Overview

Brief Summary

Biology

This adaptable species is highly promiscuous and both males and females mate with as many members of the opposite sex as possible. They travel in groups of between 8 and 180 individuals, usually with two to four times as many females as males. Breeding takes place whenever the seasons permit, with no defined period in non-seasonal areas. Females undergo a regular oestrus cycle of 26 – 29 days, but unlike many other macaques, the genital region swells and darkens in colour only slightly during the fertile period, and only in younger adult females (4). Gestation lasts around 165 days, and females give birth to a single young or, rarely, twins. The young is fed milk for a year, first clinging to the mother's belly, but riding on her back when older. After weaning, female juveniles may remain with the same group whereas males often disperse to another. Females become sexually mature between 2.5 and 4 years and males between 4.5 and 7 years. Females who reach ages of more than 25 years go through the menopause, eventually becoming infertile (6). The rhesus macaque shows dominance hierarchies in both sexes, but more so in males. The status of each individual is inherited from its mother. There may be confrontations between groups, but these are rare as weaker groups actively avoid stronger groups. Females within groups can be very loud, but rarely fight as they are usually closely related (4). All members of the group practise social grooming for pleasure, health and as a form of submission and appeasement. Appeasement is also shown by the fear grimace in which the lips are retracted to reveal the clenched teeth. Staring with the mouth open signifies threat and putting the tail vertically upwards indicates aggressive confidence. Infants attract their mother's attention by cooing, and adult females will also coo to attract a male. Males respond by lip-smacking as an invitation to mate (5). The diet of the rhesus macaque varies by region. They are omnivorous opportunists, feeding mainly on roots, herbs, insects, crop plants and small animals. They are good swimmers and will cross water to find food (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

With an expressive face and active lifestyle, the rhesus macaque is a charismatic species. Its coat is pale brown above and fades on the underside, but the naked face and rump are bright red in adults (2). It has large cheek pouches which it uses to store food when foraging (5). Audebert, who named the rhesus macaque, did so after the Greek King of Thrace, Rhesos, but emphasized that it had no special relevance. Since, the name rhesus has been extended to the hereditary blood antigen 'Rh-factor' which was discovered on the red blood cells of rhesus macaques and was also found to be present in humans (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species as a whole is found throughout most of southern Asia, in eastern Afghanistan, Bangladesh, Bhutan, central and southern China (Anhui, Fujian, Guangdong, Guangxi, Guizhou, Hebei, Henan, Hubei, Hunan, Shaanxi, Sichuan, Tibet, and Yunnan, as well as the island of Hainan), northern and central India (in the states of Andhra Pradesh, Arunachal Pradesh, Assam, Bihar, Chattisgarh, Gujarat, Haryana, Himachal Pradesh, Jammu and Kashmir, Jharkand, Madhya Pradesh, Maharashtra, Manipur, Meghalaya, Mizoram, Nagaland, Orissa, Punjab, Rajasthan, Sikkim, Tripura, Uttaranchal, Uttar Pradesh and West Bengal), Lao PDR, Myanmar, Nepal, northern Pakistan, northern Thailand, and Viet Nam.

It occurs to the north of the Krishna River in central and eastern India and to the north of the lower Tapti River in western India, north into Afghanistan, Nepal, Sikkim, Bhutan, and northeast into China, where it extends to the Yangtze and north of its middle course to about 33°N, 110°E. It is absent north of the lower Yangtze, but there is an additional, possibly introduced population in northern China north of the lower Hwang He (Yellow River), formerly occurring as far as Beijing (Groves 2001).

There are introduced populations (mostly not mapped) in areas within this region as well as outside it, for instance south of the Krishna River in India; Kowloon and a few small islands near Hong Kong; and to various other locations worldwide, including parts of Florida, USA and on Cayo Santiago island near Puerto Rico (M. Richardson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Populations of rhesus monkeys (Macaca mulatta) are most commonly found in western Afghanistan, through India to northern Thailand. This species was abundant historically in southern China and Tibet, but humans have caused drastic decline of populations in these areas over the last sixty years. Because M. mulatta is often used for research, today populations are kept in captivity world wide.

(Nowak, 1991; Parker, 1990; Wilson and Reeder, 1993)

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Afghanistan and India to northern Thailand, China, and Hainan Island (China) (Groves, in Wilson and Reeder 2005); sea level to 2500 m (Nowak 1991). Introduced in Puerto Rico and on an island near Rio de Janeiro (Brazil). A feral population in central Florida has existed since the 1930s (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Still widespread across southern Asia, the rhesus macaque has nevertheless become locally extinct in some of its former range. It has been introduced into Florida, USA as well as to Cayo Santiago Island near Puerto Rico, and is kept in captivity in large numbers worldwide due to its common use in research (4). This species has even been a participant in space travel (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These smallish monkeys have grizzled-brown fur dorsally, with the fur on the ventrum being slightly lighter in color. The hair is short on the head. The face and buttocks of adults are red.

Length varies in this species, ranging between 45 and 64 cm. The tail adds an additional 19 to 32 cm to the total length. Males are somewhat heavier than females, weighing between 6.5 and 12 kg. Females weigh a mere 5.5 kg on average.

Range mass: 4 to 12 kg.

Range length: 45 to 64 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • BBC, 2005. "Rhesus Monkey" (On-line). Accessed May 30, 2005 at http://www.bbc.co.uk/nature/wildfacts/factfiles/211.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Macaca mulatta
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1891
Locality: Lolab, Jammu And Kashmir, India, Asia
  • Type: True, F. W. 1894 May 08. Proc. U.S. Nat. Mus. 17: 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is diurnal and omnivorous, and alternatively arboreal and terrestrial. It resides in a range of habitats, including temperate coniferous, moist and dry deciduous, bamboo, and mixed forests, mangroves, scrub, rainforest, and around human habitations and developments, including cultivated areas, temples, and roadsides (Choudhury 2001; Srivastava and Mohnot 2001). In Pakistan this monkey remains in mountainous regions with forest cover; it is typically associated with Himalayan moist temperate forest (Roberts 1997). It is found at elevations up to 4,000 m (Molur et al. 2003). Due to hunting in Lao PDR and Viet Nam the species does not occur in commensal situations there, and is restricted to forest areas where it is generally associated with riverine environments over a range of altitudes (Timmins pers. comm.). In western and northern parts of its range it seems to occur in a wider array of environments. It is highly adaptable to man-made habitat. Its generation time is 12 years (Molur et al. 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Macaca mulatta lives in a wide range of habitats, and shows a great deal of adaptability. Some populations live in flatlands, while others, in northern India and Pakistan, live in the Himalayas at elevations up to 3,000 m. These primates are able to aclimate to a variety of climatic extremes, from the hot, dry temperatures found in deserts, to cold winter temperatures which fall to well below the freezing point.

In addition to living in the wilderness, some populations of M. mulatta have become accustomed to living alongside humans. Occasionally, small groups can be found living in the densely populated urban areas of northern India. Groups of rhesus monkeys that become used to living in areas occupied by people usually search out other human-populated areas if people attempt to relocate them away from civilization.

(Nowak, 1991; Parker, 1990)

Range elevation: 3,000 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Native range: near desert to dense forest; also cities and towns providing shelter, large trees, abundant food, and water from wells (Nowak 1991). In mainland Asia, rare or absent in broad-leaved evergreen forest but broadly distributed in secondary, deciduous, coniferous, riverine, and mangrove forests and in disturbed habitats (see Nowak 1991). Sacred to the Hindu religion, commonly found in the vicinity of temples and urban areas in northern India and Nepal (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The rhesus macaque occupies an enormous range of habitats and climates, ranging from snow-covered mountains through dense forests to semi-desert and urban areas (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The dietary habits of rhesus monkeys can vary greatly depending upon where they live. Macaca mulatta is omnivorous, and often eat roots, herbs, fruits, insects, crops, and small animals. The diet can also vary with the season. For example, rhesus that live in the mountain forests of northern Pakistan feed primarily on clovers during the summer, but during winter when snow covers the ground they are forced to switch to foods with lower nutritional values and higher fiber contents, such as pine needles and oak leaves. These monkeys seem to choose their environments carefully with respect to food resources. Even when they are forced to switch to lower quality food sources during the winter months they do not exhibit higher mortality rates, although they may lose a considerable percentage of their body weight.

(Macdonald, 1984; Nowak, 1991; Parker, 1990)

Animal Foods: birds; mammals; amphibians; reptiles; insects

Plant Foods: leaves; roots and tubers; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Largely vegetarian; eats wild and cultivated fruits, berries, grains, leaves, buds, seeds, flowers, and bark; opportunistically eats insects and other small invertebrates and occasionally eggs and small vertebrates (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The role of these animals in their ecosystems has not been fully described. Because of their frugivory, rhesus monkeys may help to disperse seeds. As a prey species, they may affect predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Primates are often wary of potential predators. It is likey that large carnivores, raptors, and snakes could prey upon these macaques.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Area of activity may shift with seasons; one study reported an average daily distance moved of 1428 m (range 350-2820 m). In Indonesia, population density was 5-15 per sq km in high forest, 57/sq km in low forest, and 753/sq km in towns; in northern India, 62 lived in an area of less than 4 ha (see Nowak 1991). Home range has been reported as up to 16 sq km in sub-Himalayan forests and 0.05 sq km in towns; generally, the home range of different groups overlap, sometimes extensively (see Nowak 1991). Heterosexual group size ranges from 8 to 180, with females outnumbering males; many adult males live alone or in small groups of their own. On Cayo Santiago (Puerto Rico): annual mortality was 5-8%, high infant survival rate; some lived 25+ years, but most of population was less than 10 years old (Rawlins and Kessler 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in all monkeys involves a variety of visual signals (such as body postures and facial expression), tactile communication (such as grooming, playing and fighting), vocalizations, and scent cues.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily diurnal; time of activity may shift with season; midday inactivity may occur during warm periods (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Rhesus monkeys can live up to 30 years.

Range lifespan

Status: wild:
30 (high) hours.

Range lifespan

Status: captivity:
30 (high) hours.

Average lifespan

Status: captivity:
36.0 years.

Average lifespan

Sex: female

Status: captivity:
23.0 years.

Average lifespan

Status: captivity:
35.0 years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: wild:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: Despite a higher MRDT (Finch et al. 1990), rhesus macaques appear to age significantly faster than humans from a physiological perspective (Caleb Finch 1990). The females of this species reach menopause at the age of 25 years (Ronald Nowak 1999). Maximum longevity is 40 years (Bodkin et al. 2003). It is possible that one animal under caloric restriction for part of its life lived for slightly longer than 40 years but this record is unverified (George Roth, pers. comm.).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Although rhesus monkeys show mate preferences, in general they are highly promiscuous. As they live in multi-male, multifemale groups, there are ample opportunities for individuals to copulate with multiple partners.

Female rhesus monkeys have a sexual cycle of 29 days. They are receptive to copulation for between 8 and 11 days during that cycle. To solicit copulations, females present their hindquarters to males. The skin of the perineal region becomes redded when the female is in estrus, and aliphatic acids are present, proving a potential chemical cue to their state of fertility.

Rhesus monkeys are serial mounters, meaning that males mount a female multiple times before ejaculating.

Males attract mates either by having high dominance status within the social group, or sometimes by being friendly (grooming, carrying infants, etc) to females.

Mating System: polygynandrous (promiscuous)

The breeding season varies widely amongst populations. Populations that live in areas where the winters are cold mate in the fall so that the young are born in the spring. Macaca mulatta that live where seasonal changes are less pronounced have less well-defined mating seasons.

The gestation period is around 165 days, and almost all pregnancies results in birth of a single young. When kept under uniform conditions in captivity, females maintain a steady estrus cycle of 26 to 28 days.

Unlike many primate species, the estrus cycle of M. mulatta is not accompanied by major changes in the females' genital region. There is only minor swelling and redness around the genital area.

In populations that have distinct breeding seasons, testes swell to almost double their normal size during the breeding season. The disproportionately large testicles of male rhesus monkeys, and the increase in size of their testicles during the breeding season, is probably related to the number of times a male can copulate over a short period of time.

(Buscovitch, 1993; Nowak, 1991; Parker, 1990)

Newborn macaques weigh between 400 and 500g. They nurse from their mother for about 1 year. Although young macaques typically cling to their mother's ventrum for the first few weeks of life, as their ability to keep themselves upright improves, they ride upon the mother's back. Females reach nreproductive maturity at 2.5 to 3 years of age. Males take longer to complete the transition to adulthood, reaching sexual maturity at 4.5 to 7 years of age. (Nowak, 1991)

Breeding interval: Females are capable of producing one young per year under good conditions.

Breeding season: Populations that live in areas where the winters are cold mate in the fall; those that live where seasonal changes are less pronounced have less well defined mating seasons

Average number of offspring: 1.

Range gestation period: 133 to 200 days.

Average gestation period: 165 days.

Average weaning age: 12 months.

Range age at sexual or reproductive maturity (female): 2.5 to 4 years.

Range age at sexual or reproductive maturity (male): 4.5 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; post-partum estrous

Average birth mass: 464 g.

Average number of offspring: 1.

As is common to most primates, the bulk of parental care falls to females. Mothers provide their young with protection, nutrition, grooming, and social experience from birth until independence.

The role of males in parental care is somewhat confusing. Because social groups contain multiple males, and because females mate with many of these males, there is no certainty of paternity, so males don't even know which young are theirs. There may be some care given to young by close male friends of the mother. These males may be more likely to have sired the offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Hrdy, S., P. Whitten. 1987. Patterning of Sexual Activity. Pp. 370-384 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago and London: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction is seasonal; in south-central Asia, births occur mainly February-May, with some also in September-October; usually a female produces one young every other year; gestation lasts 135-194 days (mean 166); young nurse for about a year, sexually mature in about 2.5-4 years in females, 2-3 years in males (Nowak 1991). On Cayo Santiago (Puerto Rico): median birth date was February 11 to April 12 in different years; females usually produce 1st young at 4 years; litter size 1; 75-85% of adult females gave birth each year (Rawlins and Kessler 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macaca mulatta

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0618-06|NC_005943|Macaca mulatta| AATCGCTGACTCTTTTCAACAAATCACAAAGACATTGGAACCCTGTATTTACTATTTGGTGCATGAGCTGGAATCATAGGCACTGCCCTA---AGCCTCCTCATTCGAGCTGAACTAGGCCAACCCGGCAACCTACTAGGCAAC---GACCACATCTATAACGTTATTGTAACGGCCCATGCATTTGTCATAATTTTCTTTACAGTCATACCCATTATAATTGGAGGGTTCGGGAACTGACTAGTACCCCTAATA---ATCGGCGCCCCCGACATAGCATTCCCCCGTCTAAACAATATGAGCTTCTGACTCCTCCCCCCTTCTTTCCTGCTACTAATAGCATCCGCCGTGGTAGAAGCTGGCGCCGGAACAGGCTGAACAGTATACCCCCCTCTAGCAGGAAACTTCTCCCACCCAGGAGCTTCTGTAGATTTA---GTCATCTTCTCTCTTCACCTAGCAGGTATTTCCTCTATCTTAGGAGCCATCAACTTCATTACCACCATTATCAACATAAAACCCCCCGCAGTATCCCAATACCAAACCCCTTTATTTGTCTGATCAATCTTAATCACAGCAATCCTTCTACTCCTCTCTCTACCAGTTCTAGCCGCC---GGCATTACCATGCTACTAACAGATCGCAACCTCAATACTACTTTCTTTGACCCTGTTGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTTGGTCACCCGGAAGTCTACATCCTTATTCTCCCCGGCTTCGGAATAGTCTCCCACATTGTAACCTACTACTCTGGGAAAAAA---GAACCATTTGGGTACATGGGTATAGTTTGAGCCATAATATCAATTGGGTTTTTAGGTTTTATTGTATGAGCCCACCACATGTTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macaca mulatta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 17
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Richardson, M., Chhangani, A. & Yongcheng, L.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, is tolerant of a broad range of habitats, and because it is unlikely to be declining at anything close to the rate required to qualify for listing in a threatened category.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN considers this species Lower risk/ near threatened.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The rhesus macaque is classified as Lower Risk – near threatened (LR/nt) on the IUCN Red List 2004 (1) and is listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widely distributed in south, southeast and east Asia. Populations are sizable, but increasingly commensal with humans, resulting in some fragmentation of the distribution (Molur et al. 2003). It can be abundant in many places, including in cities. Hunting of this species in Lao PDR and Viet Nam has severely depressed populations in these countries although it still remains widespread. In Namdapha National Park, India, this species was found to have a group density of 0.44 groups/km2, with an average group size of 12.3 individuals (Chetry et al. 2003). The average group size in other parts of India is much higher (Siddiqui and Southwick 2004). Srivastava and Mohnot (2001) consider this species to be rare in the forests of north-eastern India.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is generally unthreatened, though its original habitat is increasingly being lost to development. While M. mulatta exists easily around humans, the increasing level of cohabitation has been associated with waning levels of human tolerance for the animals (Molur et al. 2003). Confiscation for laboratory testing is a mostly localized threat, but it is considerable in certain areas (A. Kumar pers. comm.). Capture and release of laboratory and “problem monkeys” from rural and urban areas into natural forests is a major threat to wild macaques.

In Lao PDR and Viet Nam the major threat to the species is hunting, although loss of forest in river valleys has also likely impacted the species (R. Timmins pers. comm.). In Indochina hunting pressure is high, and thus tolerance to human disturbance is low.

Introduction, through release of confiscated M. fasicularis, is at least a localized threat in parts of the species' Viet Namese range (R. Timmins pers. comm.). Tolerance of the species varies locally, from heavily hunted and persecuted, to worshipped and fed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Whilst the rhesus macaque is threatened in the wild, a large captive population is maintained around the world for use in biological, psychological and medicinal research, especially for studies into perception, learning and behaviour. In the wild, the rhesus macaque is a generalist with great adaptability, allowing it to make the most of changes in land use. In India they are known for crop-raiding but their status as sacred animals in the Hindu religion prevents persecution by humans (4). Interspecies breeding is known to occur but appears to have no effect on the offspring's fertility, as other interspecies crosses usually do (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II. It is also listed in Schedule III in the Bangladesh Wildlife (Preservation) (Amendment) Act, 1974 and in Schedule I, Part I in the Indian Wildlife (Protection) Act (amended up to 2002), on Category II of the Chinese Wildlife Protection Act (1989), and is protected with all other primates in the Nepalese National Parks and Wildlife Conservation Act, 1973. Protection status varies widely throughout the species range.
Rhesus macaques reside in a large number of protected areas throughout their range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Continued research and monitoring of this species' behaviour, population status and range is necessary to foresee declines as a result of land use change across southern and Southeast Asia (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In India, rhesus monkeys do significant damage to crops and gardens in many areas. Because they are viewed as sacred animals by Hindus, often little is done to stop them from stealing crops.

As is true of most nonhuman primates, there is a high risk that they could carry diseases which affect humans.

(Nowak, 1991; Parker, 1990)

Negative Impacts: injures humans (bites or stings); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Macaca mulatta is a popular zoo animal because of its innate curiosity and active lifestyle. These monkeys are also used extensively for research. They are especially useful in biological, medicinal, and psychological research. Macaca mulatta is most often used in psychological research when the emphasis is on perception, learning, or behavior.

(Nowak, 1991; Parker, 1990)

Positive Impacts: source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Formerly exported in large numbers to the U.S. and elsewhere for use in biological, behavioral, and medical research.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhesus macaque

The rhesus macaque (Macaca mulatta), also called the rhesus monkey, is one of the best-known species of Old World monkeys. It is listed as Least Concern in the IUCN Red List of Threatened Species in view of its wide distribution, presumed large population, and its tolerance of a broad range of habitats. Native to South, Central and Southeast Asia, troops of Macaca mulatta inhabit a great variety of habitats from grasslands to arid and forested areas, but also close to human settlements.[2]

Contents

Characteristics

The rhesus macaque is brown or grey in color and has a pink face, which is bereft of fur. Its tail is of medium length and averages between 20.7 and 22.9 cm (8.1 and 9.0 in). Adult males measure approximately 53 cm (21 in) on average and weigh about 7.7 kg (17 lb). Females are smaller, averaging 47 cm (19 in) in length and 5.3 kg (12 lb) in weight. Rhesus macaques have on average 50 vertebrae. Their intermembral index (ratio of arms to legs) is 89%. They have dorsal scapula and a wide rib cage.

The rhesus macaque has 32 teeth with a dental formula of 2.1.2.3/2.1.2.3 and bilophodont molars. The upper molars have four cusps: paracone, metacone, protocone and hypocone. The lower molars also have four cusps: metaconid, protoconid, hypoconid and entoconid.

Distribution and habitat

Rhesus macaques in the Red Fort of Agra in India

Rhesus macaques are native to northern India, Bangladesh, Pakistan, Nepal, Burma, Thailand, Afghanistan, Vietnam, southern China, and some neighboring areas. The rhesus macaque has the widest geographic ranges of any nonhuman primate, occupying a great diversity of altitudes throughout Central, South and Southeast Asia. Inhabiting arid, open areas, Rhesus macaques may be found in grasslands, woodlands and in mountainous regions up to 2,500 m (8,200 ft) in elevation. They are regular swimmers. Babies as young as a few days old can swim, and adults are known to swim over a half mile between islands, but are often found drowned in small groups where their drinking waters lie. Rhesus macaques are noted for their tendency to move from rural to urban areas, coming to rely on handouts or refuse from humans.[3]

The southern and the northern distributional limits for rhesus and bonnet macaques, respectively, currently run parallel to each other in the western part of the country, are separated by a large gap in central India, and converge on the eastern coast of the peninsula to form a distribution overlap zone. This overlap region is characterized by the presence of mixed-species troops, with pure troops of both species sometimes occurring even in close proximity to one another. The range extension of rhesus macaque – a natural process in some areas and a direct consequence of introduction by humans in other regions – poses grave implications for the endemic and declining populations of bonnet macaques in southern India.[4]

Distribution of subspecies and populations

The name rhesus is reminiscent of the Greek mythological king Rhêsos. However, the French naturalist Jean-Baptiste Audebert who applied the name to the species, stated that it had no meaning.[5]

According to Zimmermann’s first description of 1780, the rhesus macaque is distributed in eastern Afghanistan, Bangladesh, Bhutan, as far east as the Brahmaputra Valley in peninsular India, Nepal and northern Pakistan. Today, this is known as the Indian rhesus macaque Macaca mulatta mulatta, which includes the morphologically similar Macacus rhesus villosus described by True in 1894 from Kashmir and Macaca mulatta mcmahoni described by Pocock in 1932 from Kootai, Pakistan. Several Chinese subspecies of rhesus macaques have been described between 1867 and 1917. The molecular differences identified among populations however are alone not consistent enough to conclusively define any subspecies.[6]
The Chinese subspecies can be divided in:

Feral colonies in the United States

Around the spring of 1938, a colony of rhesus macaques were released in the Silver River State Park in Florida by a tour boat operator known locally as "Colonel Tooey" to enhance his "Jungle Cruise". A traditional story that the monkeys were released for scenery enhancement in the Tarzan movies that were filmed at that location is false, as the only Tarzan movie filmed in the area, 1939's Tarzan Finds a Son! contains no rhesus macaques.[9] In addition, various colonies of rhesus and other monkey species are speculated to be the result of zoos and wildlife parks destroyed in hurricanes, most notably Hurricane Andrew.[10]

There is also a notable colony of rhesus macaques on Morgan Island, one of the Sea Islands in the South Carolina Lowcountry. They were imported in the 1970s for use in local labs and are by all accounts thriving.[11]

Ecology and behavior

A roadside band of rhesus macaque in Rishikesh, Uttarakhand, India. Although they are infamous as urban pests, who are quick to steal not only food, but also household items, it is not certain if the pair of jeans draped over the wall on the right is their handiwork.

Rhesus macaques are diurnal animals, and both arboreal and terrestrial. They are quadrupedal and, when on the ground, they walk digitigrade and plantigrade. They are mostly herbivorous feeding on mainly fruit, but also eating seeds, roots, buds, bark, and cereals. It has been estimated that they consume around 99 different plant species in 46 families. During the monsoon season, they get much of their water from ripe and succulent fruit. Macaque living far from water sources lick dewdrops from leaves and drink rain water accumulated in tree hollows.[12] They have also been observed eating termites, grasshoppers, ants and beetles.[13] When food is abundant, they are distributed in patches and forage throughout the day in their home range. They drink water when foraging and gather around streams and rivers.[14] Rhesus macaques have specialized pouch-like cheeks, allowing them to temporarily hoard their food.

In psychological research, rhesus macaques have demonstrated a variety of complex cognitive abilities, including the ability to make same-different judgments, understand simple rules, and monitor their own mental states.[15] They have even been shown to demonstrate self-agency[16], an important type of self-awareness.

Group structure

Like other macaques, rhesus troops comprise a mixture of 20–200 males and females.[17] Females may outnumber the males by a ratio of 4:1. Males and females both have separate hierarchies. Females have highly stable matrilineal hierarchies in which a female’s rank is dependent on the rank of her mother. In addition, a single group may have multiple matrilineal lines that exist in a hierarchy, and a female outranks any unrelated females that rank lower than her mother.[18] Rhesus macaques are unusual in that the youngest females tend to outrank their older sisters.[19] This is likely because young females are more fit and fertile. Mothers seem to prevent the older daughters from forming coalitions against her. The youngest daughter is the most dependent on the mother, and would have nothing to gain from helping her siblings in overthrowing their mother. Since each daughter had a high rank in their early years, rebelling against their mother is discouraged.[20] Juvenile male macaques also exist in matrilineal lines but once they reach 4–5 years of age they are driven out of their natal groups by the dominant male. Thus adult males gain dominance by age and experience.[14]

In the group, macaques position themselves based on rank. The Central Male Sub-group contains the 2-3 oldest and most dominant males who are co-dominant, along with females, their infants and juveniles. This sub-group occupies the center of the group and determines the movements, foraging and other routines.[14] The females of this sub-group are also the most dominant of the entire group. The farther to the periphery a sub-group is, the less dominant it is. Sub-groups on the periphery of the central group are run by one dominant male who ranks lower than the central males, and who maintain order in the group and communicate messages between the central and peripheral males. A sub-group of subordinate, often sub-adult males occupy the very edge of the groups and have the responsibility of communicating with other macaque groups and make alarm calls.[21]

Communication

Rhesus macaques interact using a variety of facial expressive, vocalizations and body postures, and gestures. Perhaps the most common facial expression the macaque makes is the "silent bared teeth" face.[22] This is made between individuals of different social rank with the lower rank one giving the expression to its superior. A less dominant individual will also make a "fear grimace" accompanied by a scream to appease or redirect aggression.[23] Another submissive behavior is the "present rump" where an individual raises its tail and exposes its genitals to the dominant one.[22] A dominant individual will threaten another individual standing quadrupedally making a silent "open mouth stare" accompanied by the tail sticking straight.[24] During movements, macaques will make "coos" and "grunts". These are also made during affiliative interactions and approaches before grooming.[25] When they find rare food of high-quality, macaque will emit "Warbles," "harmonic arches," or "chirps." When in threatening situations, macaques will emit a single loud, high-pitched sounds called a "shrill bark".[26] "Screeches," "screams," "squeaks," "pant-threats," "growls," and "barks" are when during aggressive interactions.[26] Infants make "geckers" during weaning conflicts.

Reproduction

Rhesus macaque with two babies near the Jakhu temple of Shimla, Himachal Pradesh

Adult male macaques try to maximize their reproductive success by entering into consort pairs with females, both in and outside the breeding period. Females prefer to mate with males that will increase the survival of their young. Thus a consort male provides resources for his female and protects her from predators. Larger, more dominant males are more likely to provide for the females. The breeding period can last up to 11 days, and a female usually mates with four males during that time. Male rhesus macaques have not been observed to fight for access to sexually receptive females, although they suffer more wounds during the mating season.[27] Female macaques first breed when they are four years old, and reach menopause at around 25 years of age.[28] Male macaques generally play no role in raising the young but do have peaceful relationships with the offspring of their consort pairs.[14]

Mothers with one or more immature daughters in addition to their infants are in contact with their infants less than those with no older immature daughters. This is because the mothers may pass the parenting responsibilities to her daughters. High-ranking mothers with older immature daughters also reject their infants significantly more than those without older daughters, and tend to begin mating earlier in the mating season than expected based on their dates of parturition the preceding birth season.[29] Infants farther from the center of the groups are more vulnerable to infanticide from outside groups.[14] Some mothers abuse their infants which is believed to be the result of controlling parenting styles.[30]

In science

Project Mercury rocket Little Joe 1B, launched in 1960, carried Miss Sam to 9.3 mi (15.0 km) in altitude.

The rhesus macaque is well known to science. Due to its relatively easy upkeep in captivity, its wide availability and its closeness to humans anatomically and physiologically, it has been used extensively in medical and biological research on human and animal health-related topics. It has given its name to the Rhesus factor, one of the elements of a person's blood group, by the discoverers of the factor, Karl Landsteiner and Alexander Wiener. The rhesus macaque was also used in the well-known experiments on maternal deprivation carried out in the 1950s by controversial comparative psychologist Harry Harlow. Other medical breakthroughs facilitated by the use of the rhesus macaque include:

The U.S. Army, the U.S. Air Force, and NASA launched rhesus macaques into outer space during the 1950s and 60s, and the Soviet/Russian space program launched them into space as recently as 1997 on the Bion missions. One of these primates ("Able") who was launched on a suborbital spaceflight in 1959 was one of the two first living beings (along with "Miss Baker" on the same mission) to travel in space and return alive.[citation needed]

In January 2000, the rhesus macaque became the first cloned primate with the birth of Tetra. January 2001 saw the birth of ANDi, the first transgenic primate; ANDi carries foreign genes originally from a jellyfish.[citation needed]

Though most studies of the rhesus macaque are from various locations in northern India, some knowledge of the natural behavior of the species comes from studies carried out on a colony established by the Caribbean Primate Research Center of the University of Puerto Rico on the island of Cayo Santiago, off Puerto Rico.[citation needed] There are no predators on the island, and humans are not permitted to land except as part of the research programmes. The colony is provisioned to some extent, but about 50% of its food comes from natural foraging. In other more controlled settings, these macaques often enjoy Fig Newtons, and are particularly keen on "pouching" large quantities of marshmallow.[citation needed]

Sequencing the genome

Work on the genome of the rhesus macaque was completed in 2007, making rhesus macaque the second non-human primate to have its genome sequenced.[32] Humans and macaques apparently share about 93% of their DNA sequence and shared a common ancestor roughly 25 million years ago.[33]. The rhesus macaque has 21 pairs of chromosomes. [34]

Comparison of rhesus macaques, chimpanzees and humans revealed the structure of ancestral primate genomes, positive selection pressure and lineage-specific expansions and contractions of gene families.

"The goal is to reconstruct the history of every gene in the human genome," said Evan Eichler, University of Washington, Seattle. DNA from different branches of the primate tree will allow us "to trace back the evolutionary changes that occurred at various time points, leading from the common ancestors of the primate clade to Homo sapiens," said Bruce Lahn, University of Chicago.[35]

After the human and chimpanzee genomes were sequenced and compared, it was usually impossible to tell whether differences were the result of the human or chimpanzee gene changing from the common ancestor. After the rhesus macaque genome was sequenced, 3 genes could be compared. If 2 genes were the same, they are presumed to be the original gene.[36]

The chimpanzee and human genome diverged 6 million years ago. They have 98% identity and many conserved regulatory regions. Comparing the macaque and human genome, which diverged 25 million years ago and had 93% identity, further identified evolutionary pressure and gene function.

Like the chimpanzee, changes were on the level of gene rearrangements rather than single mutations. There were frequent insertions, deletions, changes in the order and number of genes, and segmental duplications near gaps, centromeres and telomeres. So macaque, chimpanzee and human chromosomes are mosaics of each other.

Surprisingly, some normal gene sequences in healthy macaques and chimpanzees cause profound disease in humans. For example, the normal sequence of phenylalanine hydroxylase in macaques and chimpanzees is the mutated sequence responsible for phenylketonuria in humans. So humans must have been under evolutionary pressure to adopt a different mechanism.

Some gene families are conserved or under evolutionary pressure and expansion in all 3 primate species, while some are under expansion uniquely in human, chimpanzee or macaque.

For example, cholesterol pathways are conserved in all 3 species (and other primate species). In all 3 species, immune response genes are under positive selection, and genes of T cell-mediated immunity, signal transduction, cell adhesion, and membrane proteins generally. Genes for keratin, which produce hair shafts, were rapidly evolving in all 3 species, possibly because of climate change or mate selection. The X chromosome has 3 times more rearrangements than other chromosomes. The macaque gained 1,358 genes by duplication.

Triangulation of human, chimpanzee and macaque sequences showed expansion of gene families in each species.

The PKFP gene, important in sugar (fructose) metabolism, is expanded in macaques, possibly because of their high-fruit diet. So are genes for the olfactory receptor, cytochrome P450 (which degrades toxins), and CCL3L1-CCL4 (associated in humans with HIV susceptibility).

Immune genes are expanded in macaques, relative to all 4 great ape species. The macaque genome has 33 major histocompatibility genes, 3 times that of human. This has clinical significance because the macaque is used as an experimental model of the human immune system.

In humans, the PRAME (preferentially expressed antigen of melanoma) gene family is expanded. It is actively expressed in cancers but normally testis-specific, possibly involved in spermatogenesis. The PRAME family has 26 members on human chromosome 1. In the macaque, it has 8, and has been very simple and stable for millions of years. The PRAME family arose in translocations in the common mouse-primate ancestor 85 million years ago, and is expanded on mouse chromosome 4.

Agilent and Affymetrix have macaque DNA microarrays with 20,000 gene sequences, and they are used in macaque research. For example, Michael Katze of University of Washington, Seattle, infected macaques with 1918 and modern influenza. The DNA microarray showed the macaque genomic response to human influenza on a cellular level in each tissue. Both viruses stimulated innate immune system inflammation, but the 1918 flu stimulated stronger and more persistent inflammation, causing extensive tissue damage, and it did not stimulate the interferon-1 pathway. The DNA response showed a transition from innate to adaptive immune response over 7 days.[citation needed]

See also

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 163. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100551. 
  2. ^ a b Timmins, R. J., Richardson, M., Chhangani, A., Yongcheng, L. (2008). "Macaca mulatta". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/12554. 
  3. ^ Ciani, A. C. (1986). Intertroop Agonistic Behavior of a Feral Rhesus Macaque Troop in Ranging in Town and Forest Areas in India. Aggressive Behavior 12: 433−439. http://www.esploratore.com/files/resourcesmodule/@random44be4ac49f856/1153323855_Intertroop_Agonistic_Behavior_of_a_Feral_rhesus_Macaque_Troop_Ranging_in_Town_and_Areas_in_India.pdf. 
  4. ^ Kumar, R. Radhakrishna, S., Sinha, A. (2011). Of Least Concern? Range Extension by Rhesus Macaques (Macaca mulatta) Threatens Long-Term Survival of Bonnet Macaques (M. radiata) in Peninsular India. International Journal of Primatology 32 (4): 945−959. DOI: 10.1007/s10764-011-9514-y.
  5. ^ Jaeger, E. 1972. A source-book of biological names and terms. Springfield, Illinois: Charles C. Thomas.
  6. ^ a b c d e f g Brandon-Jones, D., Eudey, A. A., Geissmann, T., Groves, C. P., Melnick, D. J., Morales, J. C., Shekelle, M., Stewart, C.-B. (February 2004: 97-164). Asian Primate Classification. 25, No. 1. International Journal of Primatology. http://www.gibbons.de/main/papers/pdf_files/2004asianprimates.pdf. 
  7. ^ a b c d e Shilai, JXWYM 1991. Taxonomic revision and distribution of subspecies of Rhesus Monkey (Macaca mulatta) in China. Zoological Research, 1991-03 Abstract
  8. ^ Zhang,Y., Shi, L. 1993. Phylogeny of rhesus monkeys (Macaca mulatta) as revealed by mitochondrial DNA restriction enzyme analysis. International Journal of Primatology, Volume 14, Number 4: 587-605. doi 10.1007/BF02215449
  9. ^ Wolfe, Linda, Cambridge University Press (2002). Primates Face to Face. p. 320. ISBN 0-521-79109-X. 
  10. ^ Bilger, B. (April 20, 2009). "The Natural World, Swamp Things". The New Yorker: p. 80. http://www.newyorker.com/reporting/2009/04/20/090420fa_fact_bilger. Retrieved 24 November 2010. 
  11. ^ Taub, D.M., Mehlman, P.T. (1989). "Development of the Morgan Island rhesus monkey colony". Puerto Rico Health Sciences Journal 1989 April 8 (1): 159-69. http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=2780958&dopt=AbstractPlus. 
  12. ^ Makwana, S. (1979). "Field Ecology and Behavior of the rhesus macaque. Food, Feeding and Drinking in Dehra Dun Forests." Indian Journal of Forestry 2(3): 242–253
  13. ^ Lindburg, D.G. (1971) The rhesus monkeys in north India: an ecological and behavioural study. In: Rosenblum, LA (ed.) Primate Behaviour: Developments in the field and laboratory research. Academic Press, New York, vol.1, pp. 83–104.
  14. ^ a b c d e Southwick, C., Beg, M., and R. Siddiqi (1965) "Rhesus Monkeys in North India." Primate Behavior: Field Studies of monkeys and apes. DeVore, I. San Francisco: Holt, Rinehart and Winston
  15. ^ Couchman, J. J., et al. (2010). "Beyond Stimulus Cues and Reinforcement Signals: A New Approach to Animal Metacognition". Journal of Comparative Psychology 124 (4): 356–368. doi:10.1037/a0020129. PMID 20836592. http://www.apa.org/pubs/journals/features/com-124-4-356.pdf. 
  16. ^ Couchman, J. J. (2011). "Self-agency in rhesus monkeys". Biology Letters. doi:10.1098/rsbl.2011.0536. http://rsbl.royalsocietypublishing.org/content/early/2011/06/29/rsbl.2011.0536.short?rss=1. 
  17. ^ Teas, J., Richie, T., Taylor, H., and C. Southwick. "Population Patterns and Behavioral Ecology of Rhesus Monkeys (Macaca Mulatta) in Nepal." The Macaques: Studies in ecology, behavior, and evolution. Lindenburg, D. San Francisco: Van Nostrand Reinhold Company, 1980
  18. ^ Judge, P. and F. Waal (1997). "Rhesus monkey behaviour under diverse population densities: coping with long-term crowding." Animal Behavior 54: 643–662.
  19. ^ Waal , F. "Codevelopment of dominance relations and affiliative bonds in rhesus monkeys." Juvenile Primates: Life History, Development, and Behavior. Pereira, M., and L. Fairbanks. New York: Oxford Oxford University Press, 1993.
  20. ^ Hill, D., Okayasu, N. (1996) "Determinants of dominance among female macaques: nepotism, demography and danger." Evolution and Ecology of Macaque Societies. Fa, J. and D. Lindburg. Cambridge: Cambridge University Press
  21. ^ Gouzoules H., Gouzoules S., Tomaszycki M. (1998). "Agonistic screams and the classification of dominance relationships: are rhesus monkeys fuzzy logicians?". Animal Behaviour 55: 51–60. 
  22. ^ a b Maestripieri D. (1999) "Primate social organization, gestural repertoire size, and communication dynamics: a comparative study of macaque s". In: King BJ, editor. The origins of language: what nonhuman primates can tell us. Santa Fe (NM): School American Research Pr. p 55-77.
  23. ^ Rowe N. (1996) The pictorial guide to the living primates. East Hampton (NY): Pogonias Pr.
  24. ^ Partan SR (2002). "Single and multichannel signal composition: facial expressions and vocalizations of rhesus macaques (Macaca mulatta) ".". Behaviour 139 (2-3): 993–1027. 
  25. ^ Hauser MD (1998). "Functional referents and acoustic similarity field playback experiments with rhesus monkeys". Anim Behav 55 (6): 1647–58. 
  26. ^ a b Lindburg DG. (1971) "The rhesus monkey in north India : an ecological and behavioral study". In: Rosenblum LA, editor. Primate behavior: developments in field and laboratory research, Volume 2. New York : Academic Pr. p 1-106.
  27. ^ Bercovitch F (1997). "Reproductive Strategies of Rhesus Macaques". Primates 38 (3): 247–263. 
  28. ^ Walker ML, Herndon JG (2008). "Menopause in nonhuman primates?". Biology of Reproduction 79 (3): 398–406. doi:10.1095/biolreprod.108.068536. PMC 2553520. PMID 18495681. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2553520. 
  29. ^ Berman, C. (1992) "Immature siblings and mother-infant relationships among free-ranging rhesus monkeys on Cayo Santiago." Animal Behavior 44: 247–258.
  30. ^ Maestripieri D (1998). "Parenting Styles of Abusive Mothers in group-living Rhesus Macaques". Animal Behaviour 55: 1–11. 
  31. ^ Mitruka, B. M. (1976) Introduction. In: Mitruka, B. M., Rawnsley, H. M., Vadehra, D. V., (eds.) Animals for medical research: models for the study of human disease. New York: Wiley & Sons. p 1–21.
  32. ^ Zahn, L. M., Jasny, B. R., Culotta, E., and Pennisi, E. (2007-04-13). "A Barrel of Monkey Genes". Science 316 (5822): 215. doi:10.1126/science.316.5822.215. 
  33. ^ "DNA sequence of Rhesus macaque has evolutionary, medical implications" (Press release). Human Genome Sequencing Center. 13 April 2007. http://www.bcm.edu/news/item.cfm?newsID=853. Retrieved 2007-04-15. 
  34. ^ P. Perticone, M. Rizzoni, F. Palitti, P. di Chiara (1974-07). "Banding patterns of the chromosomes of the Rhesus monkey (Macaca mulatta)". Journal of Human Evolution. http://www.sciencedirect.com/science/article/pii/0047248474900232. 
  35. ^ Rhesus Macaque Genome Sequencing and Analysis Consortium (2007) The rhesus macaque genome. Science, 2007, vol. 316, no. 5822: 235-237
  36. ^ Rhesus Macaque Genome Sequencing and Analysis Consortium (2007) Evolutionary and biomedical insights from the rhesus macaque genome Science, Vol. 316, No. 5822. (13 April 2007): 222-234
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: May be conspecific with M. FASCICULARIS of Indochina and southeastern Asia (Groves, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!