Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (9) (learn more)

Overview

Distribution

Range Description

The geographic range (in Arabia) includes isolated populations scattered across the entire peninsula and extends east into India. It is also found on the islands of Sardinia and Cypress. Geographic range in Africa is extensive and separated into two distinct regions of non-forested areas (Boitani et al. 1999). The southern extent of occurrence includes the following countries: South Africa, Lesotho, Swaziland, Namibia, Botswana, Zimbabwe, southern portions of Angola, Mozambique, and Zambia (Boitani et al. 1999). The northern extent of occurrence includes: Tanzania, Kenya, Uganda, Eritrea, Sudan, Egypt, Libya, Chad, Niger, Tunisia, Algeria, Burkina Faso, Mali, Morocco, Western Sahara, Mauritania, and Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread (Sinai, North coast, oases of Western desert and Eastern Desert).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Lepus capensis is native to non-forested areas of Africa, including one population in the south and a distinct one in the Sahel and Sahara. It is also widespread through parts of the Middle East and Central Asia (  http://www.geobop.com,   http://www.borealforest.org; Wilson and Reeder, 1993)

Biogeographic Regions: palearctic (Introduced ); oriental (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Brown Hares have a slender body with a bushy tail. The oval-shaped head has very long (12 to 14 cm), black-tipped ears and large, reddish-brown eyes. This species also has very long and powerful hind legs. Lepus capensis has ginger-brown fur with shades of black on the upper parts, a more ginger-colored breast and sides, with white inner sides of the legs and belly, and reddish-gray hair on the nape of the neck. (  http://www.borealforest.org, Grzimek 1990,   http://www.harrogate.co.uk/biltonhistory)

Range mass: 4 to 5 kg.

Range length: 520 to 595 mm.

  • Grzimek, 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
  • Heptinstall, Nigel, 1996. "Bilton Historical Society" (On-line). Accessed November 11, 2001 at www.harrogate.co.uk/biltonhistory.
  • Peltonen, Aki, 2000. "borealforest.org" (On-line). Accessed November 11, 2001 at www.borealforest.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The following information applies to L. capensis on the Arabian Peninsula. This species breeds all year round, with one or two offspring in each litter. L. capensis prefers shrubs, rather than grasses, to shelter under in summer. However, whether this is a limiting factor or not is not known. L. capensis has experienced habitat loss since the 1950's resulting from urbanization, overgrazing, agricultural encroachment and infrastructure related to tourism (Drew et al. 2004). It has been noted that pastureland that has been overgrazed by domestic livestock is favored (Flux and Angermann 1990).

In Africa, it is commonly associated with open habitats (Boitani et al. 1999). Reproduction varies according to location (Happold pers. comm.). Equatorial expanses have a year-round breeding season, with up to eight litters per year and 1.3-2.0 young per litter (Flux 1981). In Kenya, L. capensis produces six to eight litters per year with a mean litter size of 1.5 (Happold pers. comm.). Hares at higher altitudes will have smaller litters than those at lower altitudes (Happold pers. comm.). Home range for this species varies, depending on the type of habitat in which it is found (Flux and Angermann 1990 ). There is little information available on the diet of L. capensis, but is presumed to vary according to habitat as well (Flux and Angermann 1990).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is found in open land, such as meadows, pastures, cultivated fields, sandy moors, and marshes, close to hedges, thickets, and forests. Lepus capensis inhabits bioclimatic regions that are temperate and humid, hot and dry, and can be found in barren and extreme arid deserts. (  http://www.borealforest.org, Kronfeld and Shkolnik 1996)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune

Wetlands: marsh

Other Habitat Features: agricultural

  • Kronfeld, N., A. Shkolnik. 1996. Adaptation to Life in the Desert in the Brown Hare (*Lepus capensis*). Journal of Mammalogy, 77/1: 171-178.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brown hares are primarily herbivorous. Their diet includes herbaceous plants, cereals, berries, vegetables, and some fungi, such as mushrooms. This species of hare also eats some of its fecal droppings laid during the night, and digests them a second time to obtain essential nutrients (proteins and vitamins) from material as it passes through the alimentary canal a second time.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; flowers; lichens

Other Foods: fungus; dung

Primary Diet: herbivore (Folivore , Granivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Hares provide about 5 percent of total food intake for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Hares are in danger from the first day of their existence from a number of predators, including raptors and foxes and other mammalian carnivores. Their greatly elongated hindlimbs have allowed them to adopt a bounding gait and occupy areas with limited shelter. So, instead of taking cover when danger approaches, they depend on their running ability for escape. About 20 to 40 percent of annual hare offspring are eliminated by predators or natural causes. Loss among hares is to a much greater extent due to diseases and parasites than predators. Deaths are also connected with weather, nutritional deficiencies, agricultural activities, and road traffic.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Lepus capensis is prey of:
Strigiformes
Falconiformes
Vulpes chama

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The communication patterns of these animals have not been reported in detail. However, it is likely that as with all diurnal mammals, there are some forms of visual communication, such as is seen in the ritual interactons between males during mating season. Tactile communication is probably important between mates, as well as between mothers and their offspring. Chemical cues may help to identify reproductive condition, and may play some role in mating. Hares have acute hearing, but the role of this in communication within the species is not known.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Specific information on the longevity of this species is not available. However, hares rarely live more than a year in the wild. Only a few individuals obtain 5 years, and the highest recorded age of 12.5 years is an exception.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Knowledge regarding the longevity of these animals is limited. One wild born specimen was still alive in captivity at about 8.9 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of these animals has not been reported.

Mating among L. capensis occurs from January to June, with the young being born from March to October. Gestation lasts 42 days, and the doe raises 2 to 4 litters of 1 to 6 leverets per year. During the mating season, mating activities are very lively in the late morning or early afternoon. (  http://www.borealforest.org, Grzimek 1990)

Breeding interval: Breeding may occur at intervals of approximately three months.

Breeding season: Breeding occurs from January to June, with young produced from March to October..

Range number of offspring: 1 to 6.

Range gestation period: 38 to 41 days.

Average gestation period: 40 days.

Range weaning age: 14 to 28 days.

Average weaning age: 28 days.

Range age at sexual or reproductive maturity (female): 7 to 9 months.

Range age at sexual or reproductive maturity (male): 7 to 9 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 118.4 g.

Average number of offspring: 2.6.

Lepus capensis newborn weigh an average of 4.5 oz and develop rapidly in the nest. The young are suckled for three weeks, at which time they are already eating plant food. Young are idependent and completely weaned by one month. At this time they reach a weight of about 2 lb. Brown hares reache adulthood at 7 to 9 months. (  http://www.borealforest.org, Grzimek 1990)

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Grzimek, 1990. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill.
  • Peltonen, Aki, 2000. "borealforest.org" (On-line). Accessed November 11, 2001 at www.borealforest.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepus capensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAATCGTTGATTATTTTCTACCAACCACAAAGATATTGGAACTCTCTACCTTTTATTTGGAGCCTGAGCTGGAATGGTAGGAACAGCCCTCAGTCTGTTGATCCGAGCAGAATTGGGCCAACCCGGGACTTTACTTGGAGATGATCAAATCTATAATGTTATTGTCACCGCACATGCCTTTGTAATAATTTTCTTCATAGTTATACCTATCATGATTGGAGGCTTCGGGAACTGACTGGTCCCCCTAATAATTGGAGCCCCTGATATAGCTTTCCCCCGAATAAACAATATAAGCTTTTGACTCCTCCCACCATCTTTCCTTCTTTTATTAGCCTCATCAATAGTAGAAGCTGGCGCAGGGACTGGTTGGACTGTCTACCCACCACTAGCTGGCAACTTAGCTCATGCAGGGGCCTCAGTTGACCTTACTATCTTTTCCCTACACTTAGCTGGAGTTTCATCTATTTTAGGGGCTATTAATTTTATTACTACTATCATTAACATAAAACCTCCCGCTATATCTCAGTACCAAACACCCCTATTTGTATGATCCGTCCTCATCACAGCTGTGCTCCTGCTTCTCTCTTTACCAGTTTTAGCTGCCGGCATTACAATACTTTTAACAGACCGAAACTTAAATACAACCTTTTTTGACCCAGCAGGTGGTGGAGACCCCATTCTCTACCAACACTTATTCTGATTCTTCGGTCACCCTGAAGTATATATTCTTATTTTACCAGGGTTCGGAATAATTTCTCACATTGTAACCTACTATTCTGGGAAAAAAGAACCATTTGGATATATAGGAATAGTGTGAGCTATGATATCAATTGGCTTCCTTGGATTTATTGTTTGAGCCCACCATATATTCACGGTAGGTATAGACGTGGACACACGAGCTTATTTTACTTCAGCCACCATAATTATTGCTATTCCTACAGGGGTAAAAGTATTTAGTTGACTAGCAACTCTACACGGCGGTAATATTAAATGAGCTCCAGCAATACTTTGAGCCTTAGGCTTTATTTTCTTATTTACAGTAGGCGGTCTTACAGGAATTGTACTAGCTAATTCTTCTCTAGACATCGTTCTACATGATACATACTATGTAGTAGCTCACTTCCACTACGTATTATCCATAGGAGCTGTATTTGCTATTATAGGAGGGTTTGCTCATTGATTCCCTTTATTCTCAGGTTACACCCTAGATCAGACCTGAGCAAAAATCCACTTCACCGTAATATTTGTAGGAGTTAACTTAACCTTCTTCCCACAACATTTCCTTGGGCTTTCCGGCATGCCACGACGATATTCAGACTATCCAGACGCCTACACAATATGAAACACCGTTTCATCAATAGGCTCATTCATCTCTCTGACCGCTGTAATAGTAATAATCTTTATAATCTGGGAAGCCTTCGCCTCAAAGCGAGAAGTAGAGACCGTTGAGTTAACTACAACTAATCTAGAATGACTCCACGGATGTCCACCTCCGTATCATACATTCGAGGAGCCTGCCTACGTAAAAGCTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lepus capensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Drew, C., O'Donovan, D., Simkins, G., Al Dosary, M., Al Khaldi, A.M., Mohammed, O.B., Al Nuaimi, A.S.M., Al Mutairi, M.S., Al Habhani, H.M., Sami Amr, Z., Qarqas, M. & Abu Baker, M.A.

Reviewer/s
Smith, A.T. & Johnston, C.H. (Lagomorph Red List Authority)

Contributor/s

Justification
This is a widespread species, with a large population, whose decline does not qualify it for listing as a threatened species. In the southern extent of the African distribution population declines have been noted, but it has been described as a less than 10% decline since 1904 and expected to continue at this rate until 2104 (Kryger et al. 2004).

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These animals are not currently a conservation concern.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no figures available on population size of L. capensis. Even in UAE, the population is highly variable and is dependent entirely on habitat availability - both for feeding and for sheltering from the summer sun. Population trends for the Arabian distribution are characterized as declining at a rate of less than 20% (Drew et al. 2004). There is concern regarding the current population status of L. capensis on islands in the Persian Gulf, specifically Masirah Island and Bahrain.

In the southern region of its African range, there is a current and an anticipated "slow rate of population decline," with total population number for this species currently at greater than 10,000 individuals (Kryger et al. 2004). The predicted rate of decline is 10% until the year 2104 (Kryger et al. 2004). No population information was available for the northern African region of this species.

Although characterized as locally common, the population on Sardinia has been experiencing a decline (Mitchell-Jones et al. 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Because of oil wealth and a desire within Gulf States to increase the human population size (in order to become less dependent on foreign labour) there are numerous threats to the species throughout its range:
Urban development: current and future threat
Infrastructural development: current and future threat
Road kills: current and future threat
Livestock competition: current and future threat
Recreational activities: current and future threat
Harvest/hunting: current and future threat
Pesticides: likely to become a threat within the next 10 years
Poisoning: likely to become a threat within the next 10 years
Climate: current and future threat
Disease: possible future threat
Loss of habitat: current and future threat
Habitat fragmentation: current and future threat
Predation: current and future threat

These threats are likely to lead to a population decline. Current estimates are that the population has declined by less than 20% since the 1980's. This figure is derived from another estimate that the available habitat has declined by approximately 20% since the 1950's. Predictions are that available habitat will continue to decline until the year 2024.

In Africa, loss of habitat due to agricultural practices and hunting (sport and subsistence) pose a threat to L. capensis (Kryger et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
National legislation does exist:
Protected by law in Jordan, UAE, Oman, and Bahrain. Hunting is permitted in Bahrain and Saudi Arabia. Hares are present in all terrestrial protected areas.

In Arabia, hare specific surveys are required to confirm if populations are still extant. According to colleagues who have visited Masirah Island, Oman for coastal surveys, there are no longer any hares there. If it is true, this would be of concern as it is possible that L. c. jefferyi is in fact a separate species. There were no representatives from Bahrain; however, from previous conversations with wildlife biologists from Bahrain it seems possible that L. c. atallahi may no longer exist there. It was also recorded, provisionally, as occurring in Qatar. There are still hares in Qatar but their taxonomy is uncertain.

The area of occupancy for L. capensis includes sections of established protected areas in Africa (Boitani et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

When L. capensis populations are high, these hares may cause damage in young forest plantations and among crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans hunt these hares for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cape hare

The Cape, common or brown hare (Lepus capensis) is a hare natively found throughout Africa, and has spread to many parts of Europe, the Middle East and Asia. The Cape hare is a nocturnal herbivore. It is known in French as lièvre du Cap and in Spanish as liebre del Cabo.

Taxonomy[edit]

There are twelve subspecies that exist in Africa.[3] These include:

Appearance[edit]

The Cape Hare is a typical hare, with well-developed legs for leaping and running, and large eyes and ears to look out for threats from its environment. There is usually a white ring around the eye. It has a fine, soft coat which varies in colour from light brown to reddish to sandy grey. Unusually among mammals, the female is larger than the male; this phenomenon is called sexual dimorphism.

Habitat[edit]

It may be found in macchia-type vegetation, grassland, bushveld, and semi-desert areas.

Ecology[edit]

The Cape Hare is a herbivore, typically eating grass and shrubs of various types. Coprophagy, the consumption of fecal material, is a common behaviour amongst rabbits and hares. This habit allows the animal to extract the maximum nourishment from its diet, and microbes present in the pellets also provide nutrients.

Like other hares, they are fast. The only predator which is capable of outrunning them is the cheetah. All other predators are ambush and/or opportunistic hunters; examples of these are leopards, caracals, and black-backed jackals.

After a 42-day-long pregnancy, the female gives birth to from one to three young, termed leverets, per litter and may have as many as 4 litters per year. A characteristic of hares which differentiates them from rabbits is that the young are born precocial; that is, the young are born with eyes open and are able to move about shortly after birth. The Cape Hare is no exception in this regard.

Conservation status[edit]

Because of its large range, the Cape Hare is evaluated by IUCN as "Least Concern", although the population trend is decreasing.[4]

Gallery[edit]

References[edit]

  1. ^ Hoffman, R. S.; Smith, A. T. (2005). "Order Lagomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 196–197. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Lagomorph Specialist Group (1996). Lepus capensis. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 2006-05-06. Database entry includes a brief justification of why this species is of least concern
  3. ^ "Cape Hare". Retrieved 14 August 2012. 
  4. ^ "IUCN Red List for Cape Hare". Retrieved 14 August 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!