Overview

Comprehensive Description

Description

The Indo-Pacific bottlenose dolphin has a medium-sized, fusiform body with a short rostrum, although it is comparatively longer and more slender than T. truncatus relative to body size. The dorsal fin is triangular or falcate, and dorsal coloration is dark grey, ventral coloration is very light grey in juvenile animals, developing dark speckling with age. The pectoral fins are also comparatively larger, possibly to allow greater manouverability in a shallow water habitat. Adults are slightly smaller and less robust than their Common bottlenose relatives.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Indo-Pacific Bottlenose Dolphin has a discontinuous distribution in the warm temperate to tropical Indo-Pacific, from South Africa in the west, along the rim of the Indian Ocean (including the Red Sea, Persian Gulf and Indo-Malay Archipelago as far east as the Solomon Islands and possibly New Caledonia) to the southern half of Japan and southeast Australia in the east (Wells and Scott 2002; Möller and Beheregaray 2001). It is also found around oceanic islands distant from major land masses within this range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Cosmopolitan in waters from South Africa and Madagascar north and east along entire rim of Indian Ocean; occurs in Red Sea and Arabian Gulf.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Size

Length 2.6 m, weight 230 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Indo-Pacific bottlenose dolphins generally occur over shallow coastal waters on the continental shelf or around oceanic islands. They sometimes occur in mixed groups with common bottlenose dolphins and other delphinid species. They feed on a wide variety of schooling, demersal and reef fishes, as well as cephalopods (Ross 1984; J.Y. Wang, unpubl. data).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

tropical to temperate, coastal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 120 specimens in 1 taxon.
Water temperature and chemistry ranges based on 72 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 27.353 - 28.694
  Nitrate (umol/L): 0.038 - 0.346
  Salinity (PPS): 33.213 - 34.984
  Oxygen (ml/l): 4.437 - 4.664
  Phosphate (umol/l): 0.097 - 0.169
  Silicate (umol/l): 3.208 - 6.205

Graphical representation

Temperature range (°C): 27.353 - 28.694

Nitrate (umol/L): 0.038 - 0.346

Salinity (PPS): 33.213 - 34.984

Oxygen (ml/l): 4.437 - 4.664

Phosphate (umol/l): 0.097 - 0.169

Silicate (umol/l): 3.208 - 6.205
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Indo-Pacific bottlenose dolphins generally occur over shallow coastal waters on the continental shelf or around oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

This species inhabits inshore coastal waters, usually in groups of 2-15 individuals, although group size can number into the hundreds and may vary due to variation in prey availability and predation risk. They form complex fission-fusion societies and associations between individuals are usually weak, and may be dynamic over a few hours or stable for longer periods of time. They are sometimes seen in mixed groups with other dolphin species.

Bottlenose dolphins feed on a wide variety of schooling, demersal and reef fish as well as cephalopods, particularly squid.

Females typically reach sexual maturity at between 7 and 12 years of age, with peak mating and calving season occurring in spring and summer. Calves are born after a gestation period of about 12 months, and are weaned at between 3 and 8 years of age. Females tend to wean mid-pregnancy, and have an inter-birth interval of about 4 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tursiops aduncus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2453-09|EU557092|Tursiops aduncus| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGGGCAGGGATAGTAGGTACCGGCCTA---AGTTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGTTTTGGGAACTGATTAGTCCCTTTAATA---ATCGGAGCTCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCTTCAATAATTGAAGCCGGCGCAGGTACAGGCTGAACTGTTTACCCTCCTCTAGCCGGAAATCTGGCACATGCAGGAGCCTCGGTAGACCTT---ACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATCATTAATATAAAGCCACCCGCTATAACTCAATACCAAACACCCCTCTTCGTCTGATCAGTCTTAGTCACAGCAGTCTTACTTTTACTATCATTACCTGTTCTAGCAGCC---GGAATTACTATACTACTAACCGATCGAAATCTAAACACAACCTTTTTCGACCCAGCAGGAGGAGGTGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTACCCGGCTTTGGAATAATTTCACACATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCTATAGTTTCTATTGGTTTCCTAGGCTTCATTGTATGAGCTCACCATATGTTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tursiops aduncus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Justification
Although the species is widespread in Indo-pacific coastal waters and its aggregate abundance is probably in the tens of thousands in multiple local populations, habitat destruction and incidental takes (of unknown but possibly large magnitude) may have a significant impact on this species. However, the lack of available information precludes an assessment of this impact.

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Unknown, probably accidental.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Few estimates of abundance have been made. There are estimated to be 520-530 bottlenose dolphins off KwaZulu-Natal, South Africa, most of which are probably T. aduncus (the rest T. truncatus – Cockcroft et al. 1992). Between 136 and 179 (95% Cis = 124-212) are known off Zanzibar, Tanzania (Stensland et al. 2006); at least 1,200 in the Persian Gulf (Preen 2004); at least 400 photo-identified along the rim of the Swatch-of-No-Ground, Bangladesh (Rubaiyat Mansur Mowgli and Brian D. Smith pers. comm.); about 218 off western Kyushu, Japan (Shirakihara et al. 2002); 169 off Mikura Island, Japan (Kogi et al. 2004); low tens at the southern tip of Taiwan and about 50 from the northeastern Philippines (J. Y. Wang pers. comm.); 1,099 off Queensland, eastern Australia (Chilvers and Corkeron 2003) and at least 2,000-3,000 in Shark Bay western Australia (Preen et al. 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species’ near-shore distribution makes it vulnerable to environmental degradation, direct exploitation, and fishery conflicts (Curry and Smith 1997, Wells and Scott 1999; Reeves et al. 2003). Until hunting was outlawed in 1990, this species was hunted in a large-scale drive fishery in Taiwan’s Penghu Islands. Some Indo-Pacific bottlenose dolphins are taken in the small cetacean fisheries of Sri Lanka.

Incidental catches occur in a number of fisheries throughout the range, including gillnets and purse seines. A Taiwanese shark gillnet fishery operated in northern Australian waters during the early 1980s and took up to 2,000 per year (Harwood and Hembree 1987). Incidental catch in Taiwan continues to be a serious problem. For example, multiple individuals have been seen observed in single catches there and throughout most of the species’ range (J.Y. Wang pers. comm.). A large proportion of dolphins (~40%) off Bangladesh exhibit scars and mutilations consistent with rope and net entanglement in trawl and gill-net fisheries (Rubaiyat Mansur Mowgli and Brian D. Smith pers. comm.). In South Africa and Australia, Indo-Pacific Bottlenose dolphins also suffer considerable mortality in the large-mesh nets set to protect bathers from sharks (Peddemors 1999; Reeves et al. 2003).

Live-captures for oceanarium display have taken place in Taiwan, Indonesia and the Solomon Islands in recent years from unassessed populations; their preference as a captive display species makes them vulnerable to depletion from such catches (Wang et al. 1999, Reeves et al. 2003, Kahn ).

Indo-Pacific bottlenose dolphins in coastal areas are exposed to a wide variety of threats in addition to direct and indirect takes. Threats that are cause for concern include: 1) the toxic effects of xenobiotic chemicals; 2) reduced prey availability caused by environmental degradation and overfishing (Jackson et al. 2001); 3) direct and indirect disturbance and harassment (e.g. boat traffic and commercial dolphin watching and interactive programs); 4) marine construction and demolition and 5) other forms of habitat destruction and degradation (including anthropogenic noise). Although these and other threats are technically challenging to quantify by comparison with takes, their cumulative impact is likely to result in longitudinal population declines. Lack of historical data in many cases hampers understanding of long-term trends, possibly resulting in shifting baselines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

More research is needed to establish the range and clarify the taxonomy of the genus Tursiops. More information is also needed on population size and the extent and magnitude of direct and indirect takes so that their impact on this species can be assessed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indo-Pacific bottlenose dolphin

Indo-Pacific bottlenose dolphin!<-- This template has to be "warmed up" before it can be used, for some reason -->

The Indo-Pacific bottlenose dolphin (Tursiops aduncus) is a species of bottlenose dolphin. The Indo-Pacific bottlenose dolphin grows to 2.6 metres (8.5 ft) long, and weigh up to 230 kilograms (510 lb).[3] It lives in the waters around India, northern Australia, South China, the Red Sea, and the eastern coast of Africa.[3] Its back is dark-grey and belly is lighter grey or nearly white with grey spots. [3]

Until 1998, all bottlenose dolphins were considered members of the single species T. truncatus. In that year, the Indo-Pacific bottlenose dolphin was recognized as a separate species.[4][5] The Indo-Pacific bottlenose dolphin is generally smaller than the common bottlenose dolphin, has a proportionately longer rostrum, and has spots on its belly and lower sides.[4][6] The Indo-Pacific bottlenose dolphin also has more teeth than the common bottlenose dolphin — 23 to 29 teeth on each side of each jaw for the Indo-Pacific bottlenose dolphin, compared to 21 to 24 for the common bottlenose dolphin.[6] There is evidence that the Indo-Pacific bottlenose dolphin may actually be more closely related to certain dolphin species in the genera Stenella and Delphinus, especially the Atlantic Spotted Dolphin (S. frontalis), than it is to the common bottlenose dolphin.[4][7]

Much of the old scientific data in the field combine data about the Indo-Pacific bottlenose dolphin and the common bottlenose dolphin into a single group, making it effectively useless in determining the structural differences between the two species. The IUCN lists both species as data deficient in their Red List of endangered species because of this issue.[8]

Contents

Description

Indo-Pacific bottlenose dolphins are very similar to common bottlenose dolphins in appearance. Common bottlenose dolphins have a reasonably strong body, moderate-length beak, and tall curved dorsal fins whereas Indo-Pacific bottlenose dolphins are have a more slender body build and their beak is longer and more slender.[9] The Indo-Pacific population also tends to have a somewhat lighter blue colour and the cape is generally more distinct with a light spinal blaze extending to below the dorsal fin.2 However, although not always present, the most obvious distinction came be made with the presence of black spots or flecks on the bellies of adults of Indo-Pacific bottlenose dolphins which are very rare in common bottlenose dolphins.[9] Their teeth can number between 23 and 29 in each upper and lower jaw and are more slender than those of common bottlenose dolphins.[9] Size of Indo-Pacific bottlenose dolphins can vary based on geographic location however its average length is 2.6 metres (8.5 ft) long, and it weighs up to 230 kilograms (510 lb).[3] Their length at birth is between 0.84 and 1.5 metres (2.8 and 4.9 ft).[3]

Diet

Indo-Pacific bottlenose dolphins feed on a wide variety of fish and cephalopods (particularly squid).[10]

In a recent study conducted by Amir et al. (2005)[10] researchers looked at the feeding ecology of Indo-Pacific bottlenose dolphins by analyzing the stomach contents of ones that got caught in the gillnet fisheries off Zanibar, Tanzania. The prey items found in the stomach contents included 50 species of bony fish and 3 species of squid. From their results the researchers concluded that the most important prey group was fish which accounted for 87% of the total number of prey items consumed and occurred in 24 of 26 stomachs examined. Cephalopods comprised the other 13% of prey items and were found in 13 of the 26 stomachs.[10] The remains of some crustaceans were also found however they hypothesize that they were consumed secondarily since a number were found intact in the fish prey stomachs and therefore were not included in the diet analysis.[10]

Behavior

Indo-Pacific bottlenose dolphins live in groups that can number in the hundreds, but groups of 5 to 15 dolphins are most common.[6] In some parts of their range they associate with the common bottlenose dolphin.[6] It also associates with other dolphin species, such as the humpback dolphin.[6]

The Indo-Pacific bottlenose dolphin has a peak mating and calving season in spring and summer, although mating and calving occur throughout the year in some regions. Gestation period is about 12 months. Calves are between 0.84 and 1.5 metres (2.8 and 4.9 ft) long, and weigh between 9 and 21 kilograms (20 and 46 lb). The calves are weaned between 1.5 and 2 years, but can remain with their mother for up to 5 years. The interbirth interval for females is typically 4 to 6 years.[3]

In some parts of its range, the Indo-Pacific bottlenose dolphin is subject to predation by sharks.[6] The Indo-Pacific bottlenose dolphin can live more than 40 years.[3]

Indo-Pacific bottlenose dolphins located in Shark Bay, Australia are thought to have a symbiotic relationship with sponges by doing what is called “sponging”. What happens is a dolphin breaks a marine sponge off the sea floor and wears it over its rostrum. It is thought that the reason they do this is to probe substrates for fish however it is still not completely understood if it is used for a tool or simply for play.

Status and threats

Indo-Pacific bottlenose dolphins are not considered to be endangered as a species however, it has a near-shore distribution which makes it vulnerable to environmental degradation, direct exploitation, and problems associated with local fisheries.[11]

The major predators of this species are typically sharks however some others may include humans, killer whales (Orcinus orca) and sting rays. Just recently large numbers of these dolphins were deliberately killed in a Taiwanese drive fishery which greatly impacted the species.[citation needed] It is now prohibited. However, gillnets are still having an impact and are a problem not only here but throughout most of the species’ range. In the early 1980s many were killed in a Taiwanese driftnet fishery in the Arafura Sea, off northwestern Australia.[12] Large-mesh nets set to protect bathers from sharks in South Africa and Australia has also resulted in a substantial number of deaths in the Indo-Pacific bottlenose dolphins.[13]

Captivity

Indo-Pacific dolphins are one of many small cetaceans commonly found in captivity.[10] Some of the conservation concerns for animals in captivity include: the effects of removing the animals from their wild populations, survivorship of cetaceans during capture and transport and while in captivity and the risks to wild populations and ecosystems of accidentally introducing alien species and spreading epizootic diseases, especially when animals have been transported over long distances and are held in sea pens.[14]

Bottlenose dolphins are the most common captive cetaceans on a global scale.[14] Prior to 1980 more than 1,500 bottlenose dolphins were collected from the United States, Mexico, and the Bahamas and more than 550 common and 60 Indo-Pacific bottlenose dolphins were brought into captivity in Japan.[14] By the late 1980s, the United States stopped collecting bottlenose dolphins and the number of captive-born animals in North American aquariums has increased from only 6 percent in 1976 to about 44 percent in 1996.

Effects of whale watching

Not much is known about the impact of whale watching on cetaceans but research is being conducted at several locations.

Japan

Morisaka et al. (2005)[15] conducted a study on three populations of Indo-Pacific bottlenose dolphins in Japan. It is believed that characteristics of acoustic signals are affected by the acoustic environments among habitats and geographical variation in animal acoustic signals can result from differences in acoustic environments therefore the characteristics of the ambient noise in the dolphin's habitats and the whistles produced were compared. Ambient noise was recorded using a hydrophone located 10m below the surface and whistles were recorded by using an underwater video system.

Results showed that dolphins produced whistles at varying frequencies with greater modulations when in habitats with less ambient noise whereas habitats with greater ambient noise seem to cause dolphins to produce whistles of lower frequencies and fewer frequency modulations. Examination of the results suggest that communication signals are adaptive and are selected to avoid the masking of signals and the decrease of higher-frequency signals as Tadamichi et al. states in the paper. They concluded that ambient noise has the potential to drive the variation in whistles of Indo-Pacific bottlenose dolphin populations.

Jervis Bay, Australia

Small motorized vessels have increased as a source of anthropogenic noise due to the rise in popularity of wildlife viewing such as whale-watching. Lemon et al. (2006)[16] carried out a study in Australia on bottlenose dolphins to look at whether powerboats are in fact a significant source of disturbance for these animals. The surface behaviour and acoustic response of traveling dolphins to approaches by a powerboat were assessed by a series of experimental trials. Dolphin behaviour was monitored continuously from an independent research boat before, during, and after a powerboat approached. Once a group of traveling dolphins was located, the group was randomly assigned to either a control or treatment condition. During each experimental trial the dolphin's acoustic and surface behaviour were recorded "pre-exposure" with the powerboat stationary and engine off, "on-approach" with the powerboat approaching the focal group, "exposure" with the power boat moving slowly alongside the group, and "post-exposure" when the powerboat had departed from the area. For the control trials the surface and acoustic behaviours were recorded from the research vessel where only the electric motor was used.

Results of the study showed that powerboat approaches altered the surface behaviour and direction of traveling dolphins when exposed to vessels within 100m. Their whistles and echolocation click bouts however, were not affected when approached. When powerboats approached the dolphins they changed their surface behaviour from traveling to milling and changed their direction to travel away from the powerboat. It was not until the powerboat left the area and its noise ceased that the dolphins returned to their preceding behaviour in the original direction.

Shark Bay, Australia

Another study was carried out by Bejder et al. (2006)[17] in Shark Bay, Western Australia on the behavioural responses of Indo-Pacific bottlenose dolphins to experimental vessel approaches in regions of both high and low vessel traffic. Data was collected from two different sites that had different histories of vessel activity: high vessel activity classified as the impact site and low vessel activity classified as the control site. A team of researchers evaluated group-level, non-vocal, behavioural responses of dolphins 15 minutes before, during and after approaches by an experimental vessel. For each experiment observers selected a focal dolphin group based on the group's proximity to the shore station and the absence of any vessels within 300m. After the focal group was selected, observers on the shore recorded behavioural data for 15 minutes. Then vessel-based observers were directed towards the focal group and collected data once within 50m of the group. Throughout the 15 minute period, shore observers continued to record behavioural data while the vessel maintained a distance of 10-50m from the focal group. Observers aboard the experimental vessel identified individual dolphins in the focal group taking dorsal fin photographs. When the experimental vessel was beyond 300m of the focal group, the shore team continued to monitor the behaviour and movements of the focal group for another 15min. Tour vessel movements were also tracked using GPS to show focal group movements during the experiment.

Results show that there were significant changes in the behaviour of targeted dolphins when compared with their behaviour before and after approaches. Dolphins in the control site showed a stronger and longer-lasting response than dolphins in the impact site. It is believed that these results show habituation of the dolphins to the vessels in a region of long-term vessel traffic. However, when compared to other studies in the same area, it is suggested that this study documented moderated responses not because of habituation occurring but because those individuals sensitive to vessel disturbance left the region before their study began.

Although these studies do show statistical significance for the effects of whale-watching boats,these results do not have biological significance and need to be researched further.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300098. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Tursiops aduncus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b c d e f g Shirihai, H. and Jarrett, B. (2006). Whales Dolphins and Other Marine Mammals of the World. p. 159–161. ISBN 0-691-12757-3. 
  4. ^ a b c Wells, R. and Scott, M. (2002). "Bottlenose Dolphins". In Perrin, W.; Wursig, B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 122–127. ISBN 0-12-551340-2. 
  5. ^ Möller Luciana M., Beheregaray Luciano B. 2001. Coastal bottlenose dolphins from southeastern Australia are Tursiops aduncus according to sequences of the mitochondrial DNA control region. Marine Mammal Science 17(2): 249-263.
  6. ^ a b c d e f Reeves, R.; Stewart, B.; Clapham, P.; Powell, J. (2002). Guide to Marine Mammals of the World. p. 362–365. ISBN 0-375-41141-0. 
  7. ^ Leduc, R., Perrin, W. & Dizon, E. (August 18, 1998). "Phylogenetic Relationships among the Delphinid Cetaceans Based on Full Cytochrome B Sequences". Marine Mammal Science 15 (3): 619–648. doi:10.1111/j.1748-7692.1999.tb00833.x. http://www3.interscience.wiley.com/journal/119937779/abstract. Retrieved 2008-10-05. 
  8. ^ "Tursiops truncatus: Species Information". IUCN. http://www.iucnredlist.org/search/details.php?species=22563. Retrieved 2006-11-03. 
  9. ^ a b c Worlds Creatures. 2004. Indo-Pacific bottlenose dolphin. Retrieved March 28, 2008 from the website: http://www.worldscreatures.com/water-species/dolphins/indo-pacific-bottlenose-dolphin.htm.
  10. ^ a b c d e Amir Omar A., Per Berggren, Simon Ndaro G.M., Narriman Jiddawi S. 2005. Feeding ecology of the Indo-Pacific bottlenose dolphin (Tursiops aduncus) incidentally caught in the gillnets fisheries off Zanzibar, Tanzania. Estuarine, Coastal and Shelf Science 63(3): 429-437.
  11. ^ Curry, B.E. and Smith, J. 1997. Phylogeographic structure of the bottlenose dolphin (Tursiops truncatus): stock identification and implications for management. In: A.E. Dizon, S.J. Chivers, and W.F. Perrin (eds) Molecular Genetics of Marine Mammals, pp. 227-247. Society for Marine Mammalogy, Special Publication No. 3, Allen Press, Lawrence, Kansas.
  12. ^ Harwood, M.B. and Hembree, D. 1987. Incidental catch of small cetaceans in the offshore gillnet fishery in northern Australian waters: 1981-1985. Report of the International Whaling Commission 37: 363-367.
  13. ^ Peddemors, V.M. 1999. Delphinids of southern Africa: a review of their distribution, status and life history. Journal of Cetacean Research and Management 1: 157-165.
  14. ^ a b c Fisher Sue J., Reeves Randall R. 2005. The Global Trade in Live Cetaceans: Implications for Conservation. Journal of International Wildlife Law and Policy 8: 315-340
  15. ^ Morisaka Tadamichi, Shinohara Masanori, Nakahara Fumio, Akamatsu Tomonari. 2005. Effects of Ambient Noise on the Whistles of Indo-Pacific Bottlenose Dolphin Populations. Journal of Mammalogy 84(3): 541-546.
  16. ^ Lemon Michelle, Lynch Tim P., Cato Douglas H., Harcourt Robert G. 2006. Response of traveling bottlenose dolphins (Tursiops aduncus) to experimental approaches by a powerboat in Jervis Bay, New South Wales, Australia. Biological Conservation 127:363-372
  17. ^ Bejder Lars, Samuels Amy, Whitehead Hal, Gales Nick. 2006. Interpreting short-term behavioural responses to disturbance within a longitudinal perspective. Animal Behaviour 72: 1149-1158

Further reading

Cockcroft VG, Ross GJB. 1990. Age, growth, and reproduction of bottlenose dolphins Tursiops truncatus from the east coast of southern Africa. Fishery Bulletin 88(2): 289-302.

Moller Luciana M., Beheregaray Luciano B., Allen Simon J., Harcourt Robert G. 2006. Association patterns and kinship in female Indo-Pacific bottlenose dolphins (Tursiops aduncus) of southeastern Australia. Behavioural Ecology Sociobiology 61: 109-117.

Nowacek Stephanie M., Wells Randall S., Solow Andrew R. 2001. Short-term effects of boat traffic on bottlenose dolphins, Tursiops truncatus, in Sarasota Bay, Florida. Marine Mammal Science 17(4): 673-688.

Schroeder, J. Pete. Breeding Bottlenose Dolphins in Captivity. In The Bottlenose Dolphin, edited by Stephen Leatherwood and Randall R. Reeves, pp. 435-446. San Diego: Academic Press, Inc., 1990.

Shane Susan H., Wells Randall S., Wursig Bernd. 1986. Ecology, behaviour and social organization of the bottlenose dolphin: a review. Marine Mammal Science 2(1): 34-63.

Urian, K.W., Duffield D.A., Read A.J., Wells R.S., Shell E.D. 1996. Seasonality of Reproduction in Bottlenose Dolphins, Tursiops truncatus. Journal of Mammalogy, 77(2): 394-403.

Wells, Randall S., Scott Michael D., Irvine Blair A. The Social Structure of Free-ranging Bottlenose Dolphins. In Current Mammalogy, Volume 1, edited by H.H. Genoways, pp. 247- 305. New York: Plenum Press, 1987.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!