Overview

Distribution

Range Description

This species occurs in Bangladesh, Brunei, Cambodia, India (Nicobar Islands), Indonesia (including Bali, Bangka, the Batu Islands, Bawean, Belitung, Java, Kalimantan Borneo, the Kangean Islands, Karimata, Karimunjawa, Lingga, Lombok, the Natuna Islands, Nias, Nusatenggara, the Riau Archipelago, Simeulue, Sumatra, Sumba, Sumbawa, and Timor), Lao PDR, Malaysia (including the Peninsula as well as Sabah and Sarawak Borneo), Myanmar (including the Mergui Archipelago), the Philippines (Balabec, Basilan, Cagayan Sulu, Culion, Jolo, Leyte, Luzon, Mindanao, Mindoro, Palawan, and Samar), Singapore, Thailand (including offshore islands), Timor-Leste and Viet Nam. On mainland Southeast Asia, there is a hybrid zone with Macaca mulata in central areas that makes it difficult to determine the northern limits of its range. The species has been introduced to Kabeana Island, Indonesia, the Pacific island of Palau, Mauritius in the Indian Ocean, and to New Guinea (Groves 2001) (these introduced populations are not included in the distribution map).

M. f. fascicularis
Occurs in Brunei, Cambodia, Indonesia (including Bali, Bangka, the Batu Islands, Bawean, Java, Kalimantan Borneo, Karimata, Lingga, the Natuna Islands, Nias, Nusatenggara, the Riau Archipelago, Sumatra, Sumba, and Timor), Malaysia (including the peninsula as well as Sabah and Sarawak Borneo), the Philippines (western Mindanao and the Sulu Archipelago), Singapore, southern Thailand (including offshore islands), and southern Viet Nam (Groves 2001).

M. f. aureus
Occurs in southernmost Bangladesh, Lao PDR, Myanmar (including the Mergui Archipelago) and west-central Thailand (Groves 2001).

M. f. umbrosus
Occurs on Nicobar Islands of India (Little Nicobar, Great Nicobar and Katchall), where it is found up to 600 m (Umapathy et al. 2003; Molur et al. 2003; Groves 2001).

M. f. fuscus
Occurs on Pulau Simeulue, off the northwestern coast of Sumatra, Indonesia (Groves 2001).

M. f. condorensis
Occurs on Con Son Island, off the coast of southern Viet Nam (Groves 2001).

M. f. tua
Occurs on Pulau Maratua, east of Borneo, Indonesia (Groves 2001).

M. f. philippensis
Occurs in the Philippines. Found on the islands of Balabac, Basilan, Biliran, Bohol, Busuanga, Camiguin, Catanduanes, Culion, Leyte, Luzon, northeastern Mindanao, Mindoro, Negros, Panay, Palawan, Samar and Sibuyan (Groves 2001; Heaney et al. 1998).

M. f. lasiae
Occurs on Pulau Lasia, off the northewestern coast of Sumatra, Indonesia (Groves 2001).

M. f. karimondjawae
Occurs on Pulau Karimunjawa and (probably) nearby Pulau Kemujan, Java Sea, Indonesia (Groves 2001).

M. f. atriceps
Occurs on Khram Yai Island, off the southeastern coast of Thailand (Groves 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Long tailed or crab eating macaques (Macaca fascicularis) are found in southeast Asia from Burma to the Philippines and southward through Indochina, Malaysia, and Indonesia. They are found as far east as the Timor Islands.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body fur of long-tailed macaques tends to be grey-brown to reddish brown. These colors are always paler ventrally. The face is brownish-grey with cheek whiskers. The eyes are directed forward for binocular vision. The nose is flat and the nostrils are narrow and close together (catarrhine condition). Long-tailed macaques have shovel-shaped incisors, conspicuous canines, and bilophodont molars. The tooth formula is I 2/2, C 1/1, PM 2/2, and M 3/3.

The body length, not including the tail, is 40 to 47 cm. The greyish- brown or reddish colored tail is 50 to 60 cm. Long-tailed macaques exhibit sexual dimorphism in size. The average weight for males is 4.8 to 7 kg and 3 to 4 kg for females, approximately 69% of average male weight.

Range mass: 3 to 7 kg.

Range length: 40 to 47 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is extremely tolerant of a range of habitats, including mangrove and swamp forests, and can be found in agricultural areas near forest (secondary growth, secondary forest, and primary forest) (Thomas 1898; Fooden 1991, 1995; Rabor 1986; Goodman and Ingle 1993; Heaney et al. 1991; Rickart et al. 1993; Danielsen et al. 1994). On the Nicobars, M. f. umbrosus is found in mangroves and coastal forests dominated by Pandanus species (Molur et al. 2003). M. f. aureus is found in evergreen forests and coastal mangroves (Molur et al. 2003). The species has been reported as occurring to elevations of up to 1,000 m on Java, Borneo, and Sumatra (Indonesia), and up to 1,800 m in the Philippines (Heaney et al. 1998). On the mainland, it generally occurs at lower elevations: up to 700 m in Thailand, while in Cambodia and Viet Nam it generally occurs below 300 m. This species is semi-terrestrial, diurnal, and omnivorous (Molur et al. 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Long-tailed macaques are "ecologically diverse." Some of the habitats in which they have been found are primary forests, disturbed and secondary forests, and riverine and coastal forests of nipa palm and mangrove. Long-tailed macaques live most successfully in disturbed habitats and on the periphery of forests.

In Sumatra, they achieve their highest population densities in mixed mangrove swamps, secondary hill forests, and riverine forests. Some were also observed in freshwater swamps, scrub grassland, lowland primary forests, and rubber groves.

In Thailand, long-tailed macaques occur in evergreen forests, bamboo forests, and in deciduous forests.

In Malaysia, they are abundant in coastal lowland forests.

This species has been observed drinking much water and eating crabs, they often live near bodies of water. Of the various habitats occupied by long-tailed macaques, the swamp forests seem to have the highest density of them.

In recent years, habitat alteration has expanded the range of some populations of long-tailed macaques. In Malaysia, cleared land, such as plantation areas, has been colonized by this species. It has been observed that some disturbed habitats have higher troop and population sizes than some pristine forests.

This species has the highest degree of arboreality of all macaque species. One study of long-tailed macaque behavior reported that they never came to the ground except within 5 m of the edge of a river near their tree. The population densities of this diurnal species vary from 10 to 400 per squared kilometer.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Aquatic Biomes: coastal ; brackish water

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Long-tailed macaques are omnivores, and exploit many different food types, reflecting the diversity of habitats they can utilize. The average length of feeding bouts is 18.3 minutes. There may be on average of twenty bouts per day. They eat a wide variety of foods such as fruits, crabs, flowers, insects, leaves, fungi, grasses, and clay. Clay may be eaten for the potassium found in it, although the potassium levels in the clay are low. However, 96% of the feeding time per day is spent eating fruit. Some limited observations suggest that long-tailed macaques select fruit based on ripeness, which is based on color.

Animal Foods: insects; aquatic crustaceans

Plant Foods: leaves; fruit; flowers

Other Foods: fungus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

To the extent that these animals are prey for other species, they may affect populations of those species. Macaca fascicularis may be an important predator in its ecosystem, and may have some impact on prey species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The predators of this species have not been reported.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in other species of the genus Macaca, it is likely that these animals use a combination of visual (facial expression, body postures), auditory (vocalizations), physical (grooming, play, mating, aggression) and possible chemical (olfactory) signals as a part of their repertoire of communication.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although the lifespan of this species has not been reported, it is likely to resemble that of other members of the genus, which seem able to obtain an maximum age of around 30 years in captivity.

Average lifespan

Sex: female

Status: captivity:
25.0 years.

Average lifespan

Status: captivity:
38.0 years.

Average lifespan

Status: captivity:
37.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 39 years (captivity) Observations: One wild born male lived 37.1 years in captivity, making it as old as 39 when he died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In Sumatra, each social group of these monkeys contains an average of 5.7 males and 9.9 adult females. Although females outnumber males, indicating that males have more mates available to them than do females, both sexes may mate with multiple partners. However, the alpha male, or highest ranking male, of the group has the greatest access to mates of any males, and probably sires the most offspring.

Mating System: polygynous ; polygynandrous (promiscuous)

Males reach sexual maturity at approximately 6 years of age, whereas females mature by about 4 years of age. Higher-ranking females become reproductively mature before lower-ranking females. The offspring of these higher-ranking females have a greater chance of survival than do the offspring of lower-ranking females. Both of these phenomena are related to the greater food availability and decreased amount of aggression experienced by the higher ranking females.

Female long-tailed macaques show a conspicuous cyclicity of sexual behavior during their menstrual cycle. As they approach ovulation, females experience a swelling of the skin in the perineal region. However, there has been no direct correlation between the frequency of copulation and the degree of swelling of genital tissues. This concealment of ovulation could exist in order to persuade consorting males to stay with females longer.

As a side effect of the prolonged estrus period and concealment of ovulation, it is difficult for humans to estimate the length of gestation. However, it seems likely that the gestation averages approximately 162 days. The average interbirth intervasl is approximately 390 days, indicating that females can produce young each year if high ranking, and every other year otherwise.

Young are nursed until they are approximately 420 days of age. The average interbirth interval is reported to be 390 days, which is less than the average time until weaning. Both the length of nursing and the interbirth interval may be affected by the rank of the mother.

It is known that the births in this species peak from May to July, corresponding with the rainy season.

Breeding interval: Females have an average interbirth interval of 390 days.

Average number of offspring: 1.

Average gestation period: 162 days.

Average weaning age: 420 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 320 g.

Average gestation period: 165 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1544 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1238 days.

As in all primates, there is an extended period of juvenile dependence. Females provide the bulk of the care for offspring. The young receive nourishment, encouragement, grooming, protection, and teaching from the mother. Young females are likely to remain in the troup into which they were born, whereas males are likely to emmigrate at or near sexual maturity.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macaca fascicularis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2232-09|NC_012670|Macaca fascicularis| GATCGTTGACTCTTTTCAACAAACCATAAGGACATCGGAACCCTGTATTTACTATTTGGTGCATGAGCTGGGGTCATAGGCACTGCCCTG---AGCCTCCTCATTCGAGCTGAACTAGGCCAACCCGGCAGCCTACTAGGCAAC---GACCACATCTACAACGTCATTGTAACGGCCCATGCATTCGTTATAATTTTCTTTACAGTTATACCCATTATAATCGGAGGGTTCGGGAACTGACTAGTGCCCCTAATA---ATCGGCGCTCCCGACATAGCATTTCCCCGTCTAAACAATATAAGCTTTTGACTCCTCCCCCCTTCTTTCCTGCTACTAATTGCATCAGCCGTAGTAGAAGCTGGTGCCGGAACAGGCTGAACAGTATATCCCCCTCTAGCAGGAAACTTCTCCCACCCAGGAGCTTCTGTAGATTTGATT---ATCTTCTCCCTCCACTTAGCAGGTATTTCCTCCATCTTAGGAGCCATCAACTTTATTACCACTATTATCAACATAAAACCTCCCGCAATATCCCAATACCAGACTCCTTTATTTGTCTGATCAATCTTAATCACGGCTATCCTCCTACTACTCTCTCTACCAGTCCTAGCCGCC---GGCATTACCATGTTACTAACAGATCGCAACCTCAACACTACTTTCTTTGATCCTGTTGGAGGAGGAGATCCTATCTTATACCAACACCTATTTTGATTCTTCGGTCACCCCGAAGTCTACATCCTTATTCTTCCCGGCTTTGGGATAGTCTCCCACATTGTAACCTACTACTCTGGAAAAAAA---GAACCATTTGGGTACATGGGTATAGTTTGAGCCATAATATCAATTGGGTTTTTAGGTTTCATTGTATGAGCCCACCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macaca fascicularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ong, P. & Richardson, M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. Although it is under heavy hunting pressure for meat, sport and trophies, this is not considered a major threat to the species overall.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There are nine national parks, nine reserves, and two sanctuaries in which some long-tailed macaques reside. Regardless of the type of habitat, there must be at least 500 squared kilometers of habitat necessary to support a viable population of 5,000 long-tailed macaques. This is the minimum size for a reserve for this species.

Long-tailed macaques receive some protection in temple ruins in Thailand and protection and food in temples in Bali. In Malaysia, long-tailed macaques are legally protected, and they are fed and protected in urban forests and parks. In the Philippines, there is much interest in protecting this species. In Indonesia, the species is well-protected, but some of the reserves are being considered for oil drilling and harvesting. Some people in Bali, in fact, consider these primates to be sacred. This may increase the chances of their survival in these reserves. In Thailand, long-tailed macaques may be hunted, captured, or kept in captivity only under license. The export of this species is regulated by a quota system.

Although there are some sanctuaries for long-tailed macaques, hunting is still a problem. In Thailand and Borneo, they are hunted for food. This species is also killed because it is a pest to agriculture. The fact that these macaques destroy crops has prevented some governments from making serious conservation efforts. Long-tailed macaques are collected for medical research. They are one of the five most used primate species in medical research. Many of these macaques were exported to the United States and Great Britian. Habitat loss in these organisms is occurring due to extensive logging operations.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a widespread and often abundant species, and is sometimes commensal with humans. In the Philippines, it ranges from being locally common to uncommon, though this is largely dependent upon hunting pressure. In Bangladesh, the population has been estimated at less than 100 total individuals, and a population on the Teknaf Peninsula has been completely decimated due to development activities (ship-building) (Molur et al. 2003).
There is a paucity of information available on the population status of several island forms. Molur et al. (2003) estimated about 4,800 individuals of M. f. umbrosus, but nothing is known about the status following the December 2004 tsunami. The islands of Katchall and Little Nicobar were submerged during the tsunami, and it is believed to have affected the habitat of this taxon; on the other hand, Shankaran et al. (2005) state that these macaques were not affected seriously on Greater Nicobar Island. The disaster could have impacted their populations on these two islands due to the fruiting Pandanus being affected by the tsunami (M. Singh pers. comm.). The population on Con Son (M. f. conderensis) likely numbers less than 1,000 individuals, and a number of other island forms probably have a similar status.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Across much of the range, the major threat to the species is hunting. In mainland Southeast Asia, such as in Cambodia and Viet Nam, females are taken into breeding facilities and males are exported internationally primarily for use in laboratory research. A potential related issue is the release of confiscated long-tailed macaques from the border area of Viet Nam and China (which is where most of the current international trade is being recorded) into the native range of other macaque species. In the Philippines, the species is subject to a high level of hunting, where it is taken for local consumption and hunted for sport. It is also persecuted as a pest. Habitat loss is also a localised threat, but the species can persist in a variety of habitats and very adaptable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included in Appendix II of CITES. It is listed on Schedule I, Part I, Indian Wildlife (Protection) Act, 1972 amended up to 2002, and Schedule III, Bangladesh Wildlife (Protection) Act A 1974 (Molur et al. 2003). In Myanmar it is a “normally” protected species. It is a protected on Appendix 2B on Decree 32 (2006) in Viet Nam. It occurs in many protected areas throughout its range and is relatively common in captivity (M. Richardson pers. comm.).

There is a need for further survey work to assess the current population status of the various island forms. In particular, following the Indian Ocean Island tsunami of December 2004, a targeted survey is required to establish their current status on the Nicobars.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Long-tailed macaques have been known to feed in cultivated fields on such items as young dry rice, cassava leaves, rubber fruit, taro plants, and other crops. They also take food from graveyards, garbage cans, and garbage pits. They have also become involved in aggresive interactions with people.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-tailed macaques, along with other species of macaques, have benefited humans through their use as research models in immunology, surgery, toxicology, and pharmacology. They are also important members of ecosystems and may serve as a basis for ecotourism ventures. They are sometimes still hunted for food.

Positive Impacts: food ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crab-eating macaque

The crab-eating macaque (Macaca fascicularis) is a cercopithecine primate native to Southeast Asia. It is also called the "long-tailed macaque", and is referred to as the "cynomolgus monkey" in laboratories.[2]

Batu Caves, Malaysia

Contents

Etymology

The scientific name of the crab-eating macaque is Macaca fascicularis. Macaca comes from the Portuguese word macaco, which was picked up from makaku, a Fiot (West African language) word (kaku means 'monkey' in Fiot). Fascicularis is Latin for 'a small band or stripe'. Sir Thomas Raffles, who gave the animal its scientific name in 1821, did not specify what he meant by the use of this word, although it is presumed it had something to do with his observation of the animal's colour.[3]

This animal has several common names. It is often referred to as the long-tailed macaque because its tail is usually about the same length as its body and because its long tail distinguishes it from most other macaques. The species is also commonly known as the crab-eating macaque because they are often seen foraging beaches for crabs. Another common name for M. fascicularis is the cynomolgus monkey, which literally means "dog-milker" monkey; this is the name most commonly used in laboratory settings. In Indonesia, M. fascicularis and other macaque species are known generically as kera, possibly because of the high-pitched alarm calls they give when in danger ("krra! krra!").

Subspecies

There is significant genetic diversity within the species; it is classified into at least ten subspecies:

Physical characteristics

Depending on subspecies, the body length of the adult monkey is 38-55 centimetres (15–22 in) with comparably short arms and legs. The tail is longer than the body, typically 40–65 cm (16–26 in). Males are considerably larger than females, weighing 5-9 kilograms (11-20 lb) compared to the 3–6 kg (7-13 lb) of female individuals.

Social structure

Macaca fascicularis is a very social animal that lives in groups of 5–60 or more animals. These are multiple-male groups, normally containing two to five males and two to three times as many females. The number of immature is usually comparable to the number of females. Group size often depends on the level of predation and availability of food. Groups are female-centred, as the females are philopatric (i.e. remain in one place across generations), while the males move in and out of these female-based groups. Males generally first emigrate from their natal group at the age of four to six years. They will remain in a group up to four or five years and thus will emigrate several times throughout their lives. These monkeys are highly despotic and have a strict dominance hierarchy. Adult males rank higher than females. Female ranks are more stable than males, as males are defeated from time to time and then lose rank. High-ranked males are generally the most successful at reproduction, and high-ranked females generally fare best at raising surviving offspring. The females are organized into matrilines, which are the female-based families consisting of the related females and their descendents. Matrilines are ranked, and some families have greater social power than others; this difference in rank is maintained over several generations. Matrilineal overthrows rarely occur, and when they do, they have severe consequences to the reproductive success of the defeated matriline in the following year.

Reproduction

After a gestation period of 167–193 days, the female gives birth to one infant. The infant's weight at birth is approximately 350 grams (12 oz). Infants are born with black fur which will begin to turn to a yellow-green, grey-green, or reddish-brown shade (depending on the subspecies) after about three months of age. This natal coat is suggested to indicate to others the status of the infant, and other group members treat infants with care and rush to their defence when distressed. Immigrant males will sometimes kill infants not their own, and high-ranked females sometimes kidnap the infants of lower-rank females. These kidnappings usually result in the death of the infants, as the other female is usually not lactating. Young juveniles stay mainly with the mother and relatives, and as male juveniles get older, they become more peripheral to the group. Here they play together, forming crucial bonds that may help them when they leave their natal group. Males that emigrate with a partner seem to be more successful than those that move off alone. Young females, on the other hand, stay in the centre of the group and become incorporated into the matriline into which they were born.

Male crab-eating macaques will groom females to increase the chance of mating. A female is more likely to engage in sexual activity with a male that has recently groomed her than with one that has not.[4]

Diet

Young macaques are breastfed by their mothers

Crab-eating macaques typically do not consume crabs; rather, they are opportunistic omnivores, eating a variety of animals, plants, and other materials. Although fruits and seeds make up 60 - 90% of the dietary intake, they also eat leaves, flowers, roots and bark. They also prey on vertebrates (including bird chicks, nesting female birds, lizards, frogs and fish), invertebrates and bird eggs. Although the species is ecologically well-adapted in its native range and poses no particular threat to the overall populations of prey species, in areas where the crab-eating macaque is not native, it can pose a substantial threat to biodiversity.

The crab-eating macaque can become a synanthrope, living off human resources. The are known to feed in cultivated fields on such items as young dry rice, cassava leaves, rubber fruit, taro plants, coconuts, mangos and other crops, often causing significant losses to local farmers. In villages, towns, and cities, they frequently take food from garbage cans and refuse piles. The species can become unafraid of humans in these conditions, which can lead to macaques directly taking food from people, both passively and aggressively (9).

In Thailand and Myanmar, long-tailed macaques use stone tools to open nuts, oysters, other bivalves, and various types of sea snails (nerites, muricids, trochids, etc.) along the Andaman sea coast and offshore islands.[5]

Distribution and habitat

The crab-eating macaque is found in a wide variety of habitats, including primary lowland rainforests, disturbed and secondary rainforests, and riverine and coastal forests of nipa palm and mangrove. They also easily adjust to human settlements; they are considered sacred at some Hindu temples and on some small islands, but a pest around farms and villages. Typically, they prefer disturbed habitats and forest periphery. The native range of this species includes most of mainland Southeast Asia, and the Maritime Southeast Asia islands of Sumatra, Java, and Borneo, offshore islands, the islands of the Philippines, and the Nicobar Islands in the Bay of Bengal.

Macaca fascicularis is an introduced alien species in several locations, including Hong Kong, western New Guinea, Anggaur Island in Palau, and Mauritius. Where it is not a native species, particularly on island ecosystems whose species often evolved in isolation from large predators, M. fascicularis is a documented threat to many native species. This fact has led the World Conservation Union (IUCN) to list M. fascicularis as one of the "100 worst invasive alien species".[6] Insofar as it is present as an invasive alien species on several islands, it has been labelled a "weed" species and is yet another significant ecological threat to those ecosystems and the species within them. However, M. fascicularis is not a biodiversity threat in its native range, where other species have adapted to their presence through evolutionary time.

Relationship with humans

As a result of sharing its environment with humans, this macaque had the opportunity to steal an asthma inhaler.

Long-tailed macaques extensively overlap with humans across their range in Southeast Asia. Consequently, people and long-tailed macaques live together in many locations. Some of these areas are associated with religious sites and local customs, such as the temples of Bali in Indonesia, Thailand, and Cambodia, while other areas are characterized by conflict as a result of habitat loss and competition over food and space.[7] Humans and long-tailed macaques have shared environments since prehistoric times, and tend to both frequent forest and river edge habitats (9).

M. fascicularis is also used extensively in medical experiments, in particular those connected with neuroscience and disease. Due to their close physiology, they can share infections with humans. Some cases of concern have been an isolated event of Ebola-Reston virus found in a captive-bred population shipped to the US from the Philipines, which was later found to be a strain of Ebola that has no known pathological consequences in humans, unlike the African strains.[7] Furthermore, they are a known carrier of monkey B virus (Herpesvirus simiae), a virus which has produced disease in some lab workers working mainly with rhesus macaques (M. mulatta).[7] Nafovanny, the largest facility for the captive breeding of nonhuman primates in the world, houses 30,000 macaques[citation needed]. The crab-eating macaque is one of the types of monkeys that have been used as space test flight animals[citation needed]. It has been discovered recently that Plasmodium knowlesi, which causes malaria in M. fascicularis, can also infect humans. A few cases have been documented in human, but for how long humans have been getting infections of this malarial strain is unknown. It is, therefore, not possible to assess if this is a newly emerging health threat, or if just newly discovered due to improved malarial detection techniques.[7] Given the long history of humans and macaques living together in SE Asia, it is likely the latter.

Conservation status

The crab-eating macaque has the third-largest range of any primate species, behind only humans and rhesus macaques. The IUCN Red List categorizes the species as Least Concern, and CITES lists them as Appendix II ("not necessarily threatened with extinction", in which trade must be controlled to avoid use incompatible with their survival). A recent review of their populations suggests there is a need for better monitoring of populations due to increased wild trade and rising levels of human-macaque conflict, which are reducing overall population levels despite the species being widely distributed.[8]

Each subspecies faces differing levels of threats, or simply lacks sufficient information to assess their situation. The umbrosa subspecies is argued to be of important biological significance. It has been recommended as a candidate for protection in the Nicobar islands, where its small, native population has been seriously fragmented,[9] and is listed as vulnerable on the IUCN Red List.[2] The Phillipine long-tailed macaque (M.f. philippensis) is listed as near threatened, and M.f. condorensis is vulnerable.[2] All other subspecies are listed as data deficient and need further study,[2] although recent work is showing M.f aurea and M.f. karimondjawae need increased protection.[10] One concern for conservation is that in areas where M. fascicularis is not native; their populations need to be monitored and managed to reduce impact on native flora/fauna.[11]

See also

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 161–162. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100534. 
  2. ^ a b c d e Ong, P. & Richardson, M. (2008). Macaca fuscicularis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Raffles, Sir TS (1821). "Descriptive Catalugue of a Zoological Collection, made on account of the Honourable East India Company, in the Island of Sumatra and its Vicinity....". Transactions of the Linnean Society. 
  4. ^ Gumert, Michael D. (December 2007). "Payment for sex in a macaque mating market". Animal Behavior 74 (6): 1655–1667. doi:10.1016/j.anbehav.2007.03.009. 
  5. ^ Gumert, MD; Kluck, M., Malaivijitnond, S. (2009). "The physical characteristics and usage patterns of stone axe and pounding hammers used by long-tailed macaques in the Andaman Sea region of Thailand". American Journal of Primatology 71: 594–608. 
  6. ^ "100 of the world's worst invasive alien species" (pdf). Invasive Species Specialist Group/IUCN. Archived from the original on 2007-07-15. http://web.archive.org/web/20070715122022/http://www.iucn.org/places/medoffice/invasive_species/docs/invasive_species_booklet.pdf. Retrieved 2007-10-21. 
  7. ^ a b c d Gumert, MD, Fuentes A, Jones-Engel, L. (2011). Monkeys on the Edge: Ecology and Management of Long-tailed Macaques and their Interface with Humans. Cambridge University Press. 
  8. ^ Eudey, Ardith (2008). "The crab-eating macaque (Macaca fascicularis) widespread and rapidly declining.". Primate conservation 23: 129–132. 
  9. ^ Umapathy, G.; Singh M., Mohnot, S.M. (2003). "Status and Distribution of Macaca fascicularis umbrosa in the Nicobar Islands, India". International Journal of Primatology 24: 281–293. 
  10. ^ Umapathy, G.; Singh M., Mohnot, S.M. (2003). "Status and Distribution of Macaca fascicularis umbrosa in the Nicobar Islands, India". International Journal of Primatology 24: 281–293. 
  11. ^ Umapathy, G.; Singh M., Mohnot, S.M. (2003). "Status and Distribution of Macaca fascicularis umbrosa in the Nicobar Islands, India". International Journal of Primatology 24: 281–293. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!