy for pet rabbits consists of grass hay, various combinations of leafy green vegetables, and limited commercial pellets. In this case, the focus is on providing adequate fiber. Testing trials to determine if this diet meets the animal's requirements for minerals and vitamins have not been done for hay/vegetable/pellet diets in the same way that pellet diets have been researched.[10]

A diet including too many pellets, root vegetables or sugary fruits can lead to diarrhea, obesity, poor wear on molar teeth and other health problems.[11] Studies have shown that although a short changeover period is needed, domestic rabbits are highly adaptable to diets produced from locally available forage products in developing countries.[12]

Coprophagy and rabbits [edit]

Rabbits are hindgut fermenters and therefore have an enlarged cecum. The cecum allows rabbits to digest, via fermentation what they otherwise would not be able to metabolically process. Because a rabbit has a sensitive and rather substantial gastrointestinal tract, a rabbit’s diet should consist of some amount of fiber. Without a proper diet, gastrointestinal stasis can occur and have detrimental effects on the animal itself.[13] It is in the cecum that this fiber is digested.

After a rabbit ingests food, the food travels down the esophagus and through a small valve called the cardia. In rabbits, this valve is very well pronounced and makes the rabbit incapable of vomiting. The food enters the stomach after passing through the cardia. Food then moves to the stomach and small intestine where a majority of nutrient extraction and absorption takes place. Food then passes into the colon and eventually into the cecum. Peristaltic muscle contractions (waves of motion) help to separate fibrous and non-fibrous particles. The non-fibrous particles are then moved backwards up the colon, through the illeo-cecal valve, and into the cecum. Symbiotic bacteria in the cecum help to further digest the non-fibrous particles into a more metabolically manageable substance. After as little as three hours, a soft, fecal pellet, called a cecotrope, is expelled from the rabbit’s anus. The rabbit instinctively eats these grape-like pellets, without chewing, in exchange keeping the mucous coating intact. This coating protects the vitamin- and nutrient-rich bacteria from stomach acid, until it reaches the small intestine, where the nutrients from the cecotrope can be absorbed.[14] [15]

The soft pellets contain a sufficiently large portion of nutrients that are critical to the rabbit’s health. This soft fecal matter is rich in vitamin B and other nutrients. The process of coprophagy is important to the stability of a rabbit’s digestive health because it is one important way that which a rabbit receives vitamin B in a form that is useful to its digestive wellness.[16] Occasionally, the rabbit may leave these pellets lying about its cage; this behavior is harmless and usually related to an ample food supply.

When caecal pellets are wet and runny (semi-liquid) and stick to the rabbit and surrounding objects they are called Intermittent Soft Cecotropes (ISCs). This is different from ordinary diarrhea and is usually caused by a diet too high in carbohydrates or too low in fiber. Soft fruit or salad items such as lettuce, cucumbers and tomatoes are possible causes. Increasing dietary fiber and decreasing carbohydrates should restore the gut flora to normal in the cecum and return gastrointestinal tract motility to normal. This can be avoided by providing a healthy diet of unlimited grass hay as the main part with fibrous green foods such as broccoli and cabbage and limited high fiber/low energy pellets. Note also that there are other more serious but uncommon causes such as cancer, intestinal obstructions and abscesses. [17] [18]

Breeding [edit]

Does are induced ovulators, and can therefore be bred at almost any time after reaching sexual maturity. Does of small breeds (Mini Rex, Polish) normally reach sexual maturity at 4 to 5 months, medium breeds (New Zealand, Rex) normally reach sexual maturity at 5 to 6 months, and large breeds (Flemish Giant, Checkered Giant) normally reach sexual maturity at 6 to 7 months. Males usually require more time to fully mature, and normally reach adult sperm counts between 6–7 months. Due to the territorial nature of female rabbits, it is standard practice for the doe to always be brought to the buck’s cage. When the doe is brought to the bucks’ cage, he quickly mounts her, performs pelvic thrusting culminating in orgasm, and “flops” off. The whole act may take less than 30 seconds, and is often repeated several times. When he is finished, the buck should then be removed, but many breeders will reintroduce the buck a few hours later to increase the size of the litter.[19][20]

Rabbits as pets [edit]

Standard Chinchilla Domestic Rabbit

Rabbits have been kept as pets in Western nations since the 19th century. Neutered (spayed or castrated) rabbits kept indoors with proper care may have a lifespan of 8 to 12 years.[21] Rabbits are especially popular as pets in the United States during the Easter season, due to their association with the holiday. However, animal shelters that accept rabbits often complain that during the weeks and months following Easter, there is a rise of unwanted and neglected rabbits that were bought as Easter "gifts", especially for children.[22]

Rabbits are relatively inexpensive to keep when compared to larger animals, such as dogs or horses, although their care can still be moderately costly.[23] Currently, regulations do not require vaccinations for rabbits in the USA. Rabbits in the United Kingdom require viral haemorrhagic disease and Myxomatosis vaccinations. Pet rabbits can be kept outdoors or indoors. Accommodations can range from an outdoor hutch to an indoor cage or pen to the free run of the home. Veterinarians with experience with rabbits can be difficult to locate. However, disease is rare when rabbits are raised in sanitary conditions and provided with adequate care. Regular brushing of the coat helps to increase sanitation and reduce ingestion of loose fur. Regular trimming of the nails is required if pet rabbits live indoors where they can not dig.

Safety and Health Considerations [edit]

Improper holding or handling of pet rabbits can lead to strong kicks by the frightened rabbit which can injure both the animal and the handler.[24] Rabbits will gnaw on anything that is available to them, including electrical cords, cables, and paper products. Electrical components, when chewed by pet rabbits, can cause electrocution and burns.[25] Rabbits have been identified with few zoonotic diseases and are considered a "low risk" to people with competent immune systems. However, a risk of transmission of E. coli, salmonella, and E. cuniculi exists, particularly for people with compromised immune systems.

Commercial rabbits [edit]

Meat rabbits [edit]

Commercially processed lean rabbit meat
Meat-type rabbits being raised as a supplementary food source during the Great Depression

Breeds such as the New Zealand and Californian are frequently utilized for meat in commercial rabbitries. These breeds have efficient metabolisms and grow quickly; they are ready for slaughter by approximately 14 to 16 weeks of age.

Rabbit fryers are rabbits that are between 70 to 90 days of age, and weighing between 3 to 5 lb (1 to 2 kg) live weight. Rabbit roasters are rabbits from 90 days to 6 months of age weighing between 5 to 8 lb (2 to 3.5 kg) live weight. Rabbit stewers are rabbits from 6 months on weighing over 8 lb.

Any type of rabbit can be slaughtered for meat, but those exhibiting the "commercial" body type are most commonly raised for meat purposes. Dark fryers (any other color but albino whites) are sometimes lower in price than albino fryers because of the slightly darker tinge of the fryer (purely pink carcasses are preferred by consumers) and because the hide is harder to remove manually than the white albino fryers.

Wool rabbits [edit]

Rabbits such as the Angora, American Fuzzy Lop, and Jersey Wooly produce wool. However, since the American Fuzzy Lop and Jersey Wooly are both dwarf breeds, only the much larger Angora breeds such as the English Angora, Satin Angora, Giant Angora, and French Angoras are used for commercial wool production. Their long fur is sheared, combed, or plucked (gently pulling loose hairs from the body during molting) and then spun into yarn used to make a variety of products. Angora sweaters can be purchased in many clothing stores and is generally mixed with other types of wool. Rabbit wool, called Angora, is 5 times warmer than sheep's wool.[citation needed]

Fur rabbits [edit]

Dried rabbit pelts

All rabbits produce fur. Rabbits such as the Palomino, Satin, Chinchilla rabbit and Rex rabbit are commonly raised for fur. Each breed has unique coloring and fur characteristics. The rabbit is fed a diet especially balanced for fur production and the pelts are harvested when they have reached prime condition. Rabbit fur is widely used throughout the world. China imports much of its fur from Scandinavia (80%) and North America (5%) according to the USDA Foreign Agricultural Service GAIN Report CH7607.

Laboratory rabbits [edit]

Rabbits have been and continue to be used in laboratory work such as production of antibodies for vaccines and research of human male reproductive system toxicology. In 1972, around 450 000 rabbits were used for experiments in the United States, decreasing to around 240 000 in 2006.[26] The Environmental Health Perspective, published by the National Institute of Health, states, "The rabbit [is] an extremely valuable model for studying the effects of chemicals or other stimuli on the male reproductive system."[27] According to the Humane Society of the United States, rabbits are also used extensively in the study of bronchial asthma, stroke prevention treatments, cystic fibrosis, diabetes, and cancer.

The New Zealand White is one of the most commonly used breeds for research and testing.

Animal rights activists generally oppose animal experimentation for all purposes, and rabbits are no exception.[improper synthesis?] The use of rabbits for the Draize test,[28] which is used for, amongst other things, testing cosmetics on animals, has been cited as an example of cruelty in animal research. Albino rabbits are typically used in the Draize tests because they have less tear flow than other animals, and the lack of eye pigment makes the effects easier to visualize.[29]

Outdoor housing [edit]

Rabbits being raised on pasture at Polyface Farm

Rabbits can live outside in properly constructed housing or hutches. Hutches provide protection from the elements in winter and keep rabbits cool in summer heat. To protect from predators rabbit hutches are usually situated in a fenced yard, shed, barn, or other enclosed structure. Whether housed indoors or out, all rabbits can be provided shelves, ramps or tunnels, toys or other enrichment items. Rabbit waste can be measured in cubic yards per year. This waste is excellent for gardening and composting, and can be collected for these uses whether the rabbit is housed indoors or outdoors. An outdoor cage should be as large as possible, at least high enough for the rabbit to stand on its back legs without its head touching the ceiling. It should be large enough to enable the rabbit to take 4 or 5 hops along its length and width. The shelter may be heated in winter (although most rabbits can be kept outside with extra bedding even into temperatures well below freezing) and should be shaded or otherwise appropriately cooled in summer. Clean water must be available at all times, especially in hot weather to keep temperatures below 85 degrees. Large rabbits (such as the New Zealand breed) do fine in temperatures as low as -10 degrees Celsius/15 degrees Fahrenheit in a hutch with plenty of straw, if their needs for food and water are well met. Water cups or bottles that become frozen in cold weather must be changed two or three times daily. Below -10 degrees Celsius/15 degrees Fahrenheit it is necessary to shelter all animals in a barn or basement or garage. Covering cages three quarters of the way with a blanket, several cages grouped together, can generate a great deal of heat. One rule of thumb is at least eight pounds of animal per cage. Even newborn rabbits do well in cold if they have sufficient nest and many siblings to snuggle with. They should stay with the mother for longer periods of time in the winter for warmth. Domesticated rabbits are most comfortable in temperatures between 10 to 21 degrees C (50 to 70 degrees F), and cannot endure temperatures above 32 degrees C (90 degrees F) well without assistance such as deep shade, cold stones, frozen water bottles or fans.

Rabbits require clean environments and all housing should be cleaned regularly to ensure that no build-up of feces or urine occurs. Rabbit droppings are often left in beds with red worms to create compost, added to compost bins for enrichment of the compost, or applied directly to a garden as a "cool" fertilizer that will not burn plants.

Rabbits can be litter trained, which makes it much easier to clean up after them. Dust free litter that will not cause health problems if ingested is used for rabbits.

Exhibition [edit]

Checkered Giant at an exhibition

Conformation shows [edit]

Show rabbits are an increasingly popular activity. Showing rabbits helps to improve the vigor and physical behavior of each breed through competitive selection. County fairs are common venues through which rabbits are shown in the United States. Rabbit clubs at local state and national levels hold many shows each year. On any given weekend one may be able to find a show in most regions of the United States and the United Kingdom. Although only purebred animals are shown, a pedigree is not required to enter a rabbit in an ARBA-sanctioned show but is required to register your rabbit with the American Rabbit Breeders Association (ARBA). A rabbit must be registered in order to receive a Grand Champion certificate.[30] Children's clubs such as 4-H also include rabbit shows, usually in conjunction with county fairs. The ARBA holds an annual national convention which has as many as 25,000 animals competing form all over the world. The mega show moves to a different city each year. The ARBA also sponsors youth programs for families as well as underprivileged rural and inner city children to learn responsible care and breeding of domestic rabbits.

Show jumping [edit]

Rabbit show jumping, a form of athletic competition between rabbits, began in the 1970s and has since become popular in Europe, particularly Sweden and the United Kingdom. Any rabbit regardless of breed may participate in this kind of competition, as it is based on athletic skill.

Genetics [edit]

Reference: Rabbit Coat Color Genetics: Gene List

There are 10 color gene groups (or loci) in rabbits. They are A, B, C, D, E, En, Du, Si, V, and W. Each locus has dominant and recessive genes. In addition to the loci there are also modifiers, which modify a certain gene. These include the rufus modifiers, color intensifiers, and plus/minus (blanket/spot) modifiers. A rabbit's coat only has two pigments, pheomelanin (yellow) and eumelanin (dark brown). There can also be no pigment, causing an albino or white rabbit.

Color Genes

Within each group, the genes are listed in order of dominance, with the most dominant gene first. In parenthesis after the description is at least one example of a color that displays this gene.

Note: lower case are recessive and capital letters are dominant
Chinchilla
  • "A" represents the agouti locus (multiple bands of color on the hair shaft). The genes are:
    • A= agouti ("wild color" or chestnut agouti, opal, chinchilla, etc.)
    • a(t)= tan pattern (otter, tan, silver marten)
    • a= self or non-agouti (black, chocolate)
  • "B" represents the brown locus. The genes are:
    • B= black (chestnut agouti, black otter, black)
    • b= brown (chocolate agouti, chocolate otter, chocolate)
Blue
  • "C" represents the color locus. The genes are:
    • C= full color (black)
    • c(ch3)= dark chinchilla, removes yellow pigmentation (chinchilla, silver marten)
    • c(ch2)= medium (light) chinchilla, Slight reduction in eumelanin creating a more sepia tone in the fur rather than black.
    • c(ch1)= light (pale) chinchilla (sable, sable point, smoke pearl, seal)
    • c(h)= Himalayan, body white with extremities ("points") colored in black, blue, chocolate or lilac, pink eyes
    • c= albino (ruby-eyed white or REW)
  • "D" represents the dilution locus. This gene dilutes black to blue and chocolate to lilac.
    • D= dense color (chestnut agouti, black, chocolate)
    • d= diluted color (opal, blue or lilac)
  • "E" represents the extension locus. It works with the 'A' and 'C' loci, and rufus modifiers. When it is recessive, it removes most black pigment. The genes are:
    • E(d)= dominant black
    • E(s)= steel (black removed from tips of fur, which then appear golden or silver)
    • E= normal
    • e(j)= Japanese brindling (harlequin), black and yellow pigment broken into patches over the body. In a broken color pattern this results in Tricolor.
    • e= most black pigment removed (agouti becomes red or orange, self becomes tortoise)
Dutch
  • "En" represents the plus/minus (blanket/spot) color locus. It is incompletely dominant and results in three possible color patterns:
    • EnEn= "Charlie" or a lightly marked broken with color on ears, on nose and sparsely on body
    • Enen= Broken rabbit with roughly even distribution of color and white
    • enen= Solid color with no white areas
  • "Du" represents the Dutch color pattern, (the front of the face, front part of the body, and rear paws are white, the rest of the rabbit has colored fur). The genes are:
    • Du= absence of Dutch pattern
    • du(d)= Dutch (dark)
    • du(w)= Dutch (white)
Czech Red
  • "V" represents the vienna white locus. The genes are:
    • V= normal color
    • Vv= Vienna carrier, carries blue-eyed white gene. May appear as a solid color, with snips of white on nose and/or front paws, or Dutch marked.
    • v= vienna white (blue-eyed white or BEW)
  • "Si" represents the silver locus. The genes are:
    • Si= normal color
    • si= silver color (silver, silver fox)
  • "W" represents the middle yellow-white band locus and works with the agouti gene. The genes are:
    • W= normal width of yellow band
    • w= doubles yellow band width (Otter becomes Tan, intensified red factors in Thrianta and Belgian Hare)
  • "P" represents the OCA type II form of albinism, P is because it is an integral P protein mutation. The genes are:
    • P= normal color
    • p= albinism mutation, removes eumelanin and causes pink eyes. (Will change, for example, a Chestnut Agouti into a Shadow)

Health problems [edit]

Fly strike [edit]

Fly strike is a rare condition which mostly affects rabbits kept in extremely unsanitary conditions and is more likely to occur during summer months. Fly strike happens when flies (particularly the Botfly) lay their eggs in the damp or soiled fur or in an open wound of a rabbit. Within 12 hours, the eggs hatch into the larvae stage of the fly, known as maggots. The maggots, initially small and almost invisible to the naked eye, can burrow into the skin of the rabbit and feed on the animal's tissue. Within 3–4 days, the larvae can be large as 15 mm long. In rare cases, if not treated, the rabbit can pass into shock and die. The most susceptible animals are those living in unsanitary housing, older rabbits who do not move much, and those who are unable to clean their bottom areas carefully. Rabbits raised on solid floors are more susceptible than rabbits raised on wire floors. Rabbits exhibiting one or more episodes of diarrhea are often inspected, especially during the summer months.[31] In 2002, the medicine Rearguard was approved in the United Kingdom for a 10-week per-application prevention of Fly strike.

Myxomatosis and West Nile Virus [edit]

Myxomatosis is a threat to the health of pet rabbits. Rabbits caged outdoors in Australia are vulnerable in areas with high numbers of mosquitoes. In Europe, fleas are the carriers of myxomatosis. In some countries, annual vaccinations against myxomatosis are available. In Australia pet rabbits cannot be vaccinated against myxomatosis which was introduced to the wild rabbit population as a means of population control. The Australian Government will not allow veterinarians to purchase and use the vaccine that would protect pet rabbits.[32] The keeping of pet rabbits is banned in the Australian state of Queensland.[33]

West Nile Virus is another threat to rabbits.[34] This is a fatal disease, and while there are vaccines available, they are not specifically indicated for rabbits. Recourse against the disease includes limiting the number of mosquitoes that are around pet rabbits.

Sore hocks [edit]

The formation of open sores on the rabbit's hocks, commonly called "sore hocks," is a problem that commonly afflicts mostly heavy-weight rabbits kept in cages with wire flooring or soiled solid flooring. The problem is most prevalent in rex-furred rabbits and heavy-weight rabbits (9+ pounds in weight), as well as those with thin foot bristles.

The condition results when, over the course of time, the protective bristle-like fur on the rabbit's hocks thins down. Standing urine or other unsanitary cage conditions can exacerbate the problem by irritating the sensitive skin. The exposed skin in turn can result in tender areas or, in severe cases, open sores, which may then become infected and abscessed if not properly cared for.

Most rabbits can live safely on wire floors with the provision of a resting board or mat. Ultra heavy-weight breeds such as Flemish Giants or Checkered Giants are best raised on solid or partially solid flooring. Alternatively, plastic-floored cages can be used in place of wire floors to provide more comfortable flooring.

Respiratory infections [edit]

An over-diagnosed ailment amongst rabbits is respiratory infection. Pasteurella bacteria, known colloquially as "snuffles," is usually misdiagnosed and has been known to be a factor in the overuse of antibiotics among rabbits.[35]

A runny nose, for instance, can have several causes, among those being high temperature or humidity, extreme stress, environmental pollution (like perfume or incense), or a sinus infection. Options for treating this is removing the pollutant, lowering or raising the temperature accordingly, and medical treatment for sinus infections.[35]

"Runny eyes" can be caused by dental disease or a blockage of the tear duct. Environmental pollution, corneal disease, entropion, distichiasis, or inflammation of the eyes are also causes. This is easy to diagnose as well as treat.[35]

Sneezing can be a sign of environmental pollution (such as too much dust) or food allergy.

While Pasteurella is a bacterium that lives in a rabbit's respiratory tract, it can flourish out of control in some cases. In the rare event that happens, antibiotic treatment is necessary.

Head tilt/wry neck/Encephalitozoon cuniculi (E. cuniculi) [edit]

Inner ear infections, certain protozoans, strokes, or other diseases or injuries affecting the brain or inner ear can lead to a condition known as wry neck or "head tilt." Although a heavy infestation of ear mites, an ear infection or injury can result in these symptoms, the most common cause of these symptoms is the protozoan parasite E. cuniculi. This condition can be fatal, due to a disorientation that causes the animal to stop eating and drinking. The drugs of choice for treatment and prevention of E. cuniculi infections are the benzimidazole anthelmintics, particularly fenbendazole. In the UK, Panacur Rabbit (containing fenbendazole) is marketed and recommended as a nine day course to help contain this condition and is a simple oral paste to medicate at home. It is sold over the counter. Users in the US or other countries will need to consult with their veterinarians about use and dosage of fenbendazole.

Teeth problems [edit]

Malocclusion

Dental disease has several causes, namely genetics, inappropriate diet, injury to the jaw, infection, or cancer.

  • Malocclusion: Rabbit teeth are open-rooted and continue to grow throughout their lives. In some rabbits, the teeth are not properly aligned, a condition called malocclusion. Because of the misaligned nature of the rabbit's teeth, there is no normal wear to control the length to which the teeth grow. There are three main causes of malocclusion, most commonly genetic predisposition, injury, or bacterial infection. In the case of congenital malocclusion, treatment usually involves veterinary visits in which the teeth are treated with a dental burr (a procedure called crown reduction or, more commonly, teeth clipping) or, in some cases, permanently removed. In cases of simple malocclusion, a block of wood for the rabbit to chew on can rectify this problem[citation needed].
  • Molar spurs: These are spurs that can dig into the rabbit's tongue and/or cheek causing pain. These can be filed down by an experienced veterinarian with a dental burr.

Signs of dental difficulty include difficulty eating, weight loss and small stools, anorexia, and visibly overgrown teeth. However, there are many other causes of ptyalism, including pain due to other causes.[36] A visit to an experienced rabbit veterinarian is strongly recommended[by whom?] in the case of a wet chin, or excessive grooming of the mouth area.

Gastrointestinal stasis [edit]

Gastrointestinal stasis is a serious and potentially fatal condition that occurs in some rabbits in which gut motility is severely reduced and possibly completely stopped. When untreated or improperly treated, GI stasis can be fatal in as little as 24 hours.

GI stasis is the condition of food not moving through the gut as quickly as normal. The gut contents may dehydrate and compact into a hard, immobile mass (impacted gut), blocking the digestive tract of the rabbit. Food in an immobile gut may also ferment, causing significant gas buildup and resultant gas pain for the rabbit.

The first noticeable symptom of GI stasis may be that the rabbit suddenly stops eating. Treatment frequently includes intravenous or subcutaneous fluid therapy (rehydration through injection of a balanced electrolyte solution), pain control, possible careful massage to promote gas expulsion and comfort, drugs to promote gut motility, and careful monitoring of all inputs and outputs. The rabbit's diet may also be changed as part of treatment, to include force-feeding to ensure adequate nutrition. Surgery to remove the blockage is not generally recommended and comes with a poor prognosis.[37]

Some rabbits are more prone to GI stasis than others. The causes of GI stasis are not completely understood, but common contributing factors are thought to include stress, reduced food intake, low fiber in the diet, dehydration and reduction in exercise. Stress factors can include changes in housing, transportation, or medical procedures under anesthesia. As many of these factors may occur together (poor dental structure leading to decreased food intake, followed by a stressful veterinary dental procedure to correct the dental problem) establishing a root cause may be difficult.[38]

GI stasis is sometimes misdiagnosed as "hair balls" by veterinarians or rabbit keepers not familiar with the condition.[39][40] While fur is commonly found in the stomach following a fatal case of gi stasis, it is also found in healthy rabbits. Molting and chewing fur can be a predisposing factor in the occurrence of gi stasis, however, the primary cause is the change in motility of the gut.

Veterinary care [edit]

Rabbits visit the vet for routine check ups, vaccination and when ill or injured. Some veterinary surgeons have a special interest in rabbits and some have extra qualifications. In the UK the following post graduate qualifications demonstrate specialist training in rabbits: Certificate in Zoological Medicine, Diploma in Zoological Medicine and Recognised specialist in Rabbit Medicine and Surgery.[41]

Routine checkups [edit]

Routine check ups usually involve assessment of weight, skin, health and teeth by the owner or a veterinarian. This is essential because a rabbit's health and welfare can be compromised by being overweight or underweight or by having dental problems. Checking the teeth is particularly important part of the examination as back teeth can only be seen with an otoscope. Veterinarians can also give personalised advice on diet and exercise.

Vaccinations [edit]

Rabbits should be vaccinated against Myxomatosis and Viral Haemorrhagic Disease in the UK.[42] These vaccinations are usually given annually, two weeks apart. If there is an outbreak of Myxomatosis locally this vaccine can be administered every six months for extra protection.[43] However, Myxomatosis immunisations are not available in all countries, including Australia, because of the risk that immunity will pass onto wild rabbits, which is what the disease was created for (the extermination of wild rabbits).

Worming [edit]

Some vets now recommend de-worming all rabbits against the parasite Encephalitozoon cuniculi. Some studies have indicated that in the UK over 50% of rabbits may be infected with this parasite. Fenbendazole is used as a deworming agent in other species of animal and has shown to be effective in treating rabbits. In the UK it is now sold in paste form as a treatment for rabbits under the brand name Panacur. It is particularly recommended for rabbits kept in colonies and before mixing new rabbits with each other.[44]

Ill or Injured [edit]

Some of the conditions that can occur in domestic rabbits include the following: dramatic or sudden loss of appetite, severe depression,[45] breathing problems,[46] sudden onset of head tilt, signs of maggot infestation,[47] not passing stools. Rabbits can also be exposed to poisons, involved in an accident, fall from a height or be exposed to smoke. Other rabbits conditions which indicate a need for medical treatment are drooling, unexplained weight loss, diarrhoea or fur loss. There are many other symptoms for which a rabbit requires medical aid or veterinary attention.

See also [edit]

References [edit]

  1. ^ Online Etymology Dictionary
  2. ^ Anthon, Charles. A System of Ancient and Mediæval Geography for the Use of Schools and Colleges pg.14
  3. ^ http://www.albc-usa.org/cpl/belgianhare.html
  4. ^ Hare Surveyhttp://www.belgianhareclub.com/hare_survey.html
  5. ^ http://ojs.upv.es/index.php/wrs/article/view/382/369 | Towards reduced feeding costs, dietary safety and minimal mineral excretion in rabbits: a review, L Maertens - World Rabbit Science, 2010
  6. ^ Templeton, George (1968). Domestic Rabbit Production. Danville, Illinois: The Interstate Printers & Publishers, Inc. p. 58. 
  7. ^ Brooks, Dale (1997). Ferrets, rabbits and rodents: Nutrition and Gastrointestional Physiology. Philadelphia: W.B. Saunders Company. p. 172. ISBN 0-7216-4023 Check |isbn= value (help). 
  8. ^ http://www.rabbitwelfare.co.uk/resources/index.php?section=leaflets.html#diet
  9. ^ http://www.thebrc.org/diet.htm
  10. ^ Brooks, Dale (1997). Ferrets, rabbits and rodents: Nutrition and Gastrointestional Physiology. Philadelphia: W.B. Saunders Company. pp. 173–174. ISBN 0-7216-4023 Check |isbn= value (help). 
  11. ^ http://www.bio.miami.edu/hare/diet.html
  12. ^ J.A. Lowe (2006). "Pet Rabbit Feeding and Nutrition". The Nutrition of the Rabbit: 309–323. 
  13. ^ Krempels, Ph.D., Dana M. "GastroIntestinal Stasis: The Silent Killer." University of Miami Department of Biology. Web. 19 April 2011. <http://www.bio.miami.edu/hare/ileus.html>.
  14. ^ The American Rabbit Breeders Ass'n., Inc. Official Guidebook: to Raising Better Rabbits and Cavies. Bloomington, IL: American Rabbit Breeders Association, 1991. Print.
  15. ^ Rees Davies, R. and J. A. E. Rees Davies (2003) "Rabbit Gastro-Intestinal Physiology," Vet Clin Exot Anim, 139-153 http://www.medirabbit.com/EN/GI_diseases/Rees-Davies.pdf
  16. ^ "Purina Mills Rabbit - NUTRITION & MANAGEMENT." Purina Mills Rabbit - Home. Web. 19 April 2011. <http://www.rabbitchow.com/NUTRITIONMANAGEMENT/default.aspx>.
  17. ^ Intermittent Soft Cecotropes in Rabbits, Susan Brown, DVM, ,VeterinaryPartner.com http://www.veterinarypartner.com/Content.plx?P=A&A=3012&S=1&SourceID=43
  18. ^ 10.6.4 Consistency of caecotrophs in Harcourt-Brown F. Textbook of rabbit medicine. Oxford: Butterworth-Heinemann; 2002. pp. 274-277
  19. ^ [Harkness, John E., and Joseph E. Wagner. The Biology and Medicine of Rabbits and Rodents. 2nd ed. Philadelphia: Lea & Febiger, 1983. Print.],
  20. ^ [Hume, C. W. The UFAW Handbook on the Care and Management of Laboratory Animals;. Edinburgh: Churchill Livingstone, 1972. Print.],
  21. ^ "What's the lifespan of a rabbit?". House Rabbit Society. Retrieved 2007-10-11. 
  22. ^ ABC7 Chicago (TV station) article "Easter Rabbits"
  23. ^ "Choosing a Rabbit as a Pet". Peteducation.com. Retrieved 2010-12-11. 
  24. ^ "Children and Rabbits". The House Rabbit Society. Retrieved 2010-12-11. 
  25. ^ "Dealing with Medical Emergencies". The House Rabbit Society. Retrieved 2010-12-11. 
  26. ^ Kulpa-Eddy. "A review of trends in animal use in the United States (1972–2006)". AATEX (Proc. 6th World Congress on Alternatives & Animal Use in the Life Sciences) (14, Special Issue): 163–165. 
  27. ^ Morton, Daniel (April 1988). "The use of rabbits in male reproductive toxicology". Environmental Health Perspectives (National Institute of Health) 77: 5–9. doi:10.2307/3430622. JSTOR 3430622. PMC 1474531. PMID 3383822. 
  28. ^ M.K. Prinsen (2006). "The Draize Eye Test and in vitro alternatives; a left-handed marriage?". Toxicology in Vitro 20 (1): Pages 78–81. doi:10.1016/j.tiv.2005.06.030. PMID 16055303. 
  29. ^ Dawn, Karen (2008). Thanking the Monkey: Rethinking the Way we Treat Animals (1st ed ed.). New York City: HarperCollins. pp. 239–40. ISBN 978-0-06-135185-3. Retrieved 12 March 2013. 
  30. ^ Official Show Rules. American Rabbit Breeders Association. 2009 
  31. ^ House Rabbit Society: Fly strike
  32. ^ "FeraFeast - Rabbits - Myxomatosis and Calicivirus". Retrieved 17 February 2012. 
  33. ^ "Rabbits". Department of Primary Industries. Retrieved 29 January 2012. 
  34. ^ http://www.cdc.gov/ncidod/dvbid/westnile/qa/transmission.htm
  35. ^ a b c Respiratory Disease by Dr. Susan A. Brown DVM
  36. ^ MediRabbit: Differential Diagnosis for Ptyalism
  37. ^ Harkness, John E. (2010). Biology and Medicine of Rabbits and Rodents (5th ed.). Ames, Iowa: Wiley-Blackwell. pp. 306–308. ISBN 978-0-8138-1531-2. 
  38. ^ Jenkins, Jeffery (1997). Ferrets, Rabbits and Rodents: Gastointestinal Diseases. Philadelphia: W.B. Saunders Company. pp. 178–179. ISBN 0-7216-4023-0. 
  39. ^ House Rabbit Society: Sluggish Motility in the Gastrointestinal Tract
  40. ^ University of Miami Department of Biology: Gastrointestinal Stasis, The Silent Killer
  41. ^ The Royal College of Veterinary Surgeons http://www.rcvs.org.uk/Templates/Internal.asp?NodeID=94964
  42. ^ British Veterinary Association Rabbit Care Downloads http://www.link2content.co.uk/uploads/bva/rabbit.pdf
  43. ^ http://www.intervet.co.uk/binaries/92_114377.pdf Intervet vaccination literature.
  44. ^ http://www.houserabbit.co.uk/resources/content/info-sheets/ecuniculi.htm RWAF Encephalitozoon Cuniculi
  45. ^ Harcourt-Brown F (2002). "Anorexia in rabbits 2". In Pract 24 (8): 450–67. doi:10.1136/inpract.24.8.450. 
  46. ^ Paul-Murphy J (2007). "Critical care of the rabbit". Vet Clin North Am Exot Anim Pract. 10 (2): 437–61. doi:10.1016/j.cvex.2007.03.002. PMID 17577559. 
  47. ^ Cousquer G , 28: (2006). "Veterinary care of rabbits with myiasis". In Pract. 1028 (6): 342–349. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

American rabbit

The American rabbit is a variety of rabbit, recognised by the American Rabbit Breeders Association (ARBA) as the German Blue Vienna in 1918. It was renamed to American Blue Rabbit shortly after because of World War I. American rabbits have an ideal mandolin body and a deep blue colour.

The American rabbit was introduced by Lewis H. Salisbury, who did not disclose what breeds were used to come to this variety. The body shape suggests that it may well have been bred from blue Vienna, Beveren, Imperial and Flemish Giants.

A white variety named American white rabbit was recognised in 1925. It was developed by selecting rabbits with white spots, and adding in white flemish giants in the bloodline.

American rabbits were popular animals up until the 1950s, kept for their fur and meat. They are now the rarest variety of rabbit in America. American rabbits weigh between 4 and 5½ kilograms (9–12 lb).

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!