Overview

Distribution

Range Description

There are four recognized subspecies:

Saimiri sciureus sciureus is a wide-ranging subspecies in the north-eastern and eastern Amazon. Distribution, according to Hershkovitz (1984), extends through the Guianas, Amapá and the Brazilian Amazon east of the Rios Deminí and Negro north of the Rio Amazonas, and east of the Rio Xingú south of the Rio Amazonas, Guyana. Silva Jr. (unpublished) places it east of the rios Tapajós and Juruena to extending east to upper reaches of the Rio Teles Pires, a little north and then east, south of the Serra od Cahimobo, across the middle Xingu, the Araguaia and Tocantins to the Rio Parnaiba valley in Maranhão. Hershkovitz (1984) placed its eastern limit as the Rio Pindaré in Maranhão. It also occupies a small area south of the Rio Solimões between the Rio Madeira and the Tapajós on the Ilha Tupinambarama, east to Parintins. Saimiri s. sciureus has not been recorded above 100 m above sea level.

The range of Saimiri sciureus albigena according to Hershkovitz (1984) is gallery forests of the Colombian llanos (Llanos Orientales) from the eastern slope of the Cordillera Oriental in the Departments of Arauca, Casanare and Guaviare, and the departments of Boyacá, Cundinamarca, and Meta to unknown limits eastward. It also occurs in the upper Río Magdalena, but how far it extends north in the Magdalena valley is not known (Hernández-Camacho and Cooper 1976; Defler 2003; 2004). Altitudinal range between 150 and 600 m or higher, possibly to 1,000 m.

The range of Saimiri sciureus cassiquiarensis according to Hershkovitz (1984) is the upper Amazon and Orinocean regions, in Brazil the state of Amazonas from north of the Rio Solimões and west of the Rios Demini and Negro into the Orinoco-Cassiquiare basin in Venezuela, form there west into eastern Colombia between the Ríos Apaporis and Inírida in the Departments of Vaupés, Guaviare and Guiania (Hernández-Camacho and Cooper 1976; Defler 2003; 2004). Occurrence in Venezuela was mapped by Bodini and Pérez-Hernández (1987) and Linares (1998).

Saimiri sciureus macrodon, according to Hershkovitz (1984), ranges in upper Amazon, in Brazil in the state of Amazonas between the Rios Juruá and Japurá, westward; in Colombia from the Rio Apaporis south into eastern Ecuador, throughout the Ecuadorian Amazon east pf the Andes to asltitidues of 1,200 m (Tirira 2007), and into Peru in the departments of San Martín and in Loreto, to the north bank of the Río Marañon-Amazonas. Hershkovitz (1984) indicated that the portion of the range between the Ríos Ucayali and Tapiche is occupied by both S. s. macrodon and S. boliviensis peruviensis (see also Aquino and Encarnación 1994). In Peru, it extends south as far as the ríos Amazonas and Marañón and west of the Huallaga to the Andes, south to a little beyond 8ºS. It extends south of the Rio Amazonas east of the Río Ucayali from the Rio Blanco, where it is sympatric with Saimiri boliviensis peruviensis (Aquino and Encarnación 1994). East of the Ucayali it ranges south to the west of the Serra do Divisor, but not known to reach the Río Tamaya.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Squirrel monkeys live in the tropical rainforests of South America, except in the southeastern coastal forests of Brazil.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Squirrel monkeys are up to 12.5 inches long (body length), with a tail of approximately 16 inches. They have a slender, lithe build, with a short greyish coat and bright yellow legs. Their non-prehensile tail often curls over one shoulder when they are resting. They have 36 teeth, and their teeth are sexually dimorphic in that males have large upper canines.

Squirrel monkesy possess nails instead of claws, and they have been called 'small, nervous primates'. They are the smallest of the Primate family Cebidae.

Average mass: 925 g.

Average basal metabolic rate: 4.429 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Saimiri sciureus typically prefers seasonally inundated forests, river edge forest, floodplain, and secondary forests. Can also be found in gallery forest, low forests of sclerophytic vegetation, forested slopes, and palm forests (particularly associations of Mauritia flexuosa). They use all levels of the forest, but forage and travel mainly in the lower canopy and understorey. Locomotion involves predominantly quadupredal walking and running.

Squirrel monkeys are small frugivore-insectivores. They spend 75-80% of their day foraging for insects and other small animal prey (Mittermeier and Van Roosmalen 1981; Terborgh 1983; Boinski 1988). During dry season shortages of appropriate fruiting trees they are able to depend entirely on animal prey (Janson and Boinski 1992).

Saimiri groups are multi-male and can be large, up to 100 animals (larger groups are believed to be temporary mergers of two) but most frequently are of 20-75 individuals (Baldwin and Baldwin 1981; Terborgh 1983; Mitchell et al. 1991). As emphasized by Boinski (1999a,b; 2005; Boinski et al. 2005a,b), allthough all squirrel monkeys are morphologicallly very similar, their social systems are quite distinct (summarized in Sussman 2000).

In S. sciureus, studied in Suriname by Boinski (1999a,b, 2005; Boinski et al. 2005a,b), group sizes range from 15 to 50, and both sexes form a single, linear hiearchy in the group, with most males being dominant to females. Aggression between females is uncommon, but they do not form coalitions. Males form coalitions and can aggressive to each other. Males show vigilance in defense agianst predators. The fruits they exploit typically occur in small but extremely dense patches, and there is considerable feeding competition between group members, much higher than in S. boliviensis.

Mating and births in Saimiri are highly seasonal, seldom exceeding two months in duration. Single offspring. Mating usually occurs during the dry season. In S. sciureus, birth synchrony is less pronounced and births occur only once every two years.

Saimiri boliviensis and S. sciureus frequently form interspecific associations, travelling with Cebus albifrons or Cebus apella (Terborgh 1983; Wallace et al. 2000), benefitting from the disturbance casued by the capuchin monkeys above them which flushes out insects.

Size:
Weight: Adult male 740 g, adult female more than 635 g (Jack 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Squirrel monkeys prefer primary and secondary forest, gallery forest and forest edge.

They prefer the intermediate forest levels, but they can sometimes be found on the ground or in upper canopy levels.

They occupy many different types of forests.

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Squirrel monkeys eat mainly fruit and some insects; they also consume some leaves and seeds. The first hour or so of the day is spent searching and collecting fruit. From then on, they look also for spiders and insects. A group spreads throughout the forest in all canopy levels to search for food.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
21.0 years.

Average lifespan

Sex: female

Status: captivity:
27.0 years.

Average lifespan

Sex: male

Status: captivity:
22.7 years.

Average lifespan

Status: captivity:
21.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.2 years (captivity) Observations: One hybrid between a common and a Bolivian squirrel monkey lived 32 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Within their own group, squirrel monkeys are promiscuous.

Mating System: polygynandrous (promiscuous)

Squirrel monkeys are seasonal breeders. They mate between September and November, with birth between February and April. Gestation lasts 160-170 days. The birth season is short and occurs during the time of greatest rainfall, perhaps because the wet season brings an abundance of food and water.

Males are mature at 4 years of age; females are mature at 2.5 years of age.

Breeding season: Squirrel monkeys mate between September and November

Range gestation period: 160 to 170 days.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 107 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1826 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1003 days.

Female squirrel monkeys nurse and care for their infants until they are independent. The fathers take no part in raising young.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saimiri sciureus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2543-09|AB371091|Saimiri sciureus| AGCCGCTGACTATTCTCAACTAATCACAAAGATATTGGAACCTTATATTTATTATTTGGTGCGTGAGCTGGAGCAGTAGGAACTGCCCTG---AGCCTCCTAATTCGTGCAGAGCTAGGTCAACCAGGGAGTCTCATAGAAGAC---GATCACATTTTCAACGTTATTGTCACCGCCCATGCATTCATTATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGTTTTGGAAACTGACTCATCCCGCTAATA---ATTGGTGCTCCCGACATAGCATTTCCTCGAATAAATAACATAAGTTTCTGACTCCTACCCCCATCACTCCTTCTCTTACTCGCATCCTCAACTCTAGAAGCTGGCGCAGGGACTGGGTGAACTGTCTATCCCCCTCTAGCAGGGAATATATCACACCCAGGGCCCTCCGTGGACCTC---ACTATCTTTTCACTCCACCTAGCCGGTATTTCCTCTATTCTAGGGGCAATTAATTTTATTACAACAATTATTAATATAAAACCACCAGCGATGAGTCAATATCAGACACCCCTATTTGTCTGATCTGTATTCATTACAGCAGTCCTCCTACTCCTCTCACTCCCAGTCCTAGCTGCC---GGAATCACAATACTCCTAACTGATCGCAATCTTAACACCTCCTTCTTCGACCCAGCTGGGGGAGGCGACCCTATTCTTTACCAACATTTATTCTGATTTTTTGGACATCCTGAAGTATACATCCTCATCCTTCCTGGCTTTGGCATGATCTCTCACATTGTTACATACTACTCCAACAAAAAA---GAACCATTCGGATATATGGGGATAGTATGAGCTATAATATCCATCGGCTTTTTAGGCTTTATCGTATGGGCTCACCACATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Saimiri sciureus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Boubli, J.-P., Rylands, A.B., de la Torre, S. & Stevenson, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern, given its relatively wide range, adaptability to some degree of disturbed forest, and apparent lack of major threats. Additionally, given its small size, it is not generally hunted. However, populations undoubtedly are declining in some areas due to forest destruction and fragmentation.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Currently, captive squirrel monkey populations are maintained in research labs.

Threats to wild squirrel monkeys include eagles in the trees and snakes on the ground.

Squirrel monkeys are easily kept in captivity, and they were once frequently sold as pets.

Habitat destruction, illegal hunting, and capture for the pet trade or medical research all pose threats and problems to the squirrel monkeys.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Recorded population densities for S. s. macrodon include:

Klein and Klein (1975) recorded a density of 50-80 individuals/km² at La Macarena, Colombia;
Peres (1997) estimated population densities at the following várzea (white-water flooded forest) sites: Nova Empresa 73.8 individuals/km²; Barro Vermelho II 109.5 individuals/km²; Lago da Fortuna 189.8 individuals/km². They are more scarce in terra firma forests: Sobral 5.9 individuals/km²; Condor 36.1 individuals/km²; Barro Vermelho I 16.7 individuals/km²; Fortuna 23.2 individuals/km²; Vira Volta 17.7 individuals/km²; Riozinho 36.4 individuals/km².

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Saimiri sciureus is wide-ranging throughout the northern Amazon. The species occupies secondary forest and is often found close to human settlements. Although they are not commonly hunted because of their small size, in some parts of their range, such as Colombia and Ecuador, they are commonly trapped for the pet market (Defler 2003, 2004; S. de la Torre pers. comm.).

In Colombia, Saimiri sciureus albigena occurs in a region subject to high rates of deforestation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II. It occurs, or may occur, in a number of protected areas:

Saimiri sciureus sciureus

Brazil
Tumucumaque National Park (3,882,376 ha)
Cabo Orange National Park (630,017 ha)
Gurupí Biological Reserve (272,379 ha)
Lago Piratuba Biological Reserve (394,223 ha)
Rio Trombetas Biological Reserve (409,578 ha)
Uatumã Biological Reserve (942,786 ha)
Jari Ecolopical Station (207,370 ha)
Terra do Meio Ecological Station (3,373,111 ha)
Niquia Ecological Station (282,803 ha)

French Guiana
Parc amazonien de Guyane (3,300,000 ha)
Nouragues Natural Reserve (100,000 ha) (Kessler 1998)

Guyana
Kaieteur Narional Park

Suriname
Brinckheuvel Nature Reserve (6,000 ha) (probable: Mittermeier and van Roosmalen 1982)
Central Suriname Nature Reserve (1,600,000 ha) (Mittermeier and van Roosmalen 1982)
Coppename Monding Nature Reserve (12,000 ha) (unconfirmed (Mittermeier and van Roosmalen 1982)
Sipaliwini Nature Reserve (100,000 ha) (Mittermeier and van Roosmalen 1982)
Brownsberg Nature Park (8,400 ha) (Mittermeier and van Roosmalen 1982)

Saimiri sciureus albigena

Colombia
Cordillera de los Picachos Natural National Park (286,600 ha) (in range)
El Cocuy Natural National Park (306,000 ha) (in range?)
Serranía de la Macarena Natural National Park (630,000 ha) (in range) (or cassiquiarensis?)
Tinigua Natural National Park (201,875 ha) (in range)? (or cassiquiarensis?)

Saimiri sciureus cassiquiarensis

Brazil
Pico da Neblina National Park (2,298,154 ha)
Jau National Park (2,378,410 ha)
Juamí Japurá Ecological Station (832,078 ha)

Colombia
Nukak Natural National Reserve (855,000 ha) (in range)
Puinawai Natural National Reserve (1,092,500 ha) (in range)

Saimiri sciureus macrodon

Colombia
Amacayacu Natural National Park (293,000 ha) (in range)
Cahuinarí Natural National Park (575,500 ha) (in range)
Serrania de Chiribiquete Natural National Park (1,280,000 ha) (in range)
Cueva de los Guacharos Natural National Park (9,000 ha) (in range)
La Paya Natural National Park (442,000 ha (in range, Polanco-Ochoa et al. 1999)

Ecuador
Yasuní National Park (Tirira 2007)
Cayambe-Coca Ecological Reserve (Tirira 2007)
Cofán-Bermejo Ecological Reserve (Tirira (2007)
Cuyabeno Faunal Protection Reserve (Tirira 2007)

Peru
Tamshiyacu-Tahuayo Communal Reserve (Aquino and Encanrfación 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Used as pets and in research.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common squirrel monkey

The common squirrel monkey (Saimiri sciureus) is a small New World primate from the Cebidae (squirrel monkey) family, and native to the tropical areas of South America.

Contents

Location

The common squirrel monkey can be found primarily in the Amazon Basin, including territories in the countries of Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Peru, Suriname, Paraguay and Venezuela; a small population has been introduced to Southern Florida and many of the Caribbean Islands. A group of free-ranging individuals was spotted and photographed in 2009 at the Tijuca Forest in Rio de Janeiro - possibly the result of an illegal release or of an escape from the pet trade;[2] by 2010, the Squirrel Monkey had begun to be considered as an invasive species in the Brazilian Atlantic rainforest, and there were concerns about its role as a predator of eggs of endangered bird species.[3] The common squirrel monkey prefers to live in the middle canopy, but will occasionally come to the ground or go up into the high canopy. They like vegetation which provides good cover from birds of prey in the rainforest, savannah, mangroves, or marshlands.

Biology and behavior

Diet

The common squirrel monkey is considered both frugivorous and insectivorous, preferring berry-like fruit on branches. It also looks for insects, and small vertebrates, such as tree frogs. It obtains a majority of water from the foods eaten, and will also obtain water from holes in trees and puddles on the ground. When fruit is scarce, the common squirrel monkey will drink nectar.

Social behavior

The common squirrel monkey is polygynous with a multi-male, multi-female group structure.[4] Most social interactions in S. sciureus groups occur within the various age/sex classes,[5] with the division of classes being between adult male categories, mother-infant categories, and juvenile categories.[4] The core of the group is made up of the adult females and their young.[6] As a result of the natural attraction each class has to the adult females, the different age/sex classes come together as one social group.[5] Even though juveniles play and jump around an appreciable amount during phases of high activity, they usually stay close to the adult females.[5] In terms of the males’ level of attraction to the adult females, the phase of the yearly reproductive cycle is what determines their distance from the adult females.[5] Overall, interactions between the various age/sex classes are most frequently directed to adult females.[5] It is important to note that the division of age/sex classes among S. sciureus is not so strictly defined because the degree of segregation between sexes can vary. That is, those subspecies which have a high degree of sexual dimorphism are sexually segregated, such that the males and females of that subspecies interact less with each other than do those of subspecies that are not very sexually dimorphic and thus sexually integrated.[7]

The fact that reproduction is seasonal[4] plays a major role in the social behavior of S. sciureus, where the frequency of between-sex interactions of the males and females differs between the birth season and the mating season.[8] Adult males are generally socially inactive during the birth season and spend their time travelling and foraging at a distance from the group.[8] On the contrary, during the mating season the adult males become fatter, excited, aggressive, and highly vocal and spend most of their time engaging in dominance interactions among themselves or following and approaching the adult females in estrus, in hopes of being able to mate with them.[5] Males can increase their chances at copulating with receptive females by approaching them quietly.[5] Nonreceptive females, on the other hand, respond aggressively to any male approach and will threaten and chase the males away, usually with the help of surrounding females.[5] Overall, intersexual interaction among S. sciureus greatly increases during the mating season.[9]

Saimiri sciureus infants develop rapidly. They become fairly independent between five to eight months of age and spend only a small percentage of the day with their mothers. Also at this range of age, the infants can find food on their own.[8] The infants are active members of the social group, climbing, running, exploring, and frequently making contact with adult members of the group.[8] Most adult-infant interactions are initiated by infants towards adult females who are not their mothers.[8] Adults generally respond to the infants calmly, but some adults may respond with antagonism.[8] Infants rank the lowest in the group.[10]

Many other aspects of S. sciureus social behavior, such as dominance relationships, coalitions, dispersal patterns, and aggression, stem from the feeding ecology of the animals.[10] Feeding ecology directly affects the females of the group which in turn affects the behavior of the males in the group.[11] The feeding patches for S. sciureus are very small and dense, which makes it possible for an individual with the greatest capability of winning a fight, if one were to occur, to monopolize access to any patch.[10] It should also be noted that within group competition among S. sciureus groups is extremely high, and between-group competition is moderate to high.[10] Coalition formation is not as stable as would be expected among the females of the group because considering their small and dense feeding patches S. sciureus females with the greatest capability of winning a fight would benefit more if they were to form alliances to gain control of a patch and then not share the patch once in control of it.[10] All males emigrate from their natal group and some females may as well, although the females are more often philopatric.[10] Males are typically dominant to females, but females still have a high status in the group[4] and are capable of forming coalitions against dominant males.[12] Genital display among males is an important social signal in relation to group hierarchy; it is derived from sexual behavior but is used for social communication.[13] It involves the animal spreading his thighs and having an erect penis.[13] Dominant males display to submissive males to emphasize their higher status.[6] The dominant males direct their action to the face of the passive males and the act can be done with the displayer leaning over the passive monkey or the displayer doing the action from a distance in a more upright position.[13] This form of dominance interaction increases during the mating season when males want to emphasize their rank and strength and gain more control over other males in relation to access to females.[5] Genital displays may also define male-male alliances when the males participate in “joint genital displays”.[4]

Habits

The common squirrel monkey is diurnal. It is usually quiet but will utter loud cries when alarmed. It is arboreal but sometimes it will come down to the ground. Bands or troops can be from 12-100. Occasionally troops as large as 500 have been seen in undisturbed forests.

Status

The common squirrel monkey is rated as "least concern" by IUCN from a conservation perspective.[1] However, the common squirrel monkey is among many rainforest animals whose status may be harmed by deforestation. The species has also been captured extensively for the pet trade and for medical research.

Subspecies

There are four subspecies of Saimiri sciureus:

Saimiri sciureus", Animal Diversity Web.

Gallery

References

  1. ^ a b Boubli, J.-P., Rylands, A. B., de la Torre, S. & Stevenson, P. (2008). "Saimiri sciureus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41537. Retrieved 19 January 2012. 
  2. ^ O Globo, 4th May 2009, Ancelmo Gois column
  3. ^ O Globo, May the 25th. 2010; available at
  4. ^ a b c d e Mitchell C.L. (1994). "Migration alliances and coalitions among adult male South American squirrel monkeys (Saimiri sciureus)". Behaviour 130 (3-4): 169–190. doi:10.1163/156853994X00514. 
  5. ^ a b c d e f g h i Baldwin J.D. (1968). "The social behavior of adult male squirrel monkeys (Saimiri sciureus) in a semi-natural environment". Folia Primatologica 9: 281–314. doi:10.1159/000155184. PMID 4975594. 
  6. ^ a b Anschel S., Talmage-Riggs G. (1973). "Homosexual behavior and dominance hierarchy in a group of captive female squirrel monkeys (Saimiri sciureus)". Folia Primatologica 19 (3): 61–72. doi:10.1159/000155519. PMID 4198058. 
  7. ^ Levine S., Lowe E.L., Mendoza S.P. (1978). "Social organization and social behavior in two subspecies of squirrel monkey (Saimiri sciureus)". Folia Primatologica 30: 126–144. 
  8. ^ a b c d e f Aruguete M.S., Mason W.A. (1996). "Effect of infants on adult social relations in the squirrel monkey (Saimiri sciureus)". Psychological Reports 79 (2): 603–611. PMID 8909087. 
  9. ^ Anderson C.O., Mason W.A. (1977). "Hormones and social behavior of squirrel monkeys (Saimiri sciureus): effects of endocrine status of females on behavior within heterosexual pairs". Hormones and Behavior 8 (1): 100–106. doi:10.1016/0018-506X(77)90025-3. PMID 405304. 
  10. ^ a b c d e f Boinski S., Cropp S., Henry M., Quatrone R., Selvaggi L., Sughrue K. (2002). "An expanded test of the ecological model of primate social evolution: Competitive regimes and female bonding in three species of squirrel monkeys (Saimiri oerstedii, S. boliviensis, and S. sciureus)". Behaviour 139: 227–261. doi:10.1163/156853902760102663. 
  11. ^ Boinski S., Mitchel C.L., van Schaik C.P. (1991). "Competitive regimes and female bonding in two species of squirrel monkeys (Saimiri oerstedi and S. sciureus)". Behavior Ecology and Sociobiology 28: 55–60. 
  12. ^ Clark D.L, Stevens J.J, Wooley M.J. (1978). "Squirrel monkey dominance and social behavior as related to group size and group structure". Primates 19 (1): 169–177. doi:10.1007/BF02373233. 
  13. ^ a b c Blitz J., Ploog D.W., Ploog F. (1963). "Studies on the social and sexual behavior of the squirrel monkey (Saimiri sciureus)". Folia Primatologica 1: 29–66. doi:10.1159/000164879. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!