Overview

Brief Summary

Where Lived: Evolved in Africa, now worldwide

When Lived: About 200,000 years ago to present

The species that you and all other living human beings on this planet belong to is Homo sapiens. During a time of dramatic climate change 200,000 years ago, Homo sapiens (modern humans) evolved in Africa. Like other early humans that were living at this time, they gathered and hunted food, and evolved behaviors that helped them respond to the challenges of survival in unstable environments.

Anatomically, modern humans can generally be characterized by the lighter build of their skeletons compared to earlier humans. Modern humans have very large brains, which vary in size from population to population and between males and females, but the average size is approximately 1300 cubic centimeters. Housing this big brain involved the reorganization of the skull into what is thought of as "modern" -- a thin-walled, high vaulted skull with a flat and near vertical forehead. Modern human faces also show much less (if any) of the heavy brow ridges and prognathism of other early humans. Our jaws are also less heavily developed, with smaller teeth.

Scientists sometimes use the term “anatomically modern Homo sapiens” to refer to members of our own species who lived during prehistoric times.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Human Origins Program

Supplier: Human Origins Program NMNH

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Introduction

Homo sapiens is the most widely dispersed and numerous medium-large size mammal, and the only extant member of the genus Homo.The type specimen of Homo sapiens is Carl Linnaeus (1707–1778), based on the descriptions in the 10th edition of his Systema Naturae (Linnaeus, 1758).No single person was recognised as the type specimen until 1959, when William Stearn wrote that "Linnaeus himself, must stand as the type of his Homo sapiens". This was enough to designate Linnaeus as a lectotype - the single name-bearing type specimen for the species Homo sapiens.Genus characteristics include a high degree of encephalisation and a skeleton adapted to habitual bipedalism. Species traits include:
  • a globular cranial vault
  • supraorbital ridges small or absent
  • a chin on the lower jaw
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Morphology
Humans can be distinguished from other living apes by a strikingly enlarged brain, reduced hair coverage on most parts of the body, and by a suite of skeletal and muscular adaptations associated with habitual bipedal locomotion, including the loss of the grasping ability of the foot. Humans are terrestrial bipeds with a limited ability to swim and dive that must be learned.The species shows strong variation in body size and proportions, and pigmentation, some of which can be related to the wide range of environments in which Homo sapiens lives. Humans exhibit moderate sexual dimorphism in body size.

Nutrition
Humans are opportunistic omnivores, showing remarkable ingenuity in extracting, producing, processing and preserving foods. Humans are the only species that can control or make fire, and cooking is practiced by all known extant human groups.Regional variations in diet are influenced by availability within a particular environment, by cultural traditions such as food preferences and avoidances, and even genetic factors. Lactase persistence, which allows some people to consume milk and dairy products throughout life, is a recent adaptation to dairy consumption that would only have been useful among populations with a tradition of dairy farming.

Life cycle
Human social structure is highly variable. Traditional arrangements that may be formalised through marriage include monogamous pairs as well as one-male multi female groups and, more rarely, one-female multi-male groups.Both males and females may disperse from their natal community. Human infants are born in a relatively immature state and remain dependent on adult carers for several years.Inter birth intervals are relatively short such that females may have multiple dependent offspring at different stages of developmental maturity. Other members of a community or extended family network may contribute to the care of dependent children, including fathers, older siblings and grandparents.Humans are typically diurnal and sleep in temporary or permanent shelters at night. Family groups often have exclusive use of a shared sleeping space or residence that may serve as a home base for extensive periods.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Homo sapiens

Human beings, humans, or Homo sapiens sapiens (Homo sapiens is latin and refers to the wise or knowing human) are bipedal primates in the family Hominidae. DNA evidence indicates that modern humans originated in Africa about 250,000 years ago. Humans have a highly developed brain, capable of abstract reasoning, language, introspection, and emotion. This mental capability, combined with an erect body carriage that frees the forelimbs (arms) for manipulating objects, has allowed humans to make far greater use of tools than any other species. Humans currently inhabit every continent on Earth, except Antarctica (although several governments maintain seasonally-staffed research stations there). Humans also now have a continuous presence in low Earth orbit, occupying the International Space Station. The human population on Earth is greater than 6.7 billion, as of July, 2008.

 

 
  Like most primates, humans are social by nature. However, they are particularly adept at utilizing systems of communication for self-expression, exchanging of ideas, and organization. Humans create complex social structures composed of many cooperating and competing groups, from families to nations. Social interactions between humans have established an extremely wide variety of traditions, rituals, ethics, values, social norms, and laws, which together form the basis of human society. Humans have a marked appreciation for beauty and aesthetics, which, combined with the desire for self-expression, has led to innovations such as culture, art, literature and music. 

 

 
 Humans are notable for their desire to understand and influence the world around them, seeking to explain and manipulate natural phenomena through science, philosophy, mythology and religion. This natural curiosity has led to the development of advanced tools and skills; humans are the only currently known species known to build fires, cook their food, clothe themselves, and manipulate and develop numerous other technologies. Humans pass down their skills and knowledge to the next generations through education. 

 

 
 The scientific study of human evolution encompasses the development of the genus Homo, but usually involves studying other hominids and hominines as well, such as Australopithecus. Modern humans are defined as the Homo sapiens species, of which the only extant subspecies - our own - is known as Homo sapiens sapiens. Homo sapiens idaltu (roughly translated as elder wise human), the other known subspecies, is now extinct. Anatomically modern humans first appear in the fossil record in Africa about 130,000 years ago, although studies of molecular biology give evidence that the approximate time of divergence from the common ancestor of all modern human populations was 200,000 years ago. 

 

 
 The closest living relatives of Homo sapiens are the two chimpanzee species: the Common Chimpanzee and the Bonobo. Full genome sequencing has resulted in the conclusion that after 6.5 [million] years of separate evolution, the differences between chimpanzee and human are just 10 times greater than those between two unrelated people and 10 times less than those between rats and mice. Suggested concurrence between human and chimpanzee DNA sequences range between 95% and 99%. It has been estimated that the human lineage diverged from that of chimpanzees about five million years ago, and from that of gorillas about eight million years ago. However, a hominid skull discovered in Chad in 2001, classified as Sahelanthropus tchadensis, is approximately seven million years old, which may indicate an earlier divergence. 

 

 
 The Recent African Origin (RAO), or the - out-of-Africa-, hypothesis proposes that modern humans evolved in Africa before later migrating outwards to replace hominids in other parts of the world. Evidence from archaeogenetics accumulating since the 1990s has lent strong support to RAO, and has marginalized the competing multiregional hypothesis, which proposed that modern humans evolved, at least in part, from independent hominid populations. Geneticists Lynn Jorde and Henry Harpending of the University of Utah propose that the variation in human DNA is minute compared to that of other species. They also propose that during the Late Pleistocene, the human population was reduced to a small number of breeding pairs, no more than 10,000, and possibly as few as 1,000, resulting in a very small residual gene pool. Various reasons for this hypothetical bottleneck have been postulated, one being the Toba catastrophe theory. 

 

 
 Human evolution is characterized by a number of important morphological, developmental, physiological and behavioural changes, which have taken place since the split between the last common ancestor of humans and chimpanzees. The first major morphological change was the evolution of a bipedal locomotor adaptation from an arboreal or semi-arboreal one, with all its attendant adaptations, such as a valgus knee, low intermembral index (long legs relative to the arms), and reduced upper-body strength. 

 

 
 Later, ancestral humans developed a much larger brain – typically 1,400 cm³ in modern humans, over twice the size of that of a chimpanzee or gorilla. The pattern of human postnatal brain growth differs from that of other apes (heterochrony), and allows for extended periods of social learning and language acquisition in juvenile humans. Physical anthropologists argue that the differences between the structure of human brains and those of other apes are even more significant than their differences in size. 

 

 
 Other significant morphological changes included: the evolution of a power and precision grip; a reduced masticatory system; a reduction of the canine tooth; and the descent of the larynx and hyoid bone, making speech possible. An important physiological change in humans was the evolution of hidden oestrus, or concealed ovulation, which may have coincided with the evolution of important behavioural changes, such as pair bonding. Another significant behavioural change was the development of material culture, with human-made objects becoming increasingly common and diversified over time. The relationship between all these changes is the subject of ongoing debate. 

 

 
 The forces of natural selection continue to operate on human populations, with evidence that certain regions of the genome display directional selection in the past 15,000 years. 

 

 
 This description from WikiPedia, 3rd August 2008: http://en.wikipedia.org/wiki/Homo_sapiens

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

David Patterson

Source: BioPedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Geographic Range

Humans are currently found throughout the world; in permanent settlements on all continents except Antarctica and on most habitable islands in all of the oceans. All available evidence suggests that humans originated in Africa.

Anatomically modern Homo sapiens populations are known from the Middle East as long as 100,000 years ago, from east Asia as long as 67,000 years ago, and southern Australia as long as 60,000 years ago. European Homo sapiens fossils are known from 35,000 years ago. Homo sapiens populations were once thought to have colonized the New World approximately 11 to 13,000 years ago, but recent research indicates earlier dates of colonization. This is an area of active research.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: cosmopolitan

  • Findley, J., A. Harris, D. Wilson, C. Jones. 1975. Mammals of New Mexico. Albuquerque: University of New Mexico Press.
  • Boaz, N., A. Almquist. 2002. Biological Anthropology: A Synthetic Approach to Human Evolution. New Jersey: Prentice Hall. Accessed December 03, 2007 at http://wps.prenhall.com/hss_boaz_biological_2/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Humans have the widest distribution of any terrestrial mammal species, inhabiting every continent on earth (although there are no permanent settlements on Antarctica). A small group of humans has been introduced to space, where they inhabit the International Space Station.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Humans are an exceptionally diverse species morphologically and many aspects of size vary substantially with environmental factors such as nutritional status. Historically there has been an effort to organize human physical variation into "races," although there is no scientific basis for the application of a race concept to human variation. Human physical variation is continuous and available evidence suggests that gene flow among human populations throughout their history has been the rule rather than the exception.

Humans are characterized by their bipedalism and their lack of significant body hair. Males are generally larger than females, with more pronounced muscle development and generally more hair on the face and torso than females.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Type Information

Key Fossils

Cro-Magnon 1

Nickname: Cro-Magnon Man

Site: Cro-Magnon, France

Date of discovery: 1868

Discovered by: Louis Laret

Age: About 30,000 years old

Species: Homo sapiens

Historic Homo sapiens

Discovered in 1868, the Cro-Magnon 1 was among the first fossils to be recognized as belonging to our own species—Homo sapiens. This famous fossil skull is from one of several modern human skeletons found at the famous rock shelter site at Cro-Magnon, near the village of Les Eyzies, France.

Road construction in 1868 revealed the rock shelter tucked into a limestone cliff. Researchers recognized an occupation floor toward the back of the cave during excavations. The occupation area revealed the remains of four adult skeletons, one infant, and some fragmentary bones. The condition and placement of ornaments, including pieces of shell and animal teeth fashioned into what appear to be pendants or necklaces, led researchers to believe the skeletons had been intentionally buried within the shelter in a single grave. The site was one of the first to establish the ancient roots of modern humans, and fossils from this shelter represent some of the oldest Homo sapiens populations of Europe. Associated tools and fragments of fossil animal bone date the site to the uppermost Pleistocene, probably between 32,000 and 30,000 years old.

Cro-Magnon 1 is a middle-aged, male skeleton of one of the four adults found in the cave at Cro-Magnon. Scientists estimate his age at death at less than 50 years old. Except for the teeth, his skull is complete, though the bones in his face are noticeably pitted from a fungal infection.

While the Cro-Magnon remains are representative of the earliest anatomically modern human beings to appear in Western Europe, this population was not the earliest anatomically modern humans to evolve - our species evolved about 200,000 years ago in Africa. however, the skull of Cro-Magnon 1 does show the traits that are unique to modern humans, including the tall, rounded skull with a near vertical forehead. A large brow ridge, no longer tops the eye sockets andthere is no prominent prognathism of the face and jaw.

Analysis of the skeletons found at the rock shelter indicates that the humans of this time period led a physically tough life. In addition Cro-Magnon 1’s fungal infection, several of the individuals found at the shelter had fused vertebrae in their necks indicating traumatic injury, and the adult female found at the shelter had survived for some time with a skull fracture. The survival of the individuals with such ailments is indicative of group support and care, which allowed their injuries to heal.

Skhul V

Site: Mount Carmel, Israel

Date of discovery: 1932

Discovered by: Theodore McCown and Hallam L. Movius, Jr.

Age: Between 120,000 and 80,000 years old

Species: Homo sapiens

Skhūl V was recovered from the Skhūl Cave near Mount Carmel, Israel, along with the skeletons of nine other adults and children. Some anatomical features, like the brow ridges above the eyes of the male Skhūl V skull are reminiscent of earlier humans; however, Skhūl V also has the high, vertical forehead and rounded skull typical of modern human skulls. At the back of the skull, Skhūl V also lacks a projecting ‘bun,’ which occurs in many Neanderthal skulls.

The Skhūl site was originally thought to be about 40,000 years old based on a comparison of animal remains and stone tools found at the site with those from other archeological sites in the region. This late date was important since it was then assumed that the Neanderthal fossils found at the nearby fossil site of Tabun Cave must be older than the modern Homo sapiens population of Skhul. This assumption left open the possibility that the Tabun Neanderthals were the evolutionary ancestors of modern humans at Skhūl.

However, after more precise dating techniques, scientists found that the modern Homo sapiens fossils at Skhūl were about 90,000 years old, much older than was previously thought. This meant the anatomically modern human population at Skhūl lived at the same time as the Neanderthal population of Tabun. Therefore, the Tabun Neanderthals could not have been the ancestors of modern humans in the Near East.

3-D collection link: http://humanorigins.si.edu/evidence/3d-collection/f-skh%C5%ABl-v

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Human Origins Program

Supplier: Human Origins Program NMNH

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Humans are found in a wide variety of habitats, largely thanks to their ability to use technology to adapt to and modify their habitats. Major concentrations are found in urban centers: over the past 30 years, the urban population has increased so that more than half of the world population will be living in cities by 2008 (Population Reference Bureau 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Humans are found in all terrestrial habitats worldwide. Humans extensively modify habitats as well, creating areas that are habitable by a much reduced set of other organisms, as in urban and agricultural areas. With the aid of technologies such as boats, humans also venture into many aquatic habitats, primarily to obtain food.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine ; intertidal or littoral ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Humans generally eat a highly variable omnivorous diet. The components of diets vary tremendously with regional availability of foods. Some human cultures restrict their diet to a vegetarian one, relying on plant sources of proteins. Foods are often extensively prepared and stored for future use. The use of fungal colonies, such as yeasts, for creating cultured foods, such as beer, bread, and cheeses, is widespread.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; blood; body fluids; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; nectar; pollen; flowers; sap or other plant fluids; algae; macroalgae

Other Foods: fungus; microbes

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Plant / resting place / within
larva of Angiometopa ruralis may be found in superficial wound of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Argas reflexus sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Argas vespertilionis sucks the blood of Homo sapiens
Other: minor host/prey

Animal / pathogen
Aspergillus conidium of Aspergillus fumigatus infects Homo sapiens

In Great Britain and/or Ireland:
Animal / pathogen
Borrelia infects Homo sapiens

Animal / parasite / ectoparasite
Cheyletiella parasitivorax ectoparasitises body of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
adult of Cimex lectularius sucks the blood of sleeping Homo sapiens

Animal / pathogen
Cryptosporidium infects gut of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
adult of Ctenocephalides canis sucks the blood of skin (esp face, ears) of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
adult of Ctenocephalides felis felis sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Dermacentor reticulatus sucks the blood of Homo sapiens

Animal / parasite / endoparasite
usually solitary tapeworm of Dipylidium caninum endoparasitises ilium of children of Homo sapiens
Other: unusual host/prey

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Homo sapiens

Animal / parasite / endoparasite
Enterobius vermiculatus endoparasitises colon of esp.children of Homo sapiens

Animal / dung associate
larva of Fannia scalaris inhabits dung of Homo sapiens

Animal / pathogen
Cryptococcus yeast anamorph of Filobasidiella neoformans infects Homo sapiens

Animal / pathogen
Giardia lamblia infects gut of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Haemaphysalis punctata sucks the blood of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite
adult of Hippobosca equina ectoparasitises Homo sapiens
Other: minor host/prey

Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Ixodes acuminatus sucks the blood of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Ixodes hexagonus sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Ixodes trianguliceps sucks the blood of skin of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Ixodes uriae sucks the blood of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Ixodes ventalloi sucks the blood of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Homo sapiens
Other: unusual host/prey

Animal / parasite / ectoparasite
larva of Lucilia sericata ectoparasitises wound of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Lyctocoris campestris sucks the blood of Homo sapiens
Other: minor host/prey

Animal / parasite
Microsporum audouinii parasitises skin (scalp) of Homo sapiens

Animal / parasite
Microsporum canis parasitises skin of Homo sapiens

Animal / epizoite
egg (nit) of Pediculus humanus capitis lives on hair (head) of Homo sapiens
Other: sole host/prey

Animal / epizoite
egg (nit) of Pediculus humanus humanus lives on clothing of Homo sapiens
Other: sole host/prey

Animal / parasite
Polypaecilum anamorph of Polypaecilum insolitum parasitises Homo sapiens

Animal / dung saprobe
fruitbody of Psilocybe merdaria is saprobic in/on dung or excretions of dried-out sewage bed of Homo sapiens

Animal / parasite / ectoparasite / blood sucker
Pthirus pubis sucks the blood of pubic hair of Homo sapiens
Other: sole host/prey

Animal / dung/debris feeder
larva of Pulex irritans feeds on dung/debris fallen hair of Homo sapiens

Animal / parasite / endoparasite
larva of Ravinia pernix endoparasitises gut of Homo sapiens
Other: minor host/prey

Animal / guest
adult of Reduvius personatus is a guest in house of Homo sapiens
Remarks: season: 5-end 9

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Homo sapiens

Animal / rests in
coccidial oocyst of Sarcocystis rests inside faeces of Homo sapiens

Animal / parasite / endoparasite
larva of Sarcophaga carnaria endoparasitises gut of Homo sapiens
Other: minor host/prey

Animal / parasite / ectoparasite
burrowing mite of Sarcoptes scabei ectoparasitises body of Homo sapiens

Animal / parasite
mycelium of Schizophyllum commune parasitises toe nails of Homo sapiens
Other: unusual host/prey

Animal / dung saprobe
gregarious, semi-immersed perithecium of Subbaromyces splendens is saprobic in/on dung or excretions of Homo sapiens

Animal / parasite / endoparasite
tapeworm of Taenia saginata endoparasitises ilium of Homo sapiens
Other: sole host/prey

Animal / parasite / endoparasite
larva of Toxocara canis endoparasitises tissue of Homo sapiens

Animal / parasite
Trichophyton rubrum parasitises shod feet skin (between toes) of Homo sapiens

Animal / parasite
Trichophyton tonsurans parasitises skin of Homo sapiens

Animal / associate
Xylocoris galactinus is associated with Homo sapiens

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Humans act as top predators in many ecosystems, although they are also sometimes preyed on by larger predators, such as tigers. Humans modify habitats and ecological communities in countless ways, often substantially changing the interactions of nearly all other species in those habitats.

Humans are parasitized by many species of internal and external parasites. Some research suggests that hairlessness in humans is an adaptation to reduce ectoparasite loads.

Humans and human societies have evolved multiple relationships with other species, including commensal species and domesticated and companion species. Human commensals are too numerous to mention, but some important commensal species are house mice (Mus musculus), black rats (Rattus rattus), Norway rats (Rattus norvegicus), and Oriental cockroaches (Periplaneta americana). Important domestic species include domestic dogs (Canis lupus familiaris), pigs (Sus scrofa), cattle (Bos taurus), sheep (Ovis aries), goats (Capra hircus), chickens (Gallus gallus), guinea pigs (Cavia porcellus), horses (Equus caballus), llamas (Lama glama), camels (Camelus species), turkeys (Meleagris gallopavo), honeybees (Apis mellifera), and many other animals. Humans have also domesticated many species of plants for food and other uses, such as corn (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), manioc (Manihot esculenta), apples (Malus domestica), and soy (Glycine max).

Ecosystem Impact: creates habitat

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans have few natural predators and often sit at or near the top of the food chain in regional ecosystems. Humans are sometimes opportunistically preyed on by large wild cats, such as tigers (Panthera tigris) and lions (Panthera leo). Other instances of large, carnivorous animals eating humans are often cases of mistaken identity or are opportunistic events. This includes cases involving large sharks, bears, monitor lizards, and crocodiles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Homo sapiens preys on:
Decapoda
Actinopterygii
Bivalvia
Rajiformes
Sterna
Charadriiformes
Scorpaenichthys marmoratus
Pleuronectiformes
Morone saxatilis
Pomatomus saltatrix
Scombridae
demersal species
Fundulus heteroclitus
Cheloniidae
Sus scrofa
coconut
Birgus latro
Phasianidae

Cyrtosperma
Pandanus
Artocarpus altilis
Pryola
Corylus
Cornus
Aralia
Bonasa umbellus
Leporidae
Anatidae
Mustelinae
Canis latrans
Mephitinae
Helianthus
Agropyron
Agrostis
Stipa
Mysticeti
Mirounga leonina
Physeter catodon
Phoca
Enhydra lutris
limpets
Gastropoda
Neoloricata
Echinoidea
Octopoda
Salmonidae
Hippopotamus
Tilapia zillii
Barbus
Aves
Crocodilia
Oreochromis leucostictus
Tilapia nilotica
Sergia lucens
Engraulis japonicus
Trachiurus japonica
Todarodes pacificus
Scomber japonicus
Stenella
Salmo
Ostreoida
Clupea harengus
Alosa pseudoharengus
Scomber
Peprilus triacanthus
Actinonaias ellipsiformis
Tridonta arctica
Pollachius pollachius
Gadidae
Melanogrammus aeglefinus
Pleuronectes ferrugineus
Scophthalmus aquosus
Paralichthys dentatus
Glyptocephalus cynoglossus
Hippoglossina oblonga
Pleuronectes americanus
Hippoglossoides platessoides
Hippoglossus hippoglossus
Mustelus canis
Squalus acanthias
Lophius americanus
Cynoscion
Phocidae
Chondrichthyes
Istiophoridae
Cichlidae
Scaridae
Acanthuridae
Siganidae
Belontiidae
Lepisosteus platostomus
Arapaima gigas
Cyprinus carpio
Stizostedion vitreum
Cyclura cornuta
Branta canadensis
Anas strepera
Anas acuta
Aythya americana
Cyrtonyx montezumae
Didelphis virginiana
Pteropus samoensis
Sylvilagus floridanus
Castor canadensis
Delphinapterus leucas
Monodon monoceros
Balaena mysticetus
Eubalaena glacialis
Ursus maritimus
Ursus arctos
Ursus americanus
Vulpes vulpes
Neophoca cinerea
Arctocephalus australis
Monachus tropicalis
Cervus nippon
Odocoileus virginianus
Alces alces
Bos taurus
Bos grunniens
Bos sauveli
Alligator mississippiensis
Phalanger lullulae
Dendrolagus scottae
Macropus bernardus
Bos javanicus
Oncifelis geoffroyi
Phoebastria nigripes
Allocebus trichotis
Eulemur rubriventer
Avahi laniger
Galago alleni
Saguinus bicolor
Saguinus nigricollis
Brachyteles arachnoides
Cebus olivaceus
Lophocebus albigena
Macaca sylvanus
Colobus angolensis
Colobus satanas
Procolobus rufomitratus
Procolobus verus
Pygathrix nemaeus
Petrodromus tetradactylus
Manis javanica
Loxodonta africana
Crateromys schadenbergi
Ailuropoda melanoleuca
Vulpes cana
Lontra provocax
Mydaus marchei
Conepatus chinga
Martes melampus
Bassaricyon gabbii
Paguma larvata
Osbornictis piscivora
Equus hemionus
Equus kiang
Sus verrucosus
Sus celebensis
Cervus albirostris
Cervus eldii
Cervus unicolor
Cervus alfredi
Mazama gouazoupira
Moschus chrysogaster
Damaliscus hunteri
Ammodorcas clarkei
Gazella gazella
Raphicerus melanotis
Raphicerus sharpei
Bubalus quarlesi
Capra ibex
Ovis ammon
Rupicapra rupicapra
Hippotragus niger
Redunca arundinum
Redunca fulvorufula
Chaetophractus nationi
Lepus nigricollis
Myotis myotis
Plecotus austriacus
Rhinolophus inops
Eidolon helvum
Hypsignathus monstrosus
Muntiacus vuquangensis
Canis lupus dingo

Based on studies in:
India, Cochin (Brackish water)
USA: Rhode Island (Coastal)
USA: Alaska, Aleutian Islands (Coastal)
USA, Northeastern US contintental shelf (Coastal)
Polynesia (Reef)
Canada: Manitoba (Forest)
Antarctic (Marine)
Russia (Lake or pond)
Ethiopia, Lake Abaya (Lake or pond)
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)
UK: Yorkshire, Aire, Nidd & Wharfe Rivers (River)
USA: California (Estuarine, Intertidal, Littoral)
Scotland (Lake or pond)
Japan (Brackish water, epipelagic zone)
Norway: Oppland, Ovre Heimdalsvatn Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • S. Z. Qazim, Some problems related to the food chain in a tropical estuary. In: Marine Food Chains, J. H. Steele, Ed. (Oliver and Boyd, Edinburgh, 1970), pp. 45-51, from p. 50.
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • J. N. Kremer and S. W. Nixon, A Coastal Marine Ecosystem: Simulation and Analysis, Vol. 24 of Ecol. Studies (Springer-Verlag, Berlin, 1978), from p. 12.
  • S. W. Nixon and C. A. Oviatt, Ecology of a New England salt marsh, Ecol. Monogr. 43:463-498, from p. 491 (1973).
  • C. A. Simenstad, J. A. Estes, K. W. Kenyon, Aleuts, sea otters, and alternate stable-state communities, Science 200:403-411, from p. 404 (1978).
  • N. C. Morgan and D. S. McLusky, A summary of the Loch Leven IBP results in relation to lake management and future research, Proc. R. Soc. Edinburgh Series B 74:407-416, from p. 408 (1972).
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
  • P. Larson, J. E. Brittain, L. Lein, A. Lillehammer and K. Tangen, The lake ecosystem of Ovre Heimdalsvatn, Holarctic Ecology 1:304-320, from p. 311 (1978).
  • E. Percival and H. Whitehead, 1929. A quantitative study of the fauna of some types of stream-bed. J. Ecol. 17:282-314, from p. 311 & overleaf.
  • Y. I. Sorokin, Biological productivity of the Rybinsk reservoir. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), pp. 493-503, from p. 497.
  • W. A. Niering, Terrestrial ecology of Kapingamarangi Atoll, Caroline Islands, Ecol. Monogr. 33(2):131-160, from p. 157 (1963).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
  • D. Riedel, Der Margheritensee (Sudabessinien) - Zugleich ein Beitrag zur Kenntnis der Abessinischen Graben-Seen, Arch. Hydrobiol. 58(4):435-466, from p. 457 (1962).
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

Humans occupy most terrestrial environments and are the most abundant medium-sized mammal on earth. Putative early members of the species lineage are known from Africa at more than 250,000 years ago, while examples showing the modern anatomical pattern date from 195,000–100,000 years ago in Africa, and 90,000–120,000 years ago in the Middle East.The earliest well-dated diagnostic Homo sapiens fossils in Europe, eastern Asia and Australasia date from 40,000–45,000 years, and in the Americas from less than 15,000 years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most primates, humans use vision extensively in perception and communication. Humans have excellent color vision, although visual acuity in low light is limited. Humans also use sounds extensively. Human languages represent one of the most complex systems of communication in the animal world, and the diversity of human languages is astounding. Touch is an important mode of perception, it is especially important in close social bonds. Humans have a moderately well developed sense of smell and taste, which is used to determine the suitability of foods and discover information about the environment and conspecifics.

The evolution of complex language is considered one of the hallmarks of Homo sapiens. Archaic humans were capable of complex language, although Homo sapiens anatomy seems to have evolved to favor the production of complex sounds in anatomically modern humans.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

How They Survived

Prehistoric Homo sapiens not only made and used stone tools, they also specialized them and made a variety of smaller, more complex, refined and specialized tools including composite stone tools, fishhooks and harpoons, bows and arrows, spear throwers and sewing needles.

For millions of years all humans, early and modern alike, had to find their own food. They spent a large part of each day gathering plants and hunting or scavenging animals. By 164,000 years ago modern humans were collecting and cooking shellfish and by 90,000 years ago modern humans had begun making special fishing tools. Then, within just the past 12,000 years, our species, Homo sapiens, made the transition to producing food and changing our surroundings. Humans found they could control the growth and breeding of certain plants and animals. This discovery led to farming and herding animals, activities that transformed Earth’s natural landscapes—first locally, then globally. As humans invested more time in producing food, they settled down. Villages became towns, and towns became cities. With more food available, the human population began to increase dramatically. We have been so successful that we have inadvertently created a turning point in the history of life on Earth.

Modern humans evolved a unique combination of physical and behavioral characteristics, many of which other early human species also possessed, though not to the same degree. The complex brains of modern humans enable us to interact with each other and with their surroundings in new and different ways. As the environment became more unpredictable, bigger brains helped our ancestors survive. We make specialized tools, and use tools to make other tools, as described above; we eat a variety of animal and plant foods and ; we have control over fire; we live in shelters; we build broad social networks, sometimes including people we have never even met; we exchange resources over wide areas; and we create art, music, personal adornment, rituals, and a complex symbolic world. Modern humans have spread to every continent and vastly expanded our numbers. We have altered the world in ways that benefit us greatly. But this transformation has unintended consequences for other species as well as for ourselves, creating new survival challenges.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Human Origins Program

Supplier: Human Origins Program NMNH

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

The beginnings of modern human cultural complexity can be traced back at least 100,000 years in Africa and the Middle East. African sites have extensive evidence of the use of red iron oxide pigments, for colouring shell beads and (probably also) the human body, while in the Middle East there are cave sites in Israel with shell beads (one is pictured from the site of Skhul), pigments, and human burials with associated grave goods such as deer antlers.This species is a large-brained biped, tool-making and tool-using, with an ancestral hunter-gatherer lifestyle, now extended to pastoralism, agriculture and industrialised urbanism.Behaviour includes complex treatment of the dead, and symbolism including:
  • representational art
  • music
  • religious beliefs
  • complex language
  • complex social systems
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Human lifespans vary tremendously with nutritional status and exposure to diseases and trauma. Humans can live more than 100 years; the longest lived human that has been documented was 122 years old. Most humans live 50 to 80 years old, providing they survive their most vulnerable childhood years. Average life expectancy in many parts of the developing world is from less than 40 years old to 65 years old. In the developed world average life expectancy can be over 80 years old.

Typical lifespan

Status: wild:
32 to 84 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 122.5 years (captivity) Observations: Succinctly, we humans age gradually. Although women tend to outlive men and there are gender differences in age-related pathologies, overall there are probably no differences between the sexes in terms of rate of ageing. Likewise, populations in different environments do not appear to greatly differ in rate of ageing even though they can differ on specific age-related diseases. Human mortality rates begin to exponentially increase after about age 30. The body's functional decline, however, starts after the sexual peak, roughly at age 19, and perhaps some functions decline even earlier in life (Leonard Hayflick 1994). A peculiar phenomena, though not unique of humans, is that the MRDT increases after about age 65. This has been suggested to be a statistical effect rather than any unknown biological process (Rossolini and Piantanelli 2001).+p Jean Calment is recorded as the longest-lived human being (Michel Allard 1998). Compared to other species, of course, the maximum longevity of humans is based on a considerably larger sample. Therefore, it has been argued that, for comparative purposes, it is more adequate to use as human maximum longevity 90 or 100 years (Lorenzini et al. 2005).+p The average human life expectancy worldwide is 66 years, ranging from 39 years in Zambia to 82 years in Japan. Among hunter-gatherers, the average life expectancy was probably around 30 years (Gurven and Kaplan 2007).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Human cultures are marked by a wide range of approaches to mating. Child-rearing in most cultures is accomplished with some degree of help and cooperation from other members of the group, including related and unrelated members.

Mating System: monogamous ; polyandrous ; polygynous ; polygynandrous (promiscuous) ; cooperative breeder

Humans are capable of breeding throughout the year. Gestation length is 40 weeks on average, a fairly long gestation length for a primate species with altricial young. Typically one young is born, although twins occur occasionally and multiple births rarely. Interbirth intervals, birth weights, time to weaning, independence, and sexual maturity all vary substantially with nutritional status of mothers and young and are influenced by cultural practices.

Breeding interval: Human females can reproduce up to once every 10 months, although typical birth intervals are longer and vary substantially.

Breeding season: Humans can breed at any time of the year.

Range number of offspring: 1 (low) .

Average gestation period: 40 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Human infants are born in an altricial state and require intense and long-term care to ensure survival. Parental care is variable across human cultures, but generally the mother plays a large role in caring for infants through weaning. Family members and unrelated community members also often play large roles in caring for young. Human young experience an extended period of adolescence in which many essential skills and cultural knowledge are learned and practiced. Human social structures are complex and frequently young remain part of the same larger social groups as their parents and their paternal and maternal families. Social stature of parents often also plays a large role in the social stature of the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Boaz, N., A. Almquist. 2002. Biological Anthropology: A Synthetic Approach to Human Evolution. New Jersey: Prentice Hall. Accessed December 03, 2007 at http://wps.prenhall.com/hss_boaz_biological_2/.
  • Martin, R., A. MacLarnon. 1990. Reproductive patterns in primates and other mammals: the dichotomy between altricial and precocial offspring. Pp. 47-80 in C DeRousseau, ed. Primate Life History and Evolution. New York: John Wiley and Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolutionary Tree Information

Fossils and DNA confirm humans are one of more than 200 species belonging to primates. Within that larger group, humans are nested within the great ape family. Although we did not evolve from any of the apes living today, we share characteristics with chimpanzees, gorillas, and orangutans (the great apes), as well as other apes. We most likely evolved from Homo heidelbergensis, the common ancestor we share with Neanderthals, who are our closest extinct relatives.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Human Origins Program

Supplier: Human Origins Program NMNH

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fossil and genetic data suggest that Homo sapiens shared a common ancestor (perhaps the species Homo heidelbergensis) with the closely-related Neanderthals in the Middle Pleistocene.

Genetics
Extensive genetic data on extant humans show that the greatest diversity and inferred evolutionary time depth lie in Africa, supporting the concept of a recent African origin for Homo sapiens. However, the newly published composite Neanderthal genome suggests there might have been some interbreeding with our Neanderthal relatives in the Middle East about 60,000 years ago, as modern humans dispersed through the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fossil History

History of Discovery

Unlike every other human species, Homo sapiens does not have a true type specimen. In other words, there is not a particular Homo sapiens individual that researchers recognize as being the specimen that gave Homo sapiens its name. Even though Linnaeus first described our species in 1758, it was not customary at that time to designate type specimens. It is rumored that in 1994 paleontologist Robert Bakker formally declared the skull of Edward Drinker Cope as the “lectotype”, a specimen essentially serving as the type specimen. When Cope, himself a great paleontologist, died in 1897, he willed his remains to science, and they are held by the University of Pennsylvania. But a type specimen must be one examined by the original author who names a species, so Cope’s remains do not qualify.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Human Origins Program

Supplier: Human Origins Program NMNH

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional Adaptations

Functional adaptation

Skin maintains structural rigidity: human
 

Human skin maintains its structural rigidity while expanding in water due to helical fibers of keratin woven into a three-dimensional pattern..

   
  "A novel technique to generate three-dimensional Euclidean weavings, composed of close-packed, periodic arrays of one-dimensional fibres, is described. Some of these weavings are shown to dilate by simple shape changes of the constituent fibres (such as fibre straightening)...This remarkable three-dimensional weaving...allows an unprecedented variation of packing density without loss of structural rigidity and is an attractive design target for materials. We propose that the G129 weaving (ideal Sþ weaving) is formed by keratin fibres in the outermost layer of mammalian skin, probably templated by a folded membrane." (Evans and Hyde 2011: 1274)
  Learn more about this functional adaptation.
  • Evans ME; Hyde ST. 2011. From three-dimensional weavings to swollen corneocytes. J. R. Soc. Interface. 8: 1274–1280.
  • Salleh A. 2011. Why skin doesn't dissolve in the bath. ABC Science [Internet], Accessed 9 March 2011.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Protein gives lifetime elasticity to tissues: human
 

Tissues of human retain elasticity for a lifetime due to the way the protein elastin’s main component, tropoelastin, is assembled and its molecular structure.

       
  "Elastin enables the reversible deformation of elastic tissues and can withstand decades of repetitive forces. Tropoelastin is the soluble precursor to elastin, the main elastic protein found in mammals...Tropoelastin is an asymmetric coil, with a protruding foot...We show that individual tropoelastin molecules are highly extensible yet elastic without hysteresis to perform as highly efficient molecular nanosprings. Our findings shed light on how biology uses this single protein to build durable elastic structures that allow for cell attachment to an appended foot." (Baldock et al. 2011:4322)
  Learn more about this functional adaptation.
  • Baldock C; Oberhauser AF; Ma L; Lammie D; Siegler V; Mithieux SM; Tu Y; Yuen Ho Chow J; Suleman F; Malfois M; Rogers S; Guo L; Irving TC; Wess TJ; Weiss AS. 2011. Shape of tropoelastin, the highly extensible protein that controls human tissue elasticity. PNAS. 108(11): 4322-4327.
  • Haworth A. 2011. Solving the riddle of nature's perfect spring. EurekAlert [Internet], Accessed 1-Mar-2011.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Helical structure improves flow: humans
 

Arteries of humans enhance transport of molecules between blood and the wall by having a helical structure.

       
  "Arteries, as living tissues, require a supply of metabolites, including oxygen, and the removal of waste products. Oxygen is soluble in and reacts at the arterial wall, and its transport between the blood and the wall is reported to be controlled by the fluid phase rather than the wall…There has been recognition of the contribution of wall shear to the transport of low-molecular-weight species between the blood and the arterial wall. However, molecular diffusion is a slow process compared with the distance over which mass transport must occur, which may be as much as the radius of a vessel. Therefore, mixing generated by secondary flow can be expected to enhance the transport of oxygen between the blood and the vessel wall. The flow in helical conduits is determined by the pitch and amplitude of the helix, and the flow rate and the physical nature of the fluid (Reynolds number). Depending on these quantities, there may be swirling and/or cross mixing…In this work, we study computationally the effect of cross mixing on oxygen transport between the blood  and the vessel wall and on the distribution of WSS [wall shear stress], by comparing the findings in two well-defined geometries, a cylindrical and a helical U-bend. We show that the helical geometry can capture the essential features of real vessels, like the coronary arteries, providing at the same time a simpler framework for understanding the effect of the geometrical parameters of the vessels." (Coppola and Caro 2008:1067)
  Learn more about this functional adaptation.
  • Coppola G; Caro C. 2008. Oxygen mass transfer in a model three-dimensional artery. Journal of the Royal Society Inteface. 5: 1067-1075.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Hydraulic action creates structural rigidity: human
 

The penis of humans avoids buckling by hydraulic action of increased blood flow into the corpora cavernosa.

   
  "Two major branches of engineering mechanics are fluid mechanics and  structural mechanics, with many practical problems involving  the effect of the first on the second. An example  is the design of an aircraft's wings to bend within reasonable limits  without  breaking under the action of lift forces exerted by  the air flowing over them; another is the maintenance of the structural  integrity of a dam designed to hold back a water  reservoir which would exert very large forces on it. Similarly, fluid  and  structural mechanics are involved in the  engineering analysis of erectile function: it is the hydraulic action of  increased  blood flow into the corpora cavernosa that creates  the structural rigidity necessary to prevent collapse of the penile  column."  (Udelson 2007:1031)

  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Udelson, D. 2007. Biomechanics of male erectile function. Journal of the Royal Society Interface.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Muscles self-repair: human
 

Muscles of humans go through self-repair and remodeling due to a modular system that incorporates nutrient and waste transport.

     
  "The ability to adapt in response to changes in functional demands sets living tissues apart from their engineered counterparts. Muscles grow during development, they remodel in response to use and disuse, and they are able to repair themselves after an injury…The modular design of muscle also facilitates the remodeling and repair of the muscle. The selfhealing properties of muscle emerge from the integration of muscles into a system that allows wound healing and continuous turnover via transport of nutrients and removal of waste products. It is arguably much simpler to grow and repair individual units than having to adapt the entire structure." (Bar-Cohen 2006:50-52)
  Learn more about this functional adaptation.
  • Yoseph Bar-Cohen. 2006. Biomimetics: biologically inspired technologies. Boca Raton, FL: CRC/Taylor & Francis. 527 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

DNA densely packed without knots: humans
 

The genomic DNA of humans is densely packed without knots into individual cells via fractal globule architecture.

         
  "'We've long known that on a small scale, DNA is a double helixBut if the double  helix didn't fold further, the genome in each cell would be two meters  long. Scientists have not really understood how the double helix folds  to fit into the nucleus of a human cell, which is only about a hundredth  of a millimeter in diameter…'

"The researchers report two striking findings. First, the human genome is  organized into two separate compartments, keeping active genes separate  and accessible while sequestering unused DNA in a denser storage  compartment. Chromosomes snake in and out of the two compartments  repeatedly as their DNA alternates between active, gene-rich and  inactive, gene-poor stretches....

"Second, at a finer scale, the genome adopts an unusual organization  known in mathematics as a 'fractal.' The specific architecture the  scientists found, called a 'fractal globule,' enables the cell to pack  DNA incredibly tightly -- the information density in the nucleus is  trillions of times higher than on a computer chip -- while avoiding the  knots and tangles that might interfere with the cell's ability to read  its own genome. Moreover, the DNA can easily unfold and refold during  gene activation, gene repression, and cell replication." (EurekAlert! 2009)


"We identified an additional level of genome organization that is characterized by the spatial segregation of open and closed chromatin to form two genome-wide compartments. At the megabase scale, the chromatin conformation is consistent with a fractal globule, a knot-free, polymer conformation that enables maximally dense packing while preserving the ability to easily fold and unfold any genomic locus. The fractal globule is distinct from the more commonly used globular equilibrium model." (Lieberman-Aiden et al. 2009:289)

  Learn more about this functional adaptation.
  • Lieberman-Aiden E; van Berkum NL; Williams L; Imakaev M; Ragoczy T; Telling A; Amit I; Lajoie BR; Sabo PJ; Dorschner MO; Sandstrom R; Bernstein B; Bender MA; Groudine M; Gnirke A; Stamatoyannopoulos J; Mirny LA; Lander ES; Dekker J. 2009. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326(5950): 289-93.
  • 2009. Scientists decipher the 3-D structure of the human genome. EurekAlert! [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Kidneys filter impurities: human
 

Kidneys of humans filter impurities by use of a dual membrane system.

       
  "Using a system based on the human body's kidneys - the ultimate in water recycling technology - Singapore and Orange County, CA have developed schemes that will use a dual membrane process to recycle domestic waste water (sewage) to levels that approach the quality of distilled water. Like the kidney, these recycling plants use two membranes, one with larger holes to remove micro-organisms such as protozoa and bacteria that cause infection, while the second separates salt from water." (Courtesy of the Biomimicry Guild)

  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Platelets block blood loss: humans
 

The circulatory system of humans prevents blood loss from wounds by sending platelets to block the hole.

   
  "Just as the human circulatory system sends platelets to a wound to prevent blood loss, oil pipelines can now transport special polymers that 'clot' oil at the site of a leak. Drawn by the pressure of the escaping liquid, these polymers press against the opening and form a temporary seal. Because each 'platelet' is electronically tagged, engineers can determine the exact location of a leak, and can repair the pipeline while it continues to operate. The technology, called Advanced Technology for Leak Location and Sealing System (ATLLASTM), works in any pressurized flow system. In addition to oil pipelines, it may prove useful in the water and chemical industries." (Courtesy of the Biomimicry Guild)

  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Skin is a multifunctional material: human
 

Skin of humans serves multiple functions (sensing, healing, actuation, etc.) because of integrated components that all work together.

       
  "Nature offers numerous examples of materials that serve multiple functions. Biological materials routinely contain sensing, healing, actuation, and other functions built into the primary structures of an organism. The human skin, for instance, consists of many layers of cells, each of which contains oil and perspiration glands, sensory receptors, hair follicles, blood vessels, and other components with functions other than providing the basic structure and protection for the internal organs. These structures have evolved in nature over eons to the level of seamless integration and perfection with which they serve their functions." (Bar-Cohen 2006:310)
  Learn more about this functional adaptation.
  • Yoseph Bar-Cohen. 2006. Biomimetics: biologically inspired technologies. Boca Raton, FL: CRC/Taylor & Francis. 527 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Sensing and sharing information: neurons
 

Neurons aid organisms in reacting to environmental stimuli because they collaborate to sense the environment, share information, and filter unimportant information

       
  "Feng Zhao, a computer scientist at Xerox's Palo Alto Research Center, proposes equipping machinery and structures with 'collaborating sensors' reminiscent of neurons. These sensors would respond adaptively to the physical environment, infer the needs of their human operators, share information within the network, and filter out unimportant details. A building or piece of equipment containing these sensors would behave almost organically." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Increased surface area improves gas exchange: human
 

Alveoli in lungs improve gas exchange by increasing the surface area of the lungs.

   
  "Our lungs are the functional interface between us and the atmosphere. The capacity of a pair of lungs is about 6 liters, but this modest volume, divided among three hundred million alveoli, is bounded by a surface of 50-100 square meters, about the floor area of a large classroom." (Vogel 2003:47)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Blood carries oxygen in varied conditions: human
 

The blood of humans distributes oxygen through the body via hemoglobin with adjustable oxygen affinity.

   
  "Nature has evolved in ways that, at the molecular scale, make inventive and elegant uses of chemistry. To take an example more or less at random, the use of allosteric effects by haemoglobin to fine-tune the protein's affinity for oxygen in different environments is exquisite. Imagine trying to design from first principles a system with haemoglobin's oxygen-sensitive oxygen affinity—there is not at all an obvious solution, and the engineer's answer would be likely to involve a cumbersome system of sensors and switches." (Ball 2002:15)
  Learn more about this functional adaptation.
  • Philip Ball. 2002. Natural strategies for the molecular engineer. Nanotechnology. 13(5): R15-R28.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Fingertips sensitive to fine textures: humans
 

The fingertips of humans are extremely sensitive to fine textures, in part due to the unique dermal ridges found on each fingertip.

     
  "Human fingertips, probably the most sensitive skin areas in the animal world, can distinguish between a smooth glass surface and one bearing grooves only 63,000 mm deep…The flexibility of the skin, together with the fine ridges, enable the fingers to grip objects and manipulate them. The pattern of dermal ridges is unique to each individual human being, and even to each finger…" (Foy and Oxford Scientific Films 1982:77)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Macromolecules aid joint lubrication: humans
 

Lubricating synovial fluid in joints protects from friction via a brush-like phase of charged macromolecules.

   
  "It is proposed that the extremely efficient lubrication observed in living joints arises from the presence of a brush-like phase of charged macromolecules at the surface of the superficial zone. This phase forms when charged macromolecules, including lubricin, superficial-zone protein, and aggrecan, cross the interface between the superficial zone and the synovial cavity as they are secreted into the synovium from within the bulk of the cartilage, and, in particular, the feasibility of such brush-like surface-phases is examined in some detail. The molecular mechanisms for the reduction in friction are proposed to be similar to those recently revealed using surface force balance studies on lubrication by charged brushes." (Klein 2006:691)
  Learn more about this functional adaptation.
  • Klein, J. 2006. Molecular mechanisms of synovial joint lubrication. Proceedings of the Institution of Mechanical Engineers, Part J: Journal of Engineering Tribology. 220(8): 691-710.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Skin protects from water loss: humans
 

The skin of humans protects from water loss in part due to fibrous structural proteins (keratins) and cross-linking.

   
  "The vertebrate integument represents an evolutionary compromise between the needs for mechanical protection and those of sensing the environment and regulating the exchange of materials and energy. Fibrous keratins evolved as a means of strengthening the integument while simultaneously providing a structural support for lipids, which comprise the principal barrier to cutaneous water efflux in terrestrial taxa…How do the structural features of keratin influence its resistance to water movement? Generally, structural features that alter the free volume (equivalent to pores or channels) should alter the permeation of water molecules accordingly. Resistance to diffusion is affected by the molecular mass of side chains and tends to increase with cross-linking beyond certain critical levels (Lieberman et al., 1972)…The stability of cross-linkages is dependent on a large number of intermolecular forces, including covalent, ionic, and hydrogen bonding in addition to van der Waals attractive forces between non-polar amino acid side chains. All of these act to influence the mobility and free volumes of the structure…Studies of human skin have indeed demonstrated that gradients of water exist in the stratum corneum (Warner et al., 1988; Bommannan et al., 1990; Caspers et al., 2001; Bouwstra et al., 2003a). Fourier transform infrared spectroscopy has demonstrated that free water content in stratum corneum is greater in central regions relative to superficial and deeper cell layers at moderate levels of hydration (57%–87%, w/w), whereas at higher levels of hydration (300% w/w) water swells corneocytes in a direction perpendicular to the skin surface except for the deepest cell layers adjacent to the viable epidermis (Bouwstra et al., 2003a). While the mechanism excluding free water from the deeper cell layers of stratum corneum is not understood, it is speculated to play a role in preventing dehydration of the viable epidermis. In relatively dry conditions (18%–26% w/w), only bound water is present in the stratum corneum (Bulgin and Vinson, 1967; Hansen and Yellin, 1972; Bouwstra et al., 2003a)." (Lillywhite 2006:202, 212, 213)
  Learn more about this functional adaptation.
  • Lillywhite, H. B. 2006. Water relations of tetrapod integument. Journal of Experimental Biology. 209(2): 202-226.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Valves handle high pressures: humans
 

The aortic valve in vertebrate hearts allows the tissue to expand under high pressures by having elastic properties.

   
  "THE human aortic valve consists of three cusps made of relatively inelastic, muscle-free material about 0.15 mm thick. It opens and shuts about once a second, and withstands a pressure difference of 100 mm of mercury when closed. It usually functions for 70 yr without failure, and works so efficiently that very little blood is regurgitated at each pulse. In order to support this large pressure difference, the cusps must close simultaneously in all operating conditions and should not touch the wall of the aorta, for considerable reversed flow would then be required to close the valve. This action suggests a fluid dynamic control mechanism which positions the cusps away from the wall of the aorta, so that the slightest reversed flow will close the valve." (Bellhouse and Bellhouse 1968:86)
  Learn more about this functional adaptation.
  • Bellhouse, B. J.; Bellhouse, F. H. 1968. Mechanism of closure of the aortic valve. Nature. 217(5123): 86-87.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Fine strands stabilize bones: humans
 

The spongy bones of humans handle stress efficiently via the distribution of fine strands called trabeculae.

   
  "In some materials, such as metal, stress lines are usually invisible; but in others, including bone, they are often quite easy to see. Some parts of bone are composed of a spongy mesh of very fine strands called trabeculae. In a cross-section of bone the trabeculae can be seen to be orientated to the lines of stress. Where they are most closely packed together, the stress is greatest. It was a section of the top of a human thigh bone that inspired Professor Culmann, a Swiss engineer, to design in 1866, a new crane: he realized that the lines of stress shown by the trabeculae constituted a diagram of how his crane should be designed to cope with similar stress (diagram c)." (Foy and Oxford Scientific Films 1982:35)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Muscles flex: humans
 

The muscles of humans flex by the sliding of tethered molecular units over one another.

         
  "Muscle fibers contain comblike arrays of filaments made from chains of the protein actin, with nodes of the myosin protein interdigitated between the combs' teeth. The ends of the filaments are covered with molecular 'motors' that can walk along actin filaments. When this motion is triggered by a nerve signal, the myosin rods become more deeply interdigitated, causing the muscle fiber to shorten." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Cochlea aids hearing: humans
 

The cochlea of the human ear helps us hear deep vibrations by directing low-frequency waves into the tightest turns of its spiral.

     
  "Deep inside your ear, the pea-size, spiral-shaped cochlea helps translate reverberations from the outside world into neurological signals that we perceive as sound. The cochlea's coil has traditionally been regarded as little more than the body's way of packing a lot of membrane into a small space—a mechanical adaptation that did not affect hearing. Not any more.

Last March a team of engineers found a function for the cochlea's shape. Using a mathematical model, they determined that the tight coil at the cochlea's center steers low-frequency waves into its tightest turns, helping us hear deep vibrations. Previous models had treated sound waves as if they traveled in a straight line, an assumption that failed to take into account how the cochlea's shape affects the waves' path. 'It's the curvature that's critical,' says biophysicist Richard Chadwick at the National Institutes of Health, a collaborator on the project. 'The more the curvature changes, the more focused the energy gets. It's behaving something like a whispering gallery, but even better.'" (Ornes 2006)
  Learn more about this functional adaptation.
  • Stephen Ornes. 2006. Cochlea's Spiral Plays Surprising Role in Hearing. Science and Technology News, Discover Magazine [Internet], Accessed 9/4/2007.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Mucus helps humans smell: human
 

Smell receptors in the human nose detect smells with the help of a thin mucus layer, which dissolves scents and uses chromatography.

   
  "Humans detect smells using more than 100 million specialised receptors on the roof of the nasal cavity, just behind the bridge of the nose. The complex manner in which multiple receptors react to a molecule is used to identify and differentiate them...the receptors in a human nose are covered in a thin layer of mucus, which helps them detect scents.

"This layer of mucus dissolves scents and separates their components chemically, using chromatography. Different odour molecules then reach receptors at slightly varied times. As a result, the receptors have another way to distinguish between compounds." (Simonite 2007)


"Here, we report on a biologically inspired analytical system that represents a new concept in the field of machine olfaction. Specifically, this paper describes the design and fabrication of a novel sensor system, based upon the principle of 'nasal chromatography', which emulates the human olfactory mucosa. Our approach exploits the physical positioning of a series of broadly tuned sensors (equivalent to the olfactory epithelium) along the length of a planar chromatographic channel (analogous to the thin mucus coating of the nasal cavity) from which we extract both spatial (response magnitude) and temporal (retentive delay) sensor signals. Our study demonstrates that this artificial mucosa is capable of generating both spatial and temporal signals which, when combined, create a novel spatio-temporal representation of an odour. We believe that such a system not only offers improved odour discrimination over a sensor array-based electronic nose, but also shorter analysis times than conventional gas chromatographic techniques." (Gardner et al. 2007:1713)

  Learn more about this functional adaptation.
  • Tom Simonite. 2007. Mucus substitute helps artificial nose scent success. New Scientist.
  • Gardner, J. W.; Covington, J. A.; Tan, S. L.; Pearce, T. C. 2007. Towards an artificial olfactory mucosa for improved odour classification. Proceedings of the Royal Society A: Mathematical, Physical and Engineering Sciences. 463(2083): 1713-1728.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Homo sapiens ssp Denisova

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Homo sapiens ssp Denisova

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Homo sapiens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8536 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCTTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAATATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAAACAAAAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Homo sapiens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8433
Specimens with Barcodes: 8673
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Global Mammal Assessment Team

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority); & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as the species is very widely distributed, adaptable, currently increasing, and there are no major threats resulting in an overall population decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Human populations are not monitored by conservation agencies. Although human populations worldwide are large and growing, some regional or isolated populations may be in decline as a result of economic disadvantage, disease, habitat degradation, emigration, and cultural erosion.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Human activities, associated with a rapidly increasing demand for food, timber, fibre, and fuel have profoundly affected the ecosystems on which humans and other species depend for their well-being.In the past century the scale and complexity of human activity has increased to the point where human activities are threatening other species and also affecting our own wellbeing as a result of environmental degradation and the likelihood of humanly-induced global warming.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In mid-2007, the total population of human beings was estimated at 6.6 billion, an increase from 6.1 billion in 2001. Two countries, China and India, hold approximately one-third of the entire human population alone, with 1,318 million and 1,312 million people, respectively. The United States of America is third with 302 million. The annual rate of increase is about 1.2%; the total population is expected to reach 7,965 million by mid-2025, and 9,294 by mid-2050 (Population Reference Bureau 2007).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are currently no major threats to humans, although some subpopulations may be experiencing localized declines as a result of disease, drought, war, natural disasters, and other factors.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed in CITES Appendix II (under Primates spp.). At present, no conservation measures are required. Humans are present in numerous protected areas throughout their range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Human interactions are often complex and negative at interpersonal levels and among social groups, cultures, and governments. Human activities often destroy or transform ecosystems, and these changes can have negative economic and/or medical impacts on other human populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Human

Human!<-- This template has to be "warmed up" before it can be used, for some reason -->

Craniata

Humans, known taxonomically as Homo sapiens[3][4] (Latin for "wise man" or "knowing man"),[5] are the only living species in the Homo genus of bipedal primates in Hominidae, the great ape family. Anatomically modern-appearing humans originated in Africa about 200,000 years ago, reaching full behavioral modernity around 50,000 years ago.[6]

Humans have a highly developed brain, capable of abstract reasoning, language, introspection, and problem solving. This mental capability, combined with an erect body carriage that frees the hands for manipulating objects, has allowed humans to make far greater use of tools than any other living species on Earth. Other higher-level thought processes of humans, such as self-awareness, rationality, and sapience,[7][8][9] are considered to be defining features of what constitutes a "person".[10][11]

Like most higher primates, humans are social animals. However, humans are uniquely adept at utilizing systems of communication for self-expression, the exchange of ideas, and organization. Humans create complex social structures composed of many cooperating and competing groups, from families to nations. Social interactions between humans have established an extremely wide variety of values, social norms, and rituals, which together form the basis of human society. With individuals widespread in every continent except Antarctica, humans are a cosmopolitan species. As of January 2011, the population of humans was estimated to be about 6.89 billion.[12]

Humans are noted for their desire to understand and influence their environment, seeking to explain and manipulate phenomena through science, philosophy, mythology, and religion. This natural curiosity has led to the development of advanced tools and skills, which are passed down culturally; humans are the only species known to build fires, cook their food, clothe themselves, and use numerous other technologies. The study of humans is the scientific discipline of anthropology.

Contents

Etymology

The English adjective human is a Middle English loan from Old French humain, ultimately from Latin hūmānus, the adjective of homō "man". Use as a noun (with a plural humans) dates to the 16th century.[13] The native English term man is now often reserved for male adults, but can still be used for "mankind" in general in Modern English.[14] The word is from Proto-Germanic *mannaz, from a Proto-Indo-European (PIE) root *man-, cognate to Sanskrit manu-.

The generic name Homo is a learned 18th century derivation from Latin homō "man", ultimately "earthly being" (Old Latin hemō, cognate to Old English guma "man", from PIE *dʰǵʰemon-, meaning 'earth' or 'ground').[15]

History

Evolution

A reconstruction of Australopithecus afarensis, a human ancestor that had developed bipedalism, but which lacked the large brain of modern humans

The scientific study of human evolution encompasses the development of the genus Homo, but usually involves studying other hominids and hominines as well, such as Australopithecus. "Modern humans" are defined as the Homo sapiens species, of which the only extant subspecies is known as Homo sapiens sapiens. Homo sapiens idaltu (roughly translated as "elder wise human"), the other known subspecies, is now extinct.[16] Homo neanderthalensis, which became extinct 30,000 years ago, has sometimes been classified as a subspecies, "Homo sapiens neanderthalensis"; genetic studies now suggest that the functional DNA of modern humans and Neanderthals diverged 500,000 years ago.[17] Similarly, the few specimens of Homo rhodesiensis have also occasionally been classified as a subspecies, but this is not widely accepted. Anatomically modern humans first appear in the fossil record in Africa about 195,000 years ago, and studies of molecular biology give evidence that the approximate time of divergence from the common ancestor of all modern human populations was 200,000 years ago.[18][19][20][21][22] The broad study of African genetic diversity headed by Dr. Sarah Tishkoff found the San people to express the greatest genetic diversity among the 113 distinct populations sampled, making them one of 14 "ancestral population clusters". The research also located the origin of modern human migration in south-western Africa, near the coastal border of Namibia and Angola.[23]

The evolutionary history of the primates can be traced back 65 million years, as one of the oldest of all surviving placental mammal groups. The oldest known primate-like mammal species (those of the genus Plesiadapis) come from North America, but they were widespread in Eurasia and Africa during the tropical conditions of the Paleocene and Eocene. Molecular evidence suggests that the last common ancestor between humans and the remaining great apes diverged between 8 and 4 million years ago, first the gorillas, and then the chimpanzees (genus Pan) split off from the line leading to the humans; the functional human DNA is approximately 98.4% identical to that of chimpanzees when comparing single nucleotide polymorphisms (see human evolutionary genetics). Therefore, the closest living relatives of humans are gorillas and chimpanzees, as they share a common ancestor.[24]

Humans are probably most closely related to two chimpanzee species: Common Chimpanzee and Bonobo.[24] Full genome sequencing has resulted in the conclusion that "after 6.5 [million] years of separate evolution, the differences between chimpanzee and human are ten times greater than those between two unrelated people and ten times less than those between rats and mice".[attribution needed] Suggested concurrence between the functional human and chimpanzee DNA sequences range between 95% and 99%;[25][26][27][28] It has been estimated that the human lineage diverged from that of chimpanzees about five million years ago, and from that of gorillas about eight million years ago. However, a hominid skull discovered in Chad in 2001, classified as Sahelanthropus tchadensis, is approximately seven million years old, which may indicate an earlier divergence.[29]

Human evolution is characterised by a number of important morphological, developmental, physiological and behavioural changes, which have taken place since the split between the last common ancestor of humans and chimpanzees. The first major morphological change was the evolution of a bipedal locomotor adaptation from an arboreal or semi-arboreal one,[30] with all its attendant adaptations, such as a valgus knee, low intermembral index (long legs relative to the arms), and reduced upper-body strength.

Later, ancestral humans developed a much larger brain – typically 1,400 cm³ in modern humans, over twice the size of that of a chimpanzee or gorilla. The pattern of human postnatal brain growth differs from that of other apes (heterochrony), and allows for extended periods of social learning and language acquisition in juvenile humans. Physical anthropologists[who?] argue that the differences between the structure of human brains and those of other apes are even more significant than their differences in size.

Other significant morphological changes included the evolution of a power and precision grip,[31] a reduced masticatory system, a reduction of the canine tooth, and the descent of the larynx and hyoid bone, making speech possible. An important physiological change in humans was the evolution of hidden oestrus, or concealed ovulation, which may have coincided with the evolution of important behavioural changes, such as pair bonding. Another significant behavioural change was the development of material culture, with human-made objects becoming increasingly common and diversified over time. The relationship between all these changes is the subject of ongoing debate.[32][33]

The forces of natural selection have continued to operate on human populations, with evidence that certain regions of the genome display directional selection in the past 15,000 years.[34]

Paleolithic

Artistic expression appeared in the Upper Paleolithic: The Venus of Dolní Věstonice figurine, one of the earliest known depictions of the human body, dates to approximately 29,000–25,000 BP (Gravettian).

Anatomically modern humans evolved from archaic Homo sapiens in Africa in the Middle Paleolithic, about 200,000 years ago. By the beginning of the Upper Paleolithic 50,000 BP (Before Present), full behavioral modernity, including language, music and other cultural universals had developed.

The out of Africa migration is estimated to have occurred about 70,000 years BP. Modern humans subsequently spread to all continents, replacing earlier hominids: they inhabited Eurasia and Oceania by 40,000 BP, and the Americas at least 14,500 years BP.[35] A popular theory is that they displaced Homo neanderthalensis and other species descended from Homo erectus[36] (which had inhabited Eurasia as early as 2 million years ago) through more successful reproduction and competition for resources.[37] The exact manner or extent of the coexistence and interaction of these species is unknown and remains a controversial subject.[citation needed]

Evidence from archaeogenetics accumulating since the 1990s has lent strong support to the "out-of-Africa" scenario, and has marginalized the competing multiregional hypothesis, which proposed that modern humans evolved, at least in part, from independent hominid populations.[38]

Geneticists Lynn Jorde and Henry Harpending of the University of Utah propose that the variation in human DNA is minute compared to that of other species. They also propose that during the Late Pleistocene, the human population was reduced to a small number of breeding pairs – no more than 10,000, and possibly as few as 1,000 – resulting in a very small residual gene pool. Various reasons for this hypothetical bottleneck have been postulated, one being the Toba catastrophe theory.[39]

Transition to civilization

The rise of agriculture, and domestication of animals, led to stable human settlements.
The path followed by humans in the course of history

Until c. 10,000 years ago, most humans lived as hunter-gatherers. They generally lived in small nomadic groups known as band societies. The advent of agriculture prompted the Neolithic Revolution, when access to food surplus led to the formation of permanent human settlements, the domestication of animals and the use of metal tools. Agriculture encouraged trade and cooperation, and led to complex society. Because of the significance of this date for human society, it is the epoch of the Holocene calendar or Human Era.

About 6,000 years ago, the first proto-states developed in Mesopotamia, Egypt's Nile Valley and the Indus Valleys. Military forces were formed for protection, and government bureaucracies for administration. States cooperated and competed for resources, in some cases waging wars. Around 2,000–3,000 years ago, some states, such as Persia, India, China, Rome, and Greece, developed through conquest into the first expansive empires. Influential religions, such as Judaism, originating in West Asia, and Hinduism, a religious tradition that originated in South Asia, also rose to prominence at this time.

The late Middle Ages saw the rise of revolutionary ideas and technologies. In China, an advanced and urbanized society promoted innovations and sciences, such as printing and seed drilling. In India, major advancements were made in mathematics, philosophy, religion and metallurgy. The Islamic Golden Age saw major scientific advancements in Muslim empires. In Europe, the rediscovery of classical learning and inventions such as the printing press led to the Renaissance in the 14th and 15th centuries. Over the next 500 years, exploration and colonialism brought great parts of the world under European control, leading to later struggles for independence. The Scientific Revolution in the 17th century and the Industrial Revolution in the 18th–19th centuries promoted major innovations in transport, such as the railway and automobile; energy development, such as coal and electricity; and government, such as representative democracy and Communism.

With the advent of the Information Age at the end of the 20th century, modern humans live in a world that has become increasingly globalized and interconnected. As of 2010, almost 2 billion humans are able to communicate with each other via the Internet,[40] and 3.3 billion by mobile phone subscriptions.[41]

Although interconnection between humans has encouraged the growth of science, art, discussion, and technology, it has also led to culture clashes and the development and use of weapons of mass destruction. Human civilization has led to environmental destruction and pollution, producing an ongoing mass extinction of other forms of life called the holocene extinction event,[42] that may be further accelerated by global warming in the future.[43]

Habitat and population

Humans often live in family-based social structures and create artificial shelter.

Early human settlements, were dependent on proximity to water and, depending on the lifestyle, other natural resources used for subsistence, such as populations of animal prey for huntinging and arable land for growing crops and grazing livestock. But humans have a great capacity for altering their habitats by means of technology; through irrigation, urban planning, construction, transport, manufacturing goods, deforestation and desertification. Deliberate habitat alteration is often done with the goals of increasing material wealth, increasing thermal comfort, improving the amount of food available, improving aesthetics, or improving ease of access to resources or other human settlements. With the advent of large-scale trade and transport infrastructure, proximity to these resources has become unnecessary, and in many places, these factors are no longer a driving force behind the growth and decline of a population. Nonetheless, the manner in which a habitat is altered is often a major determinant in population change.

Technology has allowed humans to colonize all of the continents and adapt to virtually all climates. Within the last century, humans have explored Antarctica, the ocean depths, and outer space, although large-scale colonization of these environments is not yet feasible. With a population of over six billion, humans are among the most numerous of the large mammals. Most humans (61%) live in Asia. The remainder live in the Americas (14%), Africa (14%), Europe (11%), and Oceania (0.5%).

Human habitation within closed ecological systems in hostile environments, such as Antarctica and outer space, is expensive, typically limited in duration, and restricted to scientific, military, or industrial expeditions. Life in space has been very sporadic, with no more than thirteen humans in space at any given time. Between 1969 and 1972, two humans at a time spent brief intervals on the Moon. As of January 2011, no other celestial body has been visited by humans, although there has been a continuous human presence in space since the launch of the initial crew to inhabit the International Space Station on October 31, 2000. However, other celestial bodies have been visited by human-made objects.

Since 1800, the human population has increased from one billion to over six billion.[44] In 2004, some 2.5 billion out of 6.3 billion people (39.7%) lived in urban areas, and this percentage is expected to continue to rise throughout the 21st century. In February 2008, the U.N. estimated that half the world's population will live in urban areas by the end of the year.[45] Problems for humans living in cities include various forms of pollution and crime,[46] especially in inner city and suburban slums.

Humans have had a dramatic effect on the environment. As humans are rarely preyed upon, they have been described as superpredators.[47] Currently, through land development, combustion of fossil fuels and pollution, humans are thought to be the main contributor to global climate change.[48] Human activity is believed to be a major contributor to the ongoing Holocene extinction event, which is a form of mass extinction. If this continues at its current rate it is predicted that it will wipe out half of all species over the next century.[49][50]

Biology

Anatomy

Basic anatomical features of female and male humans. Note that these models have had body hair and male facial hair removed and head hair trimmed.

Human body types vary substantially. Although body size is largely determined by genes, it is also significantly influenced by environmental factors such as diet and exercise. The average height of an adult human is about 1.5 to 1.8 m (5 to 6 feet) tall, although this varies significantly from place to place and depending on ethnic origin.[51][52] The average mass of an adult human is 54–64 kg (120–140 lbs) for females and 76–83 kg (168–183 lbs) for males.[53] Weight can also vary greatly (e.g. obesity). Unlike most other primates, humans are capable of fully bipedal locomotion, thus leaving their arms available for manipulating objects using their hands, aided especially by opposable thumbs.

Vitruvian Man, Leonardo da Vinci's image is often used as an implied symbol of the essential symmetry of the human body, and by extension, of the universe as a whole.

Although humans appear hairless compared to other primates, with notable hair growth occurring chiefly on the top of the head, underarms and pubic area, the average human has more hair follicles on his or her body than the average chimpanzee. The main distinction is that human hairs are shorter, finer, and less heavily pigmented than the average chimpanzee's, thus making them harder to see.[54]

The hue of human skin and hair is determined by the presence of pigments called melanins. Human skin hues can range from very dark brown to very pale pink. Human hair ranges from white to brown to red to most commonly black.[55] This depends on the amount of melanin (an effective sun blocking pigment) in the skin and hair, with hair melanin concentrations in hair fading with increased age, leading to grey or even white hair. Most researchers believe that skin darkening was an adaptation that evolved as a protection against ultraviolet solar radiation. However, more recently it has been argued that particular skin colors are an adaptation to balance folate, which is destroyed by ultraviolet radiation, and vitamin D, which requires sunlight to form.[56] The skin pigmentation of contemporary humans is geographically stratified, and in general correlates with the level of ultraviolet radiation. Human skin also has a capacity to darken (sun tanning) in response to exposure to ultraviolet radiation.[57][58] Humans tend to be physically weaker than other similarly sized primates, with young, conditioned male humans having been shown to be unable to match the strength of female orangutans which are at least three times stronger.[59]

The construction of the human pelvis differs from other primates, as do the toes. As a result, humans are slower for short distances than most other animals, but are among the best long-distance runners in the animal kingdom.[60] Humans' thinner body hair and more productive sweat glands also helps avoid heat exhaustion while running for long distances. For this reason persistence hunting was most likely a very successful strategy for early humans – in this method, prey is chased until it is literally exhausted. This may have also helped the early human Cro-Magnon population out-compete the Neanderthal population for food. The otherwise physically stronger Neanderthal would have much greater difficulty hunting in this way, and much more likely hunted larger game in close quarters. A trade-off for these advantages of the modern human pelvis is that childbirth is more difficult and dangerous.

The construction of modern human shoulders enable throwing weapons, which also were much more difficult or even impossible for Neanderthal competitors to use effectively.[61]

Constituents of the human body in a person weighing 60 kg[62]
ConstituentWeightPercentage of atoms
Oxygen38.8 kg25.5 %
Carbon10.9 kg9.5 %
Hydrogen6.0 kg63.0 %
Nitrogen1.9 kg1.4 %
Other2.4 kg0.6 %

Humans have proportionately shorter palates and much smaller teeth than other primates. They are the only primates to have short, relatively flush canine teeth. Humans have characteristically crowded teeth, with gaps from lost teeth usually closing up quickly in young specimens. Humans are gradually losing their wisdom teeth, with some individuals having them congenitally absent.[63]

Physiology

Human physiology is the science of the mechanical, physical, and biochemical functions of humans in good health, their organs, and the cells of which they are composed. The principal level of focus of physiology is at the level of organs and systems. Most aspects of human physiology are closely homologous to corresponding aspects of animal physiology, and animal experimentation has provided much of the foundation of physiological knowledge. Anatomy and physiology are closely related fields of study: anatomy, the study of form, and physiology, the study of function, are intrinsically tied and are studied in tandem as part of a medical curriculum.

Genetics

Humans are a eukaryotic species. Each diploid cell has two sets of 23 chromosomes, each set received from one parent. There are 22 pairs of autosomes and one pair of sex chromosomes. By present estimates, humans have approximately 20,000–25,000 genes. Like other mammals, humans have an XY sex-determination system, so that females have the sex chromosomes XX and males have XY. The X chromosome carries many genes not on the Y chromosome, which means that recessive diseases associated with X-linked genes, such as haemophilia, affect men more often than women.

Life cycle

A 10 mm human embryo at 5 weeks

The human life cycle is similar to that of other placental mammals. The zygote divides inside the female's uterus to become an embryo, which over a period of thirty-eight weeks (9 months) of gestation becomes a fetus. After this span of time, the fully grown fetus is birthed from the woman's body and breathes independently as an infant for the first time. At this point, most modern cultures recognize the baby as a person entitled to the full protection of the law, though some jurisdictions extend various levels of personhood earlier to human fetuses while they remain in the uterus.

Compared with other species, human childbirth is dangerous. Painful labors lasting twenty-four hours or more are not uncommon and sometimes leads to the death of the mother, or the child.[64] This is because of both the relatively large fetal head circumference (for housing the brain) and the mother's relatively narrow pelvis (a trait required for successful bipedalism, by way of natural selection).[65][66] The chances of a successful labor increased significantly during the 20th century in wealthier countries with the advent of new medical technologies. In contrast, pregnancy and natural childbirth remain hazardous ordeals in developing regions of the world, with maternal death rates approximately 100 times more common than in developed countries.[67]

In developed countries, infants are typically 3–4 kg (6–9 pounds) in weight and 50–60 cm (20–24 inches) in height at birth.[68] However, low birth weight is common in developing countries, and contributes to the high levels of infant mortality in these regions.[69] Helpless at birth, humans continue to grow for some years, typically reaching sexual maturity at 12 to 15 years of age. Females continue to develop physically until around the age of 18, whereas male development continues until around age 21. The human life span can be split into a number of stages: infancy, childhood, adolescence, young adulthood, adulthood and old age. The lengths of these stages, however, have varied across cultures and time periods. Compared to other primates, humans experience an unusually rapid growth spurt during adolescence, where the body grows 25% in size. Chimpanzees, for example, grow only 14%, with no pronounced spurt.[70] The presence of the growth spurt is probably necessary to keep children physically small until they are psychologically mature. Humans are one of the few species in which females undergo menopause. It has been proposed that menopause increases a woman's overall reproductive success by allowing her to invest more time and resources in her existing offspring and/or their children (the grandmother hypothesis), rather than by continuing to bear children into old age.[71][72]

There are significant differences in life expectancy around the world. The developed world is generally aging, with the median age around 40 years. In the developing world the median age is between 15 and 20 years. Life expectancy at birth in Hong Kong is 84.8 years for a female and 78.9 for a male, while in Swaziland, primarily because of AIDS, it is 31.3 years for both sexes.[73] While one in five Europeans is 60 years of age or older, only one in twenty Africans is 60 years of age or older.[74] The number of centenarians (humans of age 100 years or older) in the world was estimated by the United Nations at 210,000 in 2002.[75] At least one person, Jeanne Calment, is known to have reached the age of 122 years; higher ages have been claimed but they are not well substantiated. Worldwide, there are 81 men aged 60 or older for every 100 women of that age group, and among the oldest, there are 53 men for every 100 women.

Diet

Humans are omnivorous, capable of consuming plant, animal, and inorganic material.[76][77] Varying with available food sources in regions of habitation, and also varying with cultural and religious norms, human groups have adopted a range of diets, from purely vegetarian to primarily carnivorous. In some cases, dietary restrictions in humans can lead to deficiency diseases; however, stable human groups have adapted to many dietary patterns through both genetic specialization and cultural conventions to use nutritionally balanced food sources.[78] The human diet is prominently reflected in human culture, and has led to the development of food science.

Until the development of agriculture approximately 10,000 years ago, Homo sapiens employed a hunter-gatherer method as their sole means of food collection. This involved combining stationary food sources (such as fruits, grains, tubers, and mushrooms, insect larvae and aquatic molluscs) with wild game, which must be hunted and killed in order to be consumed.[79] It has been proposed that members of H. sapiens have used fire to prepare and cook food since the time of their divergence from Homo rhodesiensis (which itself had previously speciated from Homo erectus).[80] Around ten thousand years ago, humans developed agriculture,[81] which substantially altered their diet. This change in diet may also have altered human biology; with the spread of dairy farming providing a new and rich source of food, leading to the evolution of the ability to digest lactose in some adults.[82][83] Agriculture led to increased populations, the development of cities, and because of increased population density, the wider spread of infectious diseases. The types of food consumed, and the way in which they are prepared, has varied widely by time, location, and culture.

In general, humans can survive for two to eight weeks without food, depending on stored body fat. Survival without water is usually limited to three or four days. About 36 million humans starve to death every year, due to lack of edible materials in their habitats.[84] Childhood malnutrition is also common and contributes to the global burden of disease.[85] However global food distribution is not even, and obesity among some human populations has increased rapidly, leading to health complications and increased mortality in some developed, and a few developing countries. Worldwide over one billion people are obese,[86] while in the United States 35% of people are obese, leading to this being described as an "obesity epidemic".[87] Obesity is caused by consuming more calories than are expended, so excessive weight gain is usually caused by a combination of an energy-dense high fat diet and insufficient exercise.[86]

Sleep

Humans are generally diurnal. The average sleep requirement is between seven and nine continuous hours a day for an adult and nine to ten hours for a child; elderly people usually sleep for six to seven hours. Experiencing less sleep than this is common in modern societies; this sleep deprivation can have negative effects. A sustained restriction of adult sleep to four hours per day has been shown to correlate with changes in physiology and mental state, including fatigue, aggression, and bodily discomfort.

Psychology

A sketch of the human brain imposed upon the profile of Michelangelo's David

The human brain, the focal point of the central nervous system in humans, controls the peripheral nervous system. In addition to controlling "lower", involuntary, or primarily autonomic activities such as respiration and digestion, it is also the locus of "higher" order functioning such as thought, reasoning, and abstraction.[88] These cognitive processes constitute the mind, and, along with their behavioral consequences, are studied in the field of psychology.

Generally regarded as more capable of these higher order activities, the human brain is believed to be more "intelligent" in general than that of any other known species. Some are capable of creating structures and using simple tools—mostly through instinct and mimicry—human technology is vastly more complex, and is constantly evolving and improving through time.

Although being vastly more advanced than many species in cognitive abilities, most of these abilities are known in primitive form among other species. Modern anthropology has tended to bear out Darwin's proposition that "the difference in mind between man and the higher animals, great as it is, certainly is one of degree and not of kind".[89]

Consciousness and thought

Humans are one of only nine species to pass the mirror test—which tests whether an animal recognizes its reflection as an image of itself—along with all the great apes (gorillas, chimpanzees, orangutans, bonobos), Bottlenose dolphins, Asian elephants, European Magpies, and Orcas.[90] Most human children will pass the mirror test at 18 months old.[91] However, the usefulness of this test as a true test of consciousness has been disputed, and this may be a matter of degree rather than a sharp divide. Monkeys have been trained to apply abstract rules in tasks.[92]

The human brain perceives the external world through the senses, and each individual human is influenced greatly by his or her experiences, leading to subjective views of existence and the passage of time. Humans are variously said to possess consciousness, self-awareness, and a mind, which correspond roughly to the mental processes of thought. These are said to possess qualities such as self-awareness, sentience, sapience, and the ability to perceive the relationship between oneself and one's environment. The extent to which the mind constructs or experiences the outer world is a matter of debate, as are the definitions and validity of many of the terms used above. The philosopher of cognitive science Daniel Dennett, for example, argues that there is no such thing as a narrative centre called the "mind", but that instead there is simply a collection of sensory inputs and outputs: different kinds of "software" running in parallel.[93] Psychologist B.F. Skinner argued that the mind is an explanatory fiction that diverts attention from environmental causes of behavior,[94] and that what are commonly seen as mental processes may be better conceived of as forms of covert verbal behavior.[95][96]

Humans study the more physical aspects of the mind and brain, and by extension of the nervous system, in the field of neurology, the more behavioral in the field of psychology, and a sometimes loosely defined area between in the field of psychiatry, which treats mental illness and behavioral disorders. Psychology does not necessarily refer to the brain or nervous system, and can be framed purely in terms of phenomenological or information processing theories of the mind. Increasingly, however, an understanding of brain functions is being included in psychological theory and practice, particularly in areas such as artificial intelligence, neuropsychology, and cognitive neuroscience.

The nature of thought is central to psychology and related fields. Cognitive psychology studies cognition, the mental processes' underlying behavior. It uses information processing as a framework for understanding the mind. Perception, learning, problem solving, memory, attention, language and emotion are all well researched areas as well. Cognitive psychology is associated with a school of thought known as cognitivism, whose adherents argue for an information processing model of mental function, informed by positivism and experimental psychology. Techniques and models from cognitive psychology are widely applied and form the mainstay of psychological theories in many areas of both research and applied psychology. Largely focusing on the development of the human mind through the life span, developmental psychology seeks to understand how people come to perceive, understand, and act within the world and how these processes change as they age. This may focus on intellectual, cognitive, neural, social, or moral development.

Some philosophers divide consciousness into phenomenal consciousness, which is experience itself, and access consciousness, which is the processing of the things in experience.[97] Phenomenal consciousness is the state of being conscious, such as when they say "I am conscious." Access consciousness is being conscious of something in relation to abstract concepts, such as when one says "I am conscious of these words." Various forms of access consciousness include awareness, self-awareness, conscience, stream of consciousness, Husserl's phenomenology, and intentionality. The concept of phenomenal consciousness, in modern history, according to some, is closely related to the concept of qualia. Social psychology links sociology with psychology in their shared study of the nature and causes of human social interaction, with an emphasis on how people think towards each other and how they relate to each other. The behavior and mental processes, both human and non-human, can be described through animal cognition, ethology, evolutionary psychology, and comparative psychology as well. Human ecology is an academic discipline that investigates how humans and human societies interact with both their natural environment and the human social environment.

Motivation and emotion

Motivation is the driving force of desire behind all deliberate actions of humans. Motivation is based on emotion—specifically, on the search for satisfaction (positive emotional experiences), and the avoidance of conflict. Positive and negative is defined by the individual brain state, which may be influenced by social norms: a person may be driven to self-injury or violence because their brain is conditioned to create a positive response to these actions. Motivation is important because it is involved in the performance of all learned responses. Within psychology, conflict avoidance and the libido are seen to be primary motivators. Within economics, motivation is often seen to be based on incentives; these may be financial, moral, or coercive. Religions generally posit divine or demonic influences.

Happiness, or the state of being happy, is a human emotional condition. The definition of happiness is a common philosophical topic. Some people might define it as the best condition that a human can have—a condition of mental and physical health. Others define it as freedom from want and distress; consciousness of the good order of things; assurance of one's place in the universe or society.

Emotion has a significant influence on, or can even be said to control, human behavior, though historically many cultures and philosophers have for various reasons discouraged allowing this influence to go unchecked. Emotional experiences perceived as pleasant, such as love, admiration, or joy, contrast with those perceived as unpleasant, like hate, envy, or sorrow. There is often a distinction made between refined emotions that are socially learned and survival oriented emotions, which are thought to be innate. Human exploration of emotions as separate from other neurological phenomena is worthy of note, particularly in cultures where emotion is considered separate from physiological state. In some cultural medical theories emotion is considered so synonymous with certain forms of physical health that no difference is thought to exist. The Stoics believed excessive emotion was harmful, while some Sufi teachers felt certain extreme emotions could yield a conceptual perfection, what is often translated as ecstasy.

In modern scientific thought, certain refined emotions are considered a complex neural trait innate in a variety of domesticated and non-domesticated mammals. These were commonly developed in reaction to superior survival mechanisms and intelligent interaction with each other and the environment; as such, refined emotion is not in all cases as discrete and separate from natural neural function as was once assumed. However, when humans function in civilized tandem, it has been noted that uninhibited acting on extreme emotion can lead to social disorder and crime.

Society and culture

Human society statistics
World population6.9 billion
Population density12.7 per km² (4.9 mi²) by total area
43.6 per km² (16.8 mi²) by land area
Largest agglomerationsBeijing, Bogotá, Buenos Aires, Cairo, Delhi, Dhaka, Guangzhou, Istanbul, Jakarta, Karachi, Kinshasa, Kolkata, Lagos, Lima, London, Los Angeles, Manila, Mexico City, Moscow, Mumbai, New York City, Osaka, Paris, Rio de Janeiro, São Paulo, Seoul, Shanghai, Shenzen, Tehran, Tianjin, Tokyo, Wuhan
Most widely spoken languages[98]Mandarin Chinese, English, Spanish, Arabic, Hindi, Bengali, Portuguese, Russian, Japanese, German, Javanese, Punjabi, Telugu, Vietnamese, Marathi, French, Korean, Tamil, Italian, Urdu, Marathi, Indonesian
Most popular religions[99]Christianity, Islam, Hinduism, Buddhism, Sikhism, Judaism, Baha'i
GDP (nominal)$36,356,240 million USD
($5,797 USD per capita)
GDP (PPP)$51,656,251 million IND
($8,236 per capita)

Humans are social beings. In comparisons with animalia, humans are regarded like the primates for their social qualities. But beyond any other creature, humans are adept at utilizing systems of communication for self-expression, the exchange of ideas, and organization, and as such have created complex social structures composed of many cooperating and competing groups. Human groups range from families to nations. Social interactions between humans have established an extremely wide variety of values, social norms, and rituals, which together form the basis of human society.

Culture is defined here as patterns of complex symbolic behavior, i.e. all behavior that is not innate but which has to be learned through social interaction with others; such as the use of distinctive material and symbolic systems, including language, ritual, social organization, traditions, beliefs and technology.

Sexuality and love

Human sexuality, besides ensuring biological reproduction, has important social functions: it creates physical intimacy, bonds, and hierarchies among individuals; and in a hedonistic sense to the enjoyment of activity involving sexual gratification. Sexual desire, or libido, is experienced as a bodily urge, often accompanied by strong emotions such as love, ecstasy and jealousy. The extreme importance of sexuality in the human species can be seen in a number of physical features, among them hidden ovulation, the evolution of external scrotum and penis suggesting sperm competition, the absence of an os penis, permanent secondary sexual characteristics, the forming of pair bonds based on sexual attraction as a common social structure and sexual ability in females outside of ovulation. These adaptations indicate that the importance of sexuality in humans is on a par with that found in the Bonobo, and that the complex human sexual behaviour has a long evolutionary history.

Human choices in acting on sexuality are commonly influenced by cultural norms, which vary widely. Restrictions are often determined by religious beliefs or social customs. The pioneering researcher Sigmund Freud believed that humans are born polymorphously perverse, which means that any number of objects could be a source of pleasure. According to Freud, humans then pass through five stages of psychosexual development (and can fixate on any stage because of various traumas during the process). For Alfred Kinsey, another influential sex researcher, people can fall anywhere along a continuous scale of sexual orientation (with only small minorities fully heterosexual or homosexual). Recent studies of neurology and genetics suggest people may be born predisposed to various sexual tendencies.[100][101]

Gender roles

The sexual division of humans into male and female has been marked culturally by a corresponding division of roles, norms, practices, dress, behavior, rights, duties, privileges, status, and power. Cultural differences by gender have often been believed to have arisen naturally out of a division of reproductive labor; the biological fact that women give birth led to their further cultural responsibility for nurturing and caring for children and households. Gender roles have varied historically, and challenges to predominant gender norms have recurred in many societies. As a whole, patriarchal societies (i.e., in which men hold the greater degree of economic and political power) have been predominant, and matriarchal or egalitarian societies less common. [102][103][104][105]

Society, government, and politics

The United Nations complex in New York City, which houses one of the largest political organizations in the world.

Society is the system of organizations and institutions arising from interaction between humans. A state is an organized political community occupying a definite territory, having an organized government, and possessing internal and external sovereignty. Recognition of the state's claim to independence by other states, enabling it to enter into international agreements, is often important to the establishment of its statehood. The "state" can also be defined in terms of domestic conditions, specifically, as conceptualized by Max Weber, "a state is a human community that (successfully) claims the monopoly of the 'legitimate' use of physical force within a given territory."[106]

Government can be defined as the political means of creating and enforcing laws; typically via a bureaucratic hierarchy. Politics is the process by which decisions are made within groups; this process often involves conflict as well as compromise. Although the term is generally applied to behavior within governments, politics is also observed in all human group interactions, including corporate, academic, and religious institutions. Many different political systems exist, as do many different ways of understanding them, and many definitions overlap. Examples of governments include monarchy, Communist state, military dictatorship, theocracy, and liberal democracy, the last of which is considered dominant today. All of these issues have a direct relationship with economics.

Trade and economics

Buyers and sellers bargain in a market.

Trade is the voluntary exchange of goods and services, and is a form of economics. A mechanism that allows trade is called a market. The original form of trade was barter, the direct exchange of goods and services. Modern traders instead generally negotiate through a medium of exchange, such as money. As a result, buying can be separated from selling, or earning. The invention of money (and later credit, paper money and non-physical money) greatly simplified and promoted trade. Because of specialization and division of labor, most people concentrate on a small aspect of manufacturing or service, trading their labour for products. Trade exists between regions because different regions have an absolute or comparative advantage in the production of some tradable commodity, or because different regions' size allows for the benefits of mass production.

Economics is a social science which studies the production, distribution, trade, and consumption of goods and services. Economics focuses on measurable variables, and is broadly divided into two main branches: microeconomics, which deals with individual agents, such as households and businesses, and macroeconomics, which considers the economy as a whole, in which case it considers aggregate supply and demand for money, capital and commodities. Aspects receiving particular attention in economics are resource allocation, production, distribution, trade, and competition. Economic logic is increasingly applied to any problem that involves choice under scarcity or determining economic value. Mainstream economics focuses on how prices reflect supply and demand, and uses equations to predict consequences of decisions.

Race and ethnicity

A collection of mugshots showing multiple races

Humans often categorize themselves in terms of race or ethnicity, sometimes on the basis of differences in appearance. Human racial categories have been based on both ancestry and visible traits, especially facial features, skin color and hair texture. Most current genetic and archaeological evidence supports a recent single origin of modern humans in East Africa.[107] Current genetic studies have demonstrated that humans on the African continent are most genetically diverse.[108] However, compared to the other great apes, human gene sequences are remarkably homogeneous.[109][110][111][112] The predominance of genetic variation occurs within racial groups, with only 5 to 15% of total variation occurring between groups.[113] Thus the scientific concept of variation in the human genome is largely incongruent with the cultural concept of ethnicity or race.  Ethnic groups are defined by linguistic, cultural, ancestral, national or regional ties. Self-identification with an ethnic group is usually based on kinship and descent. Race and ethnicity are among major factors in social identity giving rise to various forms of identity politics, e.g., racism. (Humans have turned to violence and social exclusion as part of their identity politics; a side effect is name-calling, which has produced numerous offensive terms for humans.)

There is no scientific consensus of a list of the human races, and few anthropologists endorse the notion of human "race".[114] For example, a color terminology for race includes the following in a classification of human races: Black (e.g. Sub-Saharan Africa), Red (e.g. Native Americans), Yellow (e.g. East Asians) and White (e.g. Europeans).

Referring to natural species, in general, the term "race" is obsolete, particularly if a species is uniformly distributed on a territory. In its modern scientific connotation, the term is not applicable to a species as genetically homogeneous as the human one, as stated in the declaration on race (UNESCO 1950).[115]

Genetic studies have substantiated the absence of clear biological borders, thus the term "race" is rarely used in scientific terminology, both in biological anthropology and in human genetics.[citation needed]

What in the past had been defined as "races"—e.g., whites, blacks, or Asians—are now defined as "ethnic groups" or "populations", in correlation with the field (sociology, anthropology, genetics) in which they are considered.[citation needed]

War

The atomic bombings of Hiroshima and Nagasaki immediately killed over 120,000 humans.

War is a state of widespread conflict between states or other large groups of humans, which is characterized by the use of lethal violence between combatants and/or upon civilians. (Humans also engage in lesser conflicts, such as brawls, riots, revolts, and melees. A revolution may or may not involve warfare.) It is estimated that during the 20th century between 167 and 188 million humans died as a result of war.[116] A common perception of war is a series of military campaigns between at least two opposing sides involving a dispute over sovereignty, territory, resources, religion, or other issues. A war between internal elements of a state is a civil war.

There have been a wide variety of rapidly advancing tactics throughout the history of war, ranging from conventional war to asymmetric warfare to total war and unconventional warfare. Techniques include hand to hand combat, the use of ranged weapons, Naval warfare, and, more recently, air support. Military intelligence has often played a key role in determining victory and defeat. Propaganda, which often includes information, slanted opinion and disinformation, plays a key role in maintaining unity within a warring group, and/or sowing discord among opponents. In modern warfare, soldiers and armoured fighting vehicles are used to control the land, warships the sea, and aircraft the sky. These fields have also overlapped in the forms of marines, paratroopers, naval aircraft carriers, and surface-to-air missiles, among others. Satellites in low Earth orbit have made outer space a factor in warfare as well as it is used for detailed intelligence gathering, however no known aggressive actions have been taken from space.

Material culture and technology

An archaic Acheulean stone tool

Stone tools were used by proto-humans at least 2.5 million years ago.[117] The controlled use of fire began around 1.5 million years ago. Since then, humans have made major advances, developing complex technology to create tools to aid their lives and allowing for other advancements in culture. Major leaps in technology include the discovery of agriculture – what is known as the Neolithic Revolution; and the invention of automated machines in the Industrial Revolution.

Archaeology attempts to tell the story of past or lost cultures in part by close examination of the artifacts they produced. Early humans left stone tools, pottery, and jewelry that are particular to various regions and times.

Language

The capacity humans have to transfer concepts, ideas and notions through speech and writing is unrivaled in known species. Unlike the call systems of other primates that are closed, human language is far more open, and gains variety in different situations. The human language has the quality of displacement, using words to represent things and happenings that are not presently or locally occurring, but elsewhere or at a different time.[63] In this way data networks are important to the continuing development of language. The faculty of speech is a defining feature of humanity, possibly predating phylogenetic separation of the modern population. Language is central to the communication between humans, as well as being central to the sense of identity that unites nations, cultures and ethnic groups. The invention of writing systems at least 5,000 years ago allowed the preservation of language on material objects, and was a major step in cultural evolution. The science of linguistics describes the structure of language and the relationship between languages. There are approximately 6,000 different languages currently in use, including sign languages, and many thousands more that are considered extinct.

Spirituality and religion

Religion is generally defined as a belief system concerning the supernatural, sacred or divine, and practices, values, institutions and rituals associated with such belief. Some religions also have a moral code. The evolution and the history of the first religions have recently become areas of active scientific investigation.[118][119][120] However, in the course of its development, religion has taken on many forms that vary by culture and individual perspective. Some of the chief questions and issues religions are concerned with include life after death (commonly involving belief in an afterlife), the origin of life, the nature of the universe (religious cosmology) and its ultimate fate (eschatology), and what is moral or immoral. A common source in religions for answers to these questions are beliefs in transcendent divine beings such as deities or a singular God, although not all religions are theistic—many are nontheistic or ambiguous on the topic, particularly among the Eastern religions. Spirituality, belief or involvement in matters of the soul or spirit, is one of the many different approaches humans take in trying to answer fundamental questions about humankind's place in the universe, the meaning of life, and the ideal way to live one's life. Though these topics have also been addressed by philosophy, and to some extent by science, spirituality is unique in that it focuses on mystical or supernatural concepts such as karma and God.

Although the exact level of religiosity can be hard to measure,[121] a majority of humans professes some variety of religious or spiritual belief, although some are irreligious: that is lacking or rejecting belief in the supernatural or spiritual. Other humans have no religious beliefs and are atheists, scientific skeptics, agnostics or simply non-religious. Humanism is a philosophy which seeks to include all of humanity and all issues common to humans; it is usually non-religious. Additionally, although most religions and spiritual beliefs are clearly distinct from science on both a philosophical and methodological level, the two are not generally considered mutually exclusive; a majority of humans holds a mix of both scientific and religious views. The distinction between philosophy and religion, on the other hand, is at times less clear, and the two are linked in such fields as the philosophy of religion and theology.

Philosophy and self-reflection

Philosophy is a discipline or field of study involving the investigation, analysis, and development of ideas at a general, abstract, or fundamental level. It is the discipline searching for a general understanding of reality, reasoning and values. Major fields of philosophy include logic, metaphysics, epistemology, philosophy of mind, and axiology (which includes ethics and aesthetics). Philosophy covers a very wide range of approaches, and is used to refer to a worldview, to a perspective on an issue, or to the positions argued for by a particular philosopher or school of philosophy.

Art, music, and literature

Allegory of Music (ca. 1594), a painting of a woman writing sheet music by Lorenzo Lippi

Artistic works have existed for almost as long as humankind, from early pre-historic art to contemporary art. Art is one of the most unusual aspects of human behaviour and a key distinguishing feature of humans from other species.

As a form of cultural expression by humans, art may be defined by the pursuit of diversity and the usage of narratives of liberation and exploration (i.e. art history, art criticism, and art theory) to mediate its boundaries. This distinction may be applied to objects or performances, current or historical, and its prestige extends to those who made, found, exhibit, or own them. In the modern use of the word, art is commonly understood to be the process or result of making material works that, from concept to creation, adhere to the "creative impulse" of human beings. Art is distinguished from other works by being in large part unprompted by necessity, by biological drive, or by any undisciplined pursuit of recreation.

Music is a natural intuitive phenomenon based on the three distinct and interrelated organization structures of rhythm, harmony, and melody. Listening to music is perhaps the most common and universal form of entertainment for humans, while learning and understanding it are popular disciplines. There are a wide variety of music genres and ethnic musics. Literature, the body of written—and possibly oral—works, especially creative ones, includes prose, poetry and drama, both fiction and non-fiction. Literature includes such genres as epic, legend, myth, ballad, and folklore.

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. ISBN 0-801-88221-4. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100795. 
  2. ^ Global Mammal Assessment Team (2008). Homo sapiens. In: IUCN 2009. IUCN Red List of Threatened Species. Version 2009.2. <www.iucnredlist.org>. Downloaded on 03 March 2010.
  3. ^ Goodman M, Tagle D, Fitch D, Bailey W, Czelusniak J, Koop B, Benson P, Slightom J (1990). "Primate evolution at the DNA level and a classification of hominoids". J Mol Evol 30 (3): 260–266. doi:10.1007/BF02099995. PMID 2109087. 
  4. ^ "Hominidae Classification". Animal Diversity Web @ UMich. http://animaldiversity.ummz.umich.edu/site/accounts/classification/Hominidae.html. Retrieved 2006-09-25. 
  5. ^ hŏmo, săpĭens, săpĭo. Charlton T. Lewis and Charles Short. A Latin Dictionary on Perseus Project.
  6. ^ "Human Evolution by The Smithsonian Institution's Human Origins Program". Human Origins Initiative. Smithsonian Institution. http://www.mnh.si.edu/anthro/humanorigins/ha/sap.htm. Retrieved 2010-08-30. 
  7. ^ Dependent Rational Animals: Why Human Beings Need the Virtues By Alasdair MacIntyre pp. 60, "But this [language] is insufficient for human rationality, What is needed in addition is the ability to construct sentences that contain as constituents either the sentences use to express the judgment about which the agent is reflecting, or references to those sentences."
  8. ^ John McDowell, Mind and World, 1994. p.115, Harvard University Press, (quoted in Dependent Rational Animals, by Alasdair MacIntyre): "In mere animals, sentience is in the service of a mode of life that is structured exclusively by immediate biological imperatives" [..] "merely animal life is shaped by goals whose control of the animal's behavior at a given moment is an immediate outcome of biological forces"
  9. ^ The Really Hard Problem:Meaning in a Material World, Owen Flanagan, MIT Press
  10. ^ Dependent Rational Animals: Why Human Beings Need the Virtues By Alasdair MacIntyre pp. 60, "Those who have wanted to draw a single sharp line between human and nonhuman animals have commonly laid emphasis upon the presence or absence of language as such, the ability to use and to respond to strings of syntactically ordered and semantically significant expressions whose utterance constitutes speech acts. But this is insufficient for human rationality. What is needed in addition.."
  11. ^ Nature vs. Nurture: The Miracle of Language, by Malia Knezek. "What about the fact that other animals do not have similar language capabilities? [..] This obviously involves some innate difference between humans and other animals.. [..] ..other animals do not use any other form of language (i.e. sign language) even though they have the physiological capabilities." citing, Andy Clark. Being There: Putting Brain, Body, and World Together Again. The MIT Press, 1997. 208-209).
  12. ^ "World POPClock Projection". United States Census Bureau, Population Division/International Programs Center. http://www.census.gov/ipc/www/popclockworld.html. Retrieved 2011-01-07. 
  13. ^ OED, s.v. "human".
  14. ^ The OED considers obsolete the sense "a designation applied equally to particular individuals of either sex", citing a 1597 source as the most recent (The Lord had but one paire of men in Paradise.) while it continues to endorse the sense "as a general or indefinite designation" as current in English.
  15. ^ Porkorny (1959) s.v. "g'hðem" pp. 414–416; "Homo." Dictionary.com Unabridged (v 1.1). Random House, Inc. 23 Sep. 2008. "Homo". Dictionary.com. http://dictionary.reference.com/browse/Homo. 
  16. ^ Human evolution: the fossil evidence in 3D, by Philip L. Walker and Edward H. Hagen, Dept. of Anthropology, University of California, Santa Barbara. Retrieved April 5, 2005.
  17. ^ Green, R. E., Krause, J, Ptak, S. E., Briggs, A. W., Ronan, M. T., Simons, J. F., et al. (2006). Analysis of one million base pairs of Neanderthal DNA. Nature. pp. 16, 330–336. http://www.nature.com/nature/journal/v444/n7117/abs/nature05336.html. 
  18. ^ nsf.gov - National Science Foundation (NSF) News - New Clues Add 40,000 Years to Age of Human Species - US National Science Foundation (NSF)
  19. ^ "Age of ancient humans reassessed". BBC News. February 16, 2005. http://news.bbc.co.uk/2/hi/science/nature/4269299.stm. Retrieved April 10, 2010. 
  20. ^ The Oldest Homo Sapiens: – URL retrieved May 15, 2009
  21. ^ Alemseged, Z., Coppens, Y., Geraads, D. (2002). "Hominid cranium from Homo: Description and taxonomy of Homo-323-1976-896". Am J Phys Anthropol 117 (2): 103–12. doi:10.1002/ajpa.10032. PMID 11815945. 
  22. ^ Stoneking, Mark; Soodyall, Himla (1996). "Human evolution and the mitochondrial genome". Current Opinion in Genetics & Development 6 (6): 731–6. doi:10.1016/S0959-437X(96)80028-1. 
  23. ^ BBC World News "Africa's genetic secrets unlocked", 1 May 2009; the results were published in the online edition of the journal Science.
  24. ^ a b Wood B, Richmond BG (July 2000). "Human evolution: taxonomy and paleobiology". J. Anat. 197 ( Pt 1): 19–60. doi:10.1046/j.1469-7580.2000.19710019.x. PMID 10999270. 
  25. ^ Frans de Waal, Bonobo. Berkeley: University of California Press, 1997. ISBN 0-520-20535-9 [1]
  26. ^ Britten RJ (2002). "Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels". Proc Natl Acad Sci USA 99 (21): 13633–5. doi:10.1073/pnas.172510699. PMID 12368483. PMC 129726. http://www.pnas.org/cgi/content/full/99/21/13633. 
  27. ^ Wildman, D., Uddin, M., Liu, G., Grossman, L., Goodman, M. (2003). "Implications of natural selection in shaping 99.4% nonsynonymous DNA identity between humans and chimpanzees: enlarging genus Homo". Proc Natl Acad Sci USA 100 (12): 7181–8. doi:10.1073/pnas.1232172100. PMID 12766228. PMC 165850. http://www.pnas.org/cgi/content/full/100/12/7181. 
  28. ^ Ruvolo M (1 March 1997). "Molecular phylogeny of the hominoids: inferences from multiple independent DNA sequence data sets". Mol Biol Evol 14 (3): 248–65. PMID 9066793. http://mbe.oxfordjournals.org/cgi/reprint/14/3/248. 
  29. ^ Brunet, M., Guy, F., Pilbeam, D., Mackaye, H., Likius, A., Ahounta, D., Beauvilain, A., Blondel, C., Bocherens, H., Boisserie, J., De Bonis, L., Coppens, Y., Dejax, J., Denys, C., Duringer, P., Eisenmann, V., Fanone, G., Fronty, P., Geraads, D., Lehmann, T., Lihoreau, F., Louchart, A., Mahamat, A., Merceron, G., Mouchelin, G., Otero, O., Pelaez Campomanes, P., Ponce De Leon, M., Rage, J., Sapanet, M., Schuster, M., Sudre, J., Tassy, P., Valentin, X., Vignaud, P., Viriot, L., Zazzo, A., Zollikofer, C. (2002). "A new hominid from the Upper Miocene of Chad, Central Africa". Nature 418 (6894): 145–51. doi:10.1038/nature00879. PMID 12110880. http://www.nature.com/nature/journal/v418/n6894/full/nature00879.html. 
  30. ^ Vančata1 V., & Vančatová, M. A. "Major features in the evolution of early hominoid locomotion". Springer Netherlands, Volume 2, Number 6, December 1987. pp.517–537.
  31. ^ Brues, Alice M. & Snow, Clyde C. "Physical Anthropology". Biennial Review of Anthropology, Vol. 4, 1965. pp. 1–39.
  32. ^ Boyd, Robert & Silk, Joan B. (2003). How Humans Evolved. New York: Norton & Company. ISBN 0-393-97854-0.
  33. ^ Dobzhansky, Theodosius (1963). Anthropology and the natural sciences-The problem of human evolution, Current Anthropology '4 (2): 138–148.
  34. ^ Wade, N (2006-03-07). "Still Evolving, Human Genes Tell New Story". The New York Times. http://www.nytimes.com/2006/03/07/science/07evolve.html. Retrieved 2008-07-10. 
  35. ^ Wolman, David (2008). "Fossil Feces Is Earliest Evidence of N. America Humans" National Geographic
  36. ^ Dr. D.R.Johnson. "Human Evolution : Lower and Middle Pleistocene - Homo erectus and Homo sapiens : Lecture 1 of 6". Faculty of Biological Sciences, University of Leeds. 
  37. ^ How Neanderthals met a grisly fate: devoured by humans. The Observer. May 17, 2009.
  38. ^ Eswaran V, Harpending H, Rogers AR (July 2005). "Genomics refutes an exclusively African origin of humans". J. Hum. Evol. 49 (1): 1–18. doi:10.1016/j.jhevol.2005.02.006. PMID 15878780. 
  39. ^ Supervolcanoes, BBC2, 3 February 2000
  40. ^ "Internet Usage Statistics - The Internet Big Picture". internetworldstats.com/. http://www.internetworldstats.com/stats.htm. Retrieved 19 November 2010. 
  41. ^ "Reuters homepage". Reuters. http://investing.reuters.co.uk/news/articleinvesting.aspx?type=media&storyID=nL29172095. Retrieved 19 November 2010. 
  42. ^ Pimm S, Raven P, Peterson A, Sekercioglu CH, Ehrlich PR (2006). "Human impacts on the rates of recent, present, and future bird extinctions". Proc. Natl. Acad. Sci. U.S.A. 103 (29): 10941–6. doi:10.1073/pnas.0604181103. PMID 16829570. 
    *Barnosky AD, Koch PL, Feranec RS, Wing SL, Shabel AB (2004). "Assessing the causes of late Pleistocene extinctions on the continents". Science 306 (5693): 70–5. doi:10.1126/science.1101476. PMID 15459379. 
  43. ^ Lewis OT (2006). "Climate change, species-area curves and the extinction crisis" (PDF). Philos. Trans. R. Soc. Lond., B, Biol. Sci. 361 (1465): 163–71. doi:10.1098/rstb.2005.1712. PMID 16553315. PMC 1831839. http://www.journals.royalsoc.ac.uk/content/711761513317h856/fulltext.pdf. 
  44. ^ Whitehouse, David. "World's population reaches six billion". BBC News, August 05, 1999. Retrieved on February 05, 2008.
  45. ^ Half of humanity set to go urban, BBC News
  46. ^ Urban, Suburban, and Rural Victimization, 1993–98 U.S. Department of Justice, Bureau of Justice Statistics,. Accessed 29 Oct 2006
  47. ^ Scientific American (1998). Evolution and General Intelligence: Three hypotheses on the evolution of general intelligence.
  48. ^ "Climate Change 2001: Working Group I: The Scientific Basis". grida.no/. http://www.grida.no/climate/ipcc_tar/wg1/007.htm. Retrieved 2007-05-30. 
  49. ^ American Association for the Advancement of Science. Foreword. AAAS Atlas of Population & Environment.
  50. ^ Wilson, E.O. (2002). in The Future of Life.
  51. ^ de Beer H (2004). "Observations on the history of Dutch physical stature from the late-Middle Ages to the present". Econ Hum Biol 2 (1): 45–55. doi:10.1016/j.ehb.2003.11.001. PMID 15463992. 
  52. ^ "Pygmy". Pygmy. Answers.com. 2006. http://www.answers.com/topic/pygmy. Retrieved 30 October 2006. 
  53. ^ Human weight – ArticleWorld
  54. ^ Why Humans and Their Fur Parted Way by Nicholas Wade, New York Times, August 19, 2003.
  55. ^ Rogers, Alan R., Iltis, David & Wooding, Stephen (2004). "Genetic variation at the MC1R locus and the time since loss of human body hair". Current Anthropology 45 (1): 105–108. doi:10.1086/381006. 
  56. ^ Jablonski, N.G. & Chaplin, G. (2000). The evolution of human skin coloration (pdf), 'Journal of Human Evolution 39: 57–106.
  57. ^ Harding RM, Healy E, Ray AJ, et al. (April 2000). "Evidence for variable selective pressures at MC1R". Am. J. Hum. Genet. 66 (4): 1351–61. doi:10.1086/302863. PMID 10733465. 
  58. ^ Robin, Ashley (1991). Biological Perspectives on Human Pigmentation. Cambridge: Cambridge University Press.
  59. ^ Schwartz, Jeffrey (1987). The Red Ape: Orangutans and Human Origins. Cambridge, MA: Westview Press. p. 286. ISBN 0813340640. 
  60. ^ Parker-Pope, Tara (October 27, 2009). "The Human Body Is Built for Distance". The New York Times. http://www.nytimes.com/2009/10/27/health/27well.html. 
  61. ^ Were Neanderthals stoned to death by modern humans? - life - 20 November 2008 - New Scientist
  62. ^ Page 3 in Chemical storylines. Author: George Burton. Edition 2, illustrated. Publisher: Heinemann, 2000. ISBN 0-435-63119-5, 9780435631192. Length: 312 pages
  63. ^ a b Collins, Desmond (1976). The Human Revolution: From Ape to Artist. p. 208. 
  64. ^ According to the July 2, 2007 Newsweek magazine, a woman dies in childbirth every minute, most often due to uncontrolled bleeding and infection, with the world's poorest women most vulnerable. The lifetime risk is 1 in 16 in sub-Saharan Africa, compared to 1 in 2,800 in developed countries.
  65. ^ LaVelle M (1995). "Natural selection and developmental sexual variation in the human pelvis". Am J Phys Anthropol 98 (1): 59–72. doi:10.1002/ajpa.1330980106. PMID 8579191. 
  66. ^ Correia H, Balseiro S, De Areia M (2005). "Sexual dimorphism in the human pelvis: testing a new hypothesis". Homo 56 (2): 153–60. doi:10.1016/j.jchb.2005.05.003. PMID 16130838. 
  67. ^ Rush D (2000). "Nutrition and maternal mortality in the developing world". Am J Clin Nutr 72 (1 Suppl): 212 S–240 S. PMID 10871588. 
  68. ^ "Low Birthweight". Archived from the original on May 13, 2007. http://web.archive.org/web/20070513150431/http://www.childinfo.org/areas/birthweight/. Retrieved 2007-05-30. 
  69. ^ Khor G (2003). "Update on the prevalence of malnutrition among children in Asia". Nepal Med Coll J 5 (2): 113–22. PMID 15024783. 
  70. ^ Leakey, Richard; Lewin, Roger. Origins Reconsidered – In Search of What Makes Us Human. Sherma B.V., 1992.
  71. ^ Diamond, Jared (1997). Why is Sex Fun? The Evolution of Human Sexuality. Basic Books. pp. 167–170. ISBN ISBN 0-465-03127-7. 
  72. ^ Peccei, J.S. (2001). "Menopause: Adaptation or Epiphenomenon?". Evolutionary Anthropology 10: 47–57. http://www.biology.ed.ac.uk/public/conferences/evolbiol2006/papers/Peccei.pdf. 
  73. ^ "Human Development Report 2006," United Nations Development Programme, pp. 363–366, November 9, 2006
  74. ^ The World Factbook, U.S. Central Intelligence Agency. Retrieved April 2, 2005.
  75. ^ U.N. Statistics on Population Ageing, United Nations press release, February 28, 2002. Retrieved April 2, 2005.
  76. ^ Haenel H (1989). "Phylogenesis and nutrition". Nahrung 33 (9): 867–87. PMID 2697806. 
  77. ^ Cordain, Loren (2007). "Implications of Plio-pleistocene diets for modern humans". In Peter S. Ungar. Evolution of the human diet: the known, the unkown and the unknowable. pp. p 264-5. ""Since the evolutionary split between hominins and pongids approximately 7 million years ago, the available evidence shows that all species of hominins ate an omnivorous diet composed of minimally processed, wild-plant, and animal foods." 
  78. ^ American Dietetic, Association; Dietitians Of, Canada (2003). "Vegetarian Diets". Journal of the American Dietetic Association 103 (6): 748–765. doi:10.1053/jada.2003.50142. PMID 12778049. online copy available
  79. ^ Cordain L, Eaton SB, Sebastian A, et al. (February 2005). "Origins and evolution of the Western diet: health implications for the 21st century". Am. J. Clin. Nutr. 81 (2): 341–54. PMID 15699220. 
  80. ^ Ulijaszek SJ (November 2002). "Human eating behaviour in an evolutionary ecological context". Proc Nutr Soc 61 (4): 517–26. doi:10.1079/PNS2002180. PMID 12691181. 
  81. ^ Earliest agriculture in the Americas Earliest cultivation of barley Earliest cultivation of figs – URLs retrieved February 19, 2007
  82. ^ Krebs JR (September 2009). "The gourmet ape: evolution and human food preferences". Am. J. Clin. Nutr. 90 (3): 707S–711S. doi:10.3945/ajcn.2009.27462B. PMID 19656837. 
  83. ^ Holden C, Mace R (October 1997). "Phylogenetic analysis of the evolution of lactose digestion in adults". Hum. Biol. 69 (5): 605–28. PMID 9299882. 
  84. ^ United Nations Information Service. “Independent Expert On Effects Of Structural Adjustment, Special Rapporteur On Right To Food Present Reports: Commission Continues General Debate On Economic, Social And Cultural Rights”. United Nations, March 29, 2004, p. 6. “Around 36 million people died from hunger directly or indirectly every year.”.
  85. ^ Murray C, Lopez A (1997). "Global mortality, disability, and the contribution of risk factors: Global Burden of Disease Study". Lancet 349 (9063): 1436–42. doi:10.1016/S0140-6736(96)07495-8. PMID 9164317. 
  86. ^ a b Haslam DW, James WP (October 2005). "Obesity". Lancet 366 (9492): 1197–209. doi:10.1016/S0140-6736(05)67483-1. PMID 16198769. 
  87. ^ Catenacci VA, Hill JO, Wyatt HR (September 2009). "The obesity epidemic". Clin. Chest Med. 30 (3): 415–44, vii. doi:10.1016/j.ccm.2009.05.001. PMID 19700042. 
  88. ^ 3-D Brain Anatomy, The Secret Life of the Brain, Public Broadcasting Service. Retrieved April 3, 2005.
  89. ^ Jonathan Benthall (April 2007 :1). Animal liberation and rights. blackwell-synergy.com. p. 23/2. http://www.blackwell-synergy.com/doi/abs/10.1111/j.1467-8322.2007.00494.x. 
  90. ^ Robert W. Allan explores a few of these experiments on his webpage "?". Lafayette College. http://ww2.lafayette.edu/~allanr/mirror.html. [dead link]
  91. ^ Dr. Jack Palmer. "Consciousness and the Symbolic Universe". http://www.ulm.edu/~palmer/ConsciousnessandtheSymbolicUniverse.htm. Retrieved March 17, 2006. 
  92. ^ Researchers home in on how brain handles abstract thought – retrieved July 29, 2006
  93. ^ Dennett, Daniel (1991). Consciousness Explained. Little Brown & Co, 1991, ISBN 0-316-18065-3.
  94. ^ Skinner, B.F. About Behaviorism 1974, page 74–75
  95. ^ Skinner, B.F. About Behaviorism, Chapter 7: Thinking
  96. ^ A thesis against which Noam Chomsky advanced a considerable polemic.
  97. ^ Ned Block: On a Confusion about a Function of Consciousness in: The Behavioral and Brain Sciences, 1995.
  98. ^ [2]
  99. ^ [3]
  100. ^ Buss, David M. (2004) "The Evolution of Desire: Strategies of Human Mating". Revised Edition. New York: Basic Books"
  101. ^ Thornhill, R., & Palmer, C. T. (2000). A Natural History of Rape. Biological Bases of Sexual Coercion. Cambridge: MIT Press.
  102. ^ Robert Connell, Gender and power: society, the person, and sexual politics Stanford University Press, 1987, p. 145
  103. ^ Steven Goldberg, The Inevitability of Patriarchy, (William Morrow & Company, 1973).
  104. ^ Joan Bamberger,'The Myth of Matriarchy: Why Men Rule in Primitive Society', in M Rosaldo and L Lamphere, Women, Culture, and Society, Stanford, California: Stanford University Press, 1974, pp. 263-280.
  105. ^ Modern Matriarchal Studies Definitions, Scope and Topicality - Heide Goettner-Abendroth
  106. ^ Max Weber's definition of the modern state 1918, by Max Weber, 1918. Retrieved March 17, 2006.
  107. ^ Hua Liu, et al. (2006). "A Geographically Explicit Genetic Model of Worldwide Human-Settlement History" (– Scholar search). The American Journal of Human Genetics 79 (2): 230–237. doi:10.1086/505436. PMID 16826514. PMC 1559480. http://www.journals.uchicago.edu/AJHG/journal/issues/v79n2/43550/43550.html. [dead link]
  108. ^ Jorde L, Watkins W, Bamshad M, Dixon M, Ricker C, Seielstad M, Batzer M (2000). "The distribution of human genetic diversity: a comparison of mitochondrial, autosomal, and Y-chromosome data". Am J Hum Genet 66 (3): 979–88. doi:10.1086/302825. PMID 10712212. 
  109. ^ Race, Ethnicity, and Genetics Working Group (October 2005). "The use of racial, ethnic, and ancestral categories in human genetics research". Am. J. Hum. Genet. 77 (4): 519–32. doi:10.1086/491747. PMID 16175499. 
  110. ^ Bamshad M, Wooding S, Salisbury BA, Stephens JC (August 2004). "Deconstructing the relationship between genetics and race". Nat. Rev. Genet. 5 (8): 598–609. doi:10.1038/nrg1401. PMID 15266342. 
  111. ^ Tishkoff SA, Kidd KK (November 2004). "Implications of biogeography of human populations for 'race' and medicine". Nat. Genet. 36 (11 Suppl): S21–7. doi:10.1038/ng1438. PMID 15507999. 
  112. ^ Jorde LB, Wooding SP (November 2004). "Genetic variation, classification and 'race'". Nat. Genet. 36 (11 Suppl): S28–33. doi:10.1038/ng1435. PMID 15508000. 
  113. ^ Race, Ethnicity, and Genetics Working Group (2005). "The use of racial, ethnic, and ancestral categories in human genetics research". Am J Hum Genet 77 (4): 519–32. doi:10.1086/491747. PMID 16175499. 
  114. ^ "Human Races: A Genetic and Evolutionary Perspective", Alan R. Templeton, American Anthropologist, New Series, Vol. 100, No. 3 (Sep., 1998), pp. 632–650
  115. ^ Unseco Publication 791
  116. ^ Ferguson, Niall. "The Next War of the World." Foreign Affairs, Sep/Oct 2006
  117. ^ Clark JD, de Heinzelin J, Schick KD, et al. (June 1994). "African Homo erectus: old radiometric ages and young Oldowan assemblages in the Middle Awash Valley, Ethiopia". Science (journal) 264 (5167): 1907–10. doi:10.1126/science.8009220. PMID 8009220. 
  118. ^ "Evolutionary Religious Studies: A New Field of Scientific Inquiry". http://evolution.binghamton.edu/religion/. 
  119. ^ Boyer P (October 2008). "Being human: Religion: bound to believe?". Nature 455 (7216): 1038–9. doi:10.1038/4551038a. PMID 18948934. 
  120. ^ R.F, Robert A.; Paloutzian, Raymond F. (2003). "The psychology of religion". Annual Review of Psychology 54 (1): 377–402. doi:10.1146/annurev.psych.54.101601.145024. PMID 12171998. 
  121. ^ Hall DE, Meador KG, Koenig HG (June 2008). "Measuring religiousness in health research: review and critique". J Relig Health 47 (2): 134–63. doi:10.1007/s10943-008-9165-2. PMID 19105008. 
  • Freeman, Scott; Jon C. Herron, Evolutionary Analysis (4th ed.) Pearson Education, Inc., 2007. ISBN 0-13-227584-8 pages 757–761.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!