Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Description

A member of the Molossidae family, the Brazilian free-tailed bat has the characteristic mouse-like tail protruding beyond the flight membrane stretched between its hind legs. Relatively plain when compared to many bats, this species has brown fur, large ears that are nearly square, and a strongly wrinkled upper lip. However, it is superbly adapted to its aerial lifestyle, having long, narrow wings with pointed tips to enable very fast flight, and long hairs on the toes to judge flight speed and turbulence. The hind legs are short and powerful, making this bat an excellent climber (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Millions of Brazilian free-tailed bats spend their summers in the southwestern United States. Gigantic colonies summer in Bracken Cave, Texas; Carlsbad Caverns, New Mexico; and even within the city of Austin, Texas, under the Congress Avenue Bridge. They are a spectacular sight spiraling out of their day roosts like great, dark, swirling clouds when they emerge in the evening to forage. The bats eat untold numbers of insects each night, sometimes catching their prey at altitudes of a mile or more. They typically migrate to central and southern Mexico in the winter, where they live in smaller colonies. They mate there, and fly north again - as far as 1,300 km - between February and April. Females give birth to a single pup, in June, and nurse it for about six weeks. Although they number in the millions, conservation is a concern, because they raise their young in a limited number of caves, and because pesticides can accumulate in their body tissues.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Geoffroy Saint-Hilaire, I., 1824. Mémoire sur une chauve-souris américaine, formant une nouvelle espèce dans le genre Nyctinome, 1:343. Annales des Sciences Naturelles, Paris, 1:337-347.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

A particularly well-studied species, the Brazilian free-tailed bat exhibits some spectacular behaviour. It forms the largest warm-blooded colonies in the world, emerging to feed at dusk in huge columns of several million individuals. Their flapping wings create a sound equivalent to a white-water river and their numbers are great enough to be detected by airport and weather radars (7). Feeding for longer each night than any other bat species, it travels as far as 31 miles from the roost to the feeding grounds and uses echolocation to find its prey. The Brazilian free-tailed bat flies at up to 47 mile per hour in open spaces, foraging with fast, straight flight (6). Each bat consumes between 200 and 600 insects a night, selecting mainly moths, but also eating beetles, flying ants and leafhoppers (3). The Brazilian free-tailed bats of Texas are estimated to consume from 6,000 to 18,000 metric tons of insects each year, many of which are agricultural pests (2). At dawn, they return to their roosts where they swarm before re-entering. Thought to be a predator-avoidance tactic, the bats gather into groups at a great height above the cave, before closing their wings and dropping rapidly in one continuous stream. Predators waiting at the mouth of the cave to catch emerging bats include red-tailed hawks, owls, raccoons, opossums, skunks and snakes (7). Mating takes place in March and shortly afterwards the females migrate to female-only maternity roosts. Most adult males do not leave the tropical and subtropical part of the range and therefore contribute nothing to rearing the young. Gestation lasts for 90 days (2) and females give birth within around 15 days of each other to a single young, known as a pup (7). The female clings to the roost with both thumbs and one or both feet to give birth, and remains attached to the pup via the umbilical cord for up to an hour while she cleans and nurses her offspring. In the first hour the young bat learns to cling to the roost wall and other bats with its hands, feet and teeth. Once stable, the female pulls away from the pup, dislodging the placenta, which hangs from the pup until it dries out and falls off several days later. During this time the number of bats in the roost doubles, and a female must locate her own pup by listening for its calls. She may land several times, eventually finding her pup by scent. Once reunited she touches the top of its head with her muzzle to confirm the bond (7). A consequence of the enormous number of bats in a single cave is the build up of guano, or bat droppings. This nutrient-rich mixture was once commercially extracted from caves on a large scale, to be sold as fertiliser. In the early 1900s it was the largest mineral export from Texas after oil, and it continues to be sold commercially although to a lesser degree. Bat caves are widely known to contain noxious gases, but this is actually a result of carpet beetles (Dermestidae) that feed on guano and fallen bats. These beetles multiply so rapidly as a result of such a constant food supply that the whole floor of a cave may be 'carpeted' with them, hence their common name. They produce waste that combines with water vapour to make ammonium hydroxide which is poisonous to most animals. Bats have adapted to this potent atmosphere by lowering their metabolic rate, which causes the level of carbon dioxide dissolved in their blood to rise, thus neutralising the ammonia. Their fur, however, may become bleached to a reddish-brown colour. The first flight of the five-week-old bats is fraught with danger as they become used to their wings and echolocation system. Collisions, failed flights, and unsteady landings can result in bats falling to the cave floor, where they are stripped to the bone in minutes by the beetles (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern Oregon, northern Nebraska, and southern North Carolina (some records farther north) southward through most of Central America and Antilles (south to St. Lucia in Lesser Antilles; Tobago record probably an accidental, Jones 1989) to central Argentina, southern Brazil, and central Chile, excluding Amazonia (Wilkins 1989, Honacki et al. 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found from southern Brazil, Bolivia, Argentina, and Chile to Oregon, southern Nebraska and Ohio (USA); Greater and Lesser Antilles (Simmons 2005). Distribution extended to Falkland Islands. Not found in Nicaragua (Medina pers. comm.)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Tadarida brasiliensis is a member of one of the widely distributed genera of bats in North and South America. Extensive studies on their range have yet to be completed, especially within South America; however they have been found throughout the much of the United States, Mexico, Central America, and southwestern South America, including Brazil, Chile, and Argentina. In the United States Tadarida brasiliensis is found from southern Oregon to Nevada and eastward to North Carolina and southwestern Virginia. In the last 50 to 100 years, Tadarida brasiliensis populations have declined, possibly due to a decrease in habitat, damage to roosts, and indirect consumption of pesticides.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Cranford, J., D. Fortune. 1994. Mexican free-tailed bats at Mt. Lake Biological Station.. Virginia Journal of Science, 45/2: 111.
  • Gannon, M., A. Kurta, A. Rodriquez-Duran, M. Willig. 2005. Bats of Puerto Rico. Jamaica: The University of the West Indies Press.
  • Wilkins, K. 1989. Mammalian Species: Tadarida brasiliensis. Mammalian Species, 331: 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Despite its name, the Brazilian free-tailed bat is actually widespread throughout South, Central and North America. It has fairly complex migratory habits; some populations travel from the extreme north of the range to the extreme south, whilst others remain resident year-round. The largest and most well-known populations are found in Mexico and Texas, USA. There are nine subspecies in total; all occupy different ranges and have different migration routes (3). The population is thought to total between 95 and 105 million individuals, with Bracken Cave in Texas holding between 20 and 40 million individuals alone (2). In World War II this species was secretly investigated by the U.S. Air Force for its potential to carry tiny bombs into Japan. Bat caves were carefully guarded but the bats refused to cooperate, instead wreaking havoc in Air Force bases (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

With brown fur and large ears, Brazilian free-tailed bats are medium-sized, with distinctive short snouts and wrinkled upper lips. The free-tailed bats, which include the genera Tadarida, Eumops, and Nycintomops, are most easily recognized by their “free-tail,” which extends well beyond the uropatagium. They have powerful legs and can climb well. Their long, narrow, pointed wings make them well-suited for rapid, direct flight. Like other temperate bat species, Brazilian free-tailed bats take advantage of daily torpor to conserve energy and may hibernate.

Adults range in size from 79 to 98 mm in length, with a tail almost half the size (31 to 41 mm). Their body mass varies seasonally and depending on maturity, adults typically weigh 7 to 12 g. Ear length is 8 to 15 mm, forearm length ranges from 37 to 41 mm, and their hindfoot measures 6 to 9 mm.

The dental formula is the same as other members of the genus Tadarida: Incisors= 1/3, canines= 1/1, premolars= 2/2, molars= 3/3, with a total of 32 teeth.

Range mass: 7 to 12 g.

Range length: 79 to 98 mm.

Average wingspan: 280 mm.

Range basal metabolic rate: 1.99 to 7.31 cm^3 oxygen/hour.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Jones Jr., J., R. Manning. 1992. Illustrated Key to Skulls of Genera of North American Land Mammals. Lubbock, Texas: Texas Tech University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 11 cm

Weight: 14 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males may be about 5% longer than females but females weigh about 5% more than males.

Length:
Average: 95 mm
Range: 85-109 mm

Weight:
Range: 10-15 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Roosts primarily in buildings (generally old ones) in southeastern U.S. (sometimes in hollow trees), U.S. West Coast, and Jamaica; in caves in southwestern U.S.; in both buildings and caves in Puerto Rico. May use rock crevice, bridge, sign, or cliff swallow nest as roost during migration. Generally roosts high (at least 3 m) above ground to allow free fall required to attain flight. Large maternity colonies inhabit buildings and caves (rarely used in Florida); also uses culverts and bridges. Tends to return to natal cave to breed (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occurs in wide range of habitats (Barquez pers. comm.). Insectivorous, migratory species forming large colonies with millions of individuals. In the Antilles they form small colonies (Rodriguez pers. comm.)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brazilian free-tailed bats use a variety of different roost sites, including caves and man-made structures, such as bridges and attics. Caves with large rooms and high ceilings are the primary roosting habitats, although roosts also occur in hollow trees. Roosts are used for nesting, breeding, and interaction between individuals.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest

Other Habitat Features: urban ; suburban ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Brazilian free-tailed bat is found in many different habitats from desert through pinion-juniper woodland to pine-oak forests. It inhabits areas from sea level to 3,000 metres, and roosts in limestone caves, abandoned mines, under bridges, in buildings and in hollow trees (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In the eastern U.S. (to eastern Texas) and U.S. West Coast: hibernates but does not migrate. Antillean subspecies ANTILLARUM does not migrate (Jones 1989). Texas and Great Plains through southwestern U.S.: most migrate to Mexico or to southwestern U.S., usually toward end of October, return in March. (See Wilkins 1989 for more detail.) Individuals from southern Great Plains migrate, beginning in late August, to winter range from southern edge of Edwards Plateau in Texas south nearly to latitude of Mexico City (Caire et al. 1989).

Foraging habitat is very broad. May range as far as 80 km from cave to feed (Caire et al. 1989). Bats that roost in Carlsbad Cavern, New Mexico, forage up to at least 56 km from the cavern (Best and Geluso 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic; diet includes moths, flying ants, beetles, bugs, and other insects; often preys on densely swarming insects. May fly considerable distances to favorite feeding areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Brazilian free-tailed bats are aerial insectivores that use echolocation to find and consume their prey. Their diet varies based on geographical range, but mainly includes moths (Lepidoptera), beetles (Coleoptera), dragonflies (Odonata),flies (Diptera), true bugs (Hemiptera), and wasps, bees, and ants (Hymenoptera). Diet is influenced by the abundance of prey, weather conditions, metabolic demands, and lunar illumination, which can alter food availability. Brazilian free-tailed bats prey on flying insects while they are, themselves, in flight.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

  • McWilliams, L. 2005. Variation in diet of the Mexican free-tailed bat (Tadarida brasiliensis mexicana). Journal of Mammalogy, 86/3: 599-605.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Brazilian free-tailed bats play host to both ecto- and endoparasites. Individuals that are part of a colony are at higher risk for being parasitized than individuals in smaller roosts. Mite, tick, chigger, flea, and beetle infections are common among Brazilian free-tailed bats, and may act as vectors for other diseases. For example, the chigger Microtrombicula merrihewi affects the nasal passages of Brazilian free-tailed bats, while other parasites affect the blood stream and digestive system. Brazilian free-tailed bats, like other mammals, are also hosts for the rabies virus and at least five other known viruses, such as the Rio Bravo virus, St. Louis encephalitis virus, Eastern equine encephalitis, Western equine encephalitis, and Japanese B encephalitis.

Brazilian free-tailed bats are also known as guano bats. Excrement (guano) in roosts can build-up and result in tons of guano. Guano can be harvested as fertilizer and can pose a health risk in spreading diseases that are transmitted through the air (e.g., histoplasmosis). During the summer, disease transmission risk worsens, with higher temperatures and movement from within the caves generating dust clouds. Higher temperatures are also ideal for parasites and pathogens.

More studies are needed on associations with other bat species. In Texas, Myotis velifer are most commonly seen in roosts with T. brasiliensis. Although segregated, individuals can be seen within the other’s colony especially if the roost is crowded. The flight paths of M. velifer and T. brasiliensis differ, which helps avoid competition between the two species while exiting the roost.

Deer mice (Peromyscus species) and squirrels can also be seen using cave roosts as shelters. However, they have no known impact on T. brasiliensis.

During the summer months, these bats significantly affect local insect populations, which makes maintaining them important to agriculture and human health by eating agricultural pests and disease vectors.

Commensal/Parasitic Species:

  • Davis, R., R. Loomis. 1971. The Intranasal Chigger Mircotrombicula merrihewi (Acarina: Trombiculidae) in the North American Free-Tailed Bat, Tadarida brasiliensis.. The Southwestern Naturalist, 15/4: 437-458.
  • Jameson, D. 1959. A Survey of the Parasites of Five Species of Bats. The Southwestern Naturalist, 4/2: 61-65.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of Brazilian free-tailed bats include a number of raptors, such as red-tailed hawks (Buteo jamaicensis), American kestrels (Falco sparverius), great horned owls (Bubo virginianus), barn owls (Tyto alba), and Mississippi kites (Ictinia mississippiensis). Virginia opossums (Didelphis virginiana), striped skunks (Mephitis mephitis), and raccoons (Procyon lotor are among the mammalian roost predators. Snakes also prey on these bats in roosts, including eastern coachwhips (Masticophis flagellum) and eastern coral snakes (Micrurus fulviusprey). However, predation on Tadarida brasiliensis is rare; the number of bats lost due to predation is very low compared to their total population of around 100 million individuals.

Known Predators:

Anti-predator Adaptations: cryptic

  • 1997. "Brazilian Free-tailed Bat" (On-line). The Mammals of Texas - Online Edition. Accessed April 06, 2010 at http://www.nsrl.ttu.edu/tmot1/tadabras.htm.
  • Davis, R., C. Herreid, H. Short. 1962. Mexican Free-Tailed Bats in Texas. Ecological Monographs, 32/4: 311-346.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Bulk of total abundance is confined to about 20 caves in the southwestern U.S. Rest are small in size, though numerous. All large colonies probably known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimated 120-150 million. See Arita (1993) for information on population size in Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Roosts in tightly packed groups. Winter congregations typically much smaller than summer colonies. Sexes generally segregate during summer; males may form small (but sometimes up to 100,000) at higher elevations, whereas females usually form nursery colonies in warmer areas of the species' northern range (Freeman and Wunder 1988). Typically feeds within 50-mile radius of day roost, but up to 150 miles away (Whitaker 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Brazilian free-tailed bats use echolocation as their primary mode of perception for navigation and detecting prey. They emit brief constant frequency calls as they travel, unless food or another object is detected, then they transfer to modulated frequency calls between 75 and 40 kHz. Their normal frequency ranges from 49 to 70 kHz, but can drop to 25 to 40 kHz when objects cross their flight path. Mate and intra-specific recognition is determined through the use of echolocation and through chemical, visual, and audible vocalizations. Females do not roost with their offspring, they must find their young through scent and sound recognition.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; echolocation

  • Gillam, E., G. McCracken. 2007. Variability in the echolocation of Tadarida brasiliensis: effects. Animal Behavior, 74: 277-286.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: On overcast days, often found feeding in early evening. In predominantly male colony in Colorado: began to leave mine shaft at about 2300 h; a few began returning by 2300, continuing until 0430; none returned after 0515 (Freeman and Wunder 1988); in some areas some groups do not return to cave until after daylight (Caire et al. 1989); in other areas may forage for a few hours, return to cave roost for a few hours, then go out on another foraging trip, returning after dawn. Typically hibernates in the eastern U.S. and on U.S. West Coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Dental studies (Gannon et al., 2005) determined that the longest-living individual was over eight years old. Most adults have a survival rate of 70 to 80% each year, with the rate decreasing with age. Males and females have roughly equal lifespan and mortality rates. Weigl (2005) reported a live free-tailed bat in captivity that was 12 years old. It is therefore expected that this species can live beyond 12 years in captivity.

Average lifespan

Status: wild:
8 years.

Average lifespan

Status: captivity:
12 years.

Average lifespan

Status: wild:
8.0 years.

  • Weigl, R. 2005. Longevity of Mammals in Captivity; from the Living Collections of the World. Stuttgart, Germany: Kleine Senckenberg-Reihe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (captivity) Observations: In the wild, these animals live at least 8 years (Brunet-Rossinni and Austad 2004). One 12 year old specimen was still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds late February-March or early April in North America. None of 8 females collected in late December in Jamaica was pregnant (Goodwin 1970). Gestation lasts 2.5-3.5 months. Births mainly June-July in North America (early to mid-June in Texas). Litter size: 1 (females occasionally carry 2 embryos). Despite the huge numbers of young that may be present in a colony, females recognize and nurse their own offspring. Young nurse for about 45 days, first fly at 6-7 weeks. Females may become pregnant as yearlings; males become sexually mature at 18-22 months. Maternity colonies initially consist of almost only of pregnant females. Some colonies include more than 1 million individuals (20 million adult females give birth in Bracken Cave near San Antonio, Texas); 10,000s in eastern North America. If a nursery falls below about 20,000 females, usually it is abandoned (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Male Brazilian free-tailed bat behavior and scent-marking changes throughout the year based on the breeding season. Females gather in large numbers at maternity roosts in caves, while smaller groups can be found in tree, bridges, buildings, and other man-made structures. Males vocalize and mark territories in order to attract potential mates. Male and female free-tailed bats call to each other, singling out a mate. Once found, they move away from the group. Males aggressively mate with the female, restricting her movement by grabbing her neck, jaw, or ear. He moves onto her back, biting her neck to keep her in place. The female and male call to each other during mating. Some free-tailed bats mate multiple times, moving from mate to mate.

Mating System: monogamous

Brazilian free-tailed bat males mature at about two years, while females mature at nine months. They are monestrous, with females having one annual estrous cycle lasting roughly five weeks during ovulation, which occurs in the spring. Male sexual activity coincides with spring female receptivity, suitable timing for mating interactions to occur.  A female usually gives birth to a single offspring after an 11 to 12 week gestation period. Births occurs upside down and last roughly 90 seconds. It takes an additional 10 to 15 minutes for the newborn to find a nipple for feeding. The sex-ratio is typically 1:1 in pups.

Breeding interval: Breeding occurs once yearly.

Breeding season: Ovaluation lasts roughly 5 weeks in females and occurs in spring, when breeding occurs.

Average number of offspring: 1.

Range gestation period: 11 to 12 weeks.

Average birth mass: 2.8 g.

Range time to independence: 4 to 7 weeks.

Average age at sexual or reproductive maturity (female): 9 months.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 2.8 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
547 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
273 days.

Because mothers do not roost with their offspring, but rather leave them with a larger cluster of pups (a creche), she has to identify her own young through a series of calls and odors produced by the pup. Loughry and McCracken (1991) found that the scent of mothers is imprinted during early stages of development; however, pups will try latching onto any female that passes in the cluster to get fed. The young are nursed daily. They reach adult size, are weaned, and are independent in 4 to 7 weeks after birth. Brazilian free-tailed bat females have the highest milk fat content of any bat, over 28% fat, which allows their pups to grow relatively quickly.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Gannon, M., A. Kurta, A. Rodriquez-Duran, M. Willig. 2005. Bats of Puerto Rico. Jamaica: The University of the West Indies Press.
  • Keeley, A., B. Keeley. 2004. The Mating System of Tadarida brasiliensis (Chiroptera: Molossidae) in a Large Highway Bridge Colony. Journal of Mammalogy, 85/1: 113-1. Accessed April 06, 2010 at http://www.bioone.org/doi/abs/10.1644/BME-004.
  • Krutzsch, P., T. Fleming, E. Crichton. 2002. Reproductive biology of male Mexican free-tailed bats (Tadarida brasiliensis mexicana). Journal of Mammalogy, 83/2: 489-500.
  • Kunz, T., S. Robson. 1995. Postnatal growth and development in the Mexican free-tailed bat (Tadarida brasiliensis mexicana): birth size, growth rates, and age estimation. Journal of Mammalogy, 76/3: 769-783.
  • Loughry, W., G. McCracken. 1991. Factors influencing female-pup scent recognition in Mexican free-tailed bats. Journal of Mammalogy, 72/3: 624-626.
  • Wilkins, K. 1989. Mammalian Species: Tadarida brasiliensis. Mammalian Species, 331: 1-10.
  • de Magalhaes, J., J. Costa. 2009. "AnAge entry for Tadarida brasiliensis" (On-line). AnAge: The Animal Ageing and Longevity Database. Accessed April 06, 2010 at http://genomics.senescence.info/species/entry.php?species=Tadarida_brasiliensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Hot spots cool and heat: Brazilian free-tailed bat
 

The flanks of Brazilian free-tailed bats aid thermoregulation due to a unique arrangement of arteries and veins creating thermal windows.

     
  "The Brazilian free-tailed bat (Tadarida brasiliensis) experiences challenging thermal conditions while roosting in hot caves, flying during warm daylight conditions, and foraging at cool high altitudes. Using thermal infrared cameras, we identified hot spots along the flanks of free-ranging Brazilian free-tailed bats, ventral to the extended wings. These hot spots are absent in syntopic cave myotis (Myotis velifer), a species that forages over relatively short distances, and does not engage in long-distance migration. We hypothesized that the hot spots, or 'radiators,' on Brazilian free-tailed bats may be adaptations for migration, particularly in this long-distance, high-flying species. We examined the vasculature of radiators on Brazilian free-tailed bats with transillumination to characterize the unique arrangements of arteries and veins that are positioned perpendicular to the body in the proximal region of the wing. We hypothesized that these radiators aid in maintaining heat balance by flushing the uninsulated thermal window with warm blood, thereby dissipating heat while bats are flying under warm conditions, but shunting blood away and conserving heat when they are flying in cooler air at high altitudes. We also examined fluid-preserved specimens representing 122 species from 15 of 18 chiropteran families and radiators appeared present only in species in the family Molossidae, including both sedentary and migratory species and subspecies. Thus, the radiator appears to be a unique trait that may facilitate energy balance and water balance during sustained dispersal, foraging, and long-distance migration." (Reichard et al. 2010:358)
  Learn more about this functional adaptation.
  • Reichard JD; Prajapati SI; Austad SN; Keller C; Kunz TH. 2010. Thermal windows on Brazilian free-tailed bats facilitate thermoregulation during prolonged flight. Integrative and Comparative Biology. 50(3): 358-370.
  • Reichard JD; Fellows SR; Frank AJ; Kunz TH. 2010. Thermoregulation during flight: body temperature and sensible heat transfer in free-ranging Brazilian free-tailed Bats (Tadarida brasiliensis). Physiological and Biochemical Zoology. 83(6): 885-897.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tadarida brasiliensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATACCTTTTATTTGGTGCTTGAGCAGGGATAGTAGGAACTGCTCTAAGTCTTCTTATCCGAGCTGAATTAGGTCAGCCAGGAGCTCTCTTAGGAGATGATCAAATCTACAACGTAATCGTTACTGCCCATGCCTTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAACTGATTAGTCCCTCTAATAATTGGTGCCCCAGACATAGCTTTCCCACGAATAAACAATATAAGCTTCTGACTACTGCCTCCATCATTTCTATTACTATTAGCCTCTTCAATAGTAGAAGCTGGGGCTGGAACTGGTTGAACAGTTTACCCTCCCTTAGCCGGAAATTTAGCCCACGCCGGAGCCTCCGTTGATCTAACTATCTTCTCTTTACATTTAGCCGGTGTTTCATCAATTTTAGGCGCTATTAATTTTATCACAACTATTATTAACATAAAACCACCCGCCCTTTCCCAATATCAGACTCCCCTATTCGTTTGGTCAGTCCTAATTACAGCCGTATTACTCCTACTATCTCTACCAGTGCTTGCAGCAGGAATTACAATATTATTAACAGACCGAAACCTAAATACCACTTTCTTTGACCCTGCCGGAGGAGGAGACCCTATCTTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tadarida brasiliensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range (southern North America to South America); suitable sites for large colonies are extremely limited; threats include pesticides and disturbance to major roosts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Diaz, M., Gonzalez, E., Rodriguez, A., Incháustegui, S. & Arroyo-Cabrales, J.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of Tadarida brasiliensis have declined over the last century. Some suggest this decline has been caused by disturbance and destruction of roost sites and indirect poisoning by pesticides.  Tadarida brasiliensis is labeled as “near threatened” by the International Union for Conservation of Nature, with a Species Action Plan created.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Arita, H. 1993. Conservation Biology of the Cave Bats of Mexico. Journal of Mammalogy, 74/3: 693-702.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Brazilian free-tailed bat is classified as Least Concern (LC) on the IUCN Red List (1) and is listed on Appendix I of the Convention on Migratory Species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant species (Barquez pers. comm.)

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Threatened by disturbance, pesticides, and habitat destruction in tropics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Populations exterminated as plagues in several places in Uruguay (Gonzalez pers. comm.). In Northern Mexico and southern US it has been documented reduction in the population in 1980s. Mining in the caves in the Antilles (Armando Rodriguez pers. comm.). There are no major threats throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whilst the Brazilian free-tailed bat exists in extremely large numbers and across a great range of countries and habitat types, it is still classed as a threatened species. This is due to its reliance on a relatively low number of roost sites. With the loss of just one roost site, a large proportion of the population could be destroyed. Some significant declines have been documented, such as the population of Eagle Creek Cave, which fell from 25 million individuals in 1963 to just 30,000 individuals in 1969. These declines are not fully understood, but several threats are present, particularly from the alteration of roost sites and the use of organochlorine pesticides. Insecticides which are found in the bodies of living insects accumulate in the bodies of the bats that eat them in such large numbers, resulting in reduced reproductive success and death (6). Rabies, a disease often associated with bats, is found in members of the Brazilian free-tailed bat population. Humans who attempt to handle bats without the proper precautions have been infected with rabies, which can be fatal. Media sensationalism of this problem has resulted in deliberate eradication attempts and roost destruction (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: A relatively well-studied species. Needs some resolution of subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Carlsbad Caverns N.P., New Mexico.

Needs: Protect largest colonies. Protect tropical winter areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
There is a large population protected in Tucuman. There is a large conservation program in Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Although perhaps no species' fate should be judged solely on its importance to humans, the Brazilian free-tailed bat is known to have an enormous impact on insect numbers, thereby contributing to both the ecology and economy of those countries that are home to it. It is crucial to continue to protect its roost sites and to educate the public and the media as to the reality of rabies and the benefits of the Brazilian free-tailed bat (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Large colonies produce voluminous guano in roost caves; guano has been (and still is) mined for use as a fertilizer in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There is no known negative economic importance. However, histoplasmosis is a potential health concern in caves with large guano accumulations and, like other bats, Brazilian free-tailed bats can carry and transmit rabies.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Brazilian free-tailed bats eat large numbers of insects nightly, some of which are agricultural pests or disease vectors. Their positive economic impact on agriculture is substantial. However, agricultural pests are often exposed to pesticides through agricultural applications, which can indirectly. Population declines may be linked to toxicity from pesticides.  In addition, the large amount of guano produced in  Brazilian free-tailed bat colonies are used for fertilizer and as a component in gunpowder.

Positive Impacts: produces fertilizer; controls pest population

  • Clark Jr., D., A. Lollar, D. Cowman. 1996. Dead and dying Brazilian free-tailed bats (Tadarida brasiliensis) from Texas: rabies and pesticide exposure. The Southwestern Naturalist, 41/3: 275-278.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mexican free-tailed bat

The Mexican free-tailed bat (Tadarida brasiliensis), also known as the Brazilian free-tailed bat and Austonian bridge bat, is a medium-sized bat that is native to the Americas and is widely regarded as one of the most abundant mammals in North America.

However, its proclivity towards roosting in large numbers in relatively few roosts makes it especially vulnerable to human disturbance and habitat destruction, and declining numbers at some roosts such as in the western state of Utah have been documented. In the western coastal state of California, the bat is considered a species of special concern as a result of declining populations. The species' winter migratory habits and destination points are still relatively unknown.[1]

The Mexican free-tailed bat is the official state bat of both Oklahoma and Texas, and its image is the icon for the Bacardi rum brand and for Freetail Brewing Company in San Antonio, TX.[2]

Physical description[edit]

Mexican free-tailed bats are about 9 cm (3.5 in) in length, and they weigh about 12.3 g (0.43 oz). Their tails make up almost half their lengths. Their ears are wide and set apart to help them find prey with echolocation. They are also fairly close behind the snout and eyes. Their fur color varies from dark brown to gray. Their muzzles are condensed, with wrinkled upper lips. The tail of these bats stretches further than the uropatagium, hence they are named "free-tailed" bats. The wings are elongated and narrow with pointed tips, making them well-equipped for quick, straight flight patterns.

Range and ecology[edit]

Bats flying near Frio Cave in Concan, TX.

The Mexican free-tailed bat is one of the most widespread mammals in the Western Hemisphere. It ranges from the southern half of the continental United States through most of Mexico, and through most of Central America into South America. The range of the Mexican free-tailed bat in South America is less understood where it lives in the eastern Brazilian highlands and coast, the northeastern Andes and the coast of Peru and northern Chile.[3] It is absent in much of the Amazon rainforest. The bat is also found in the Caribbean, and is native to all of the Greater Antilles and 11 of the Lesser Antilles.[4] The largest known colony is found at Bracken Cave, north of San Antonio, Texas, with nearly 20 million bats; research indicates the bats from this colony congregate in huge numbers at altitudes between 180 and 1,000 m (590 and 3,300 ft), and even as high as 3,000 m (9,800 ft).

Habitat[edit]

Mexican free-tailed bats roost primarily in caves. However, they will also roost in buildings of any type as long as they have access to openings and dark recesses in ceilings or walls.[3] The bats can make roosting sites of buildings regardless of "age, height, architecture, construction materials, occupancy by humans and compass orientation".[3] Caves, on the other hand, need to have enough wall and ceiling space to fit millions of bats.[3] Before buildings, free-tailed bats in the southeastern United States probably roosted in the hollows of trees such as red mangrove, black mangrove, white mangrove and cypress. However, most bats in Florida seem to prefer buildings and other man-made structures over natural roosts.[3] Caves in Florida tend to be occupied mostly by the southeastern myotis. Caves in Florida tend to have pools of water on the floor and the free-tailed bats do not need as much relative humidity as the southeastern myotis.[3]

Migration[edit]

Mexican free-tailed bats, emerging from Carlsbad Caverns, Carlsbad Caverns National Park, New Mexico

Mexican free-tailed bats in southeastern Nevada, southwestern Utah, western Arizona and southeastern California come together to migrate southwest to southern California and Baja California.[3] Bats in southeastern Utah, southwestern Colorado, western New Mexico and eastern Arizona travel though western edge of the Sierra Madre Oriental into Jalisco, Sinaloa and Sonora. Some bats that summer in Kansas, Oklahoma, eastern New Mexico and Texas will migrate southward to southern Texas[5] and Mexico.[3] Some bat populations in other areas of North America do not migrate, but are residents and may make seasonal changes in roost sites.[3]

Emergence of the bats of the Congress Avenue Bridge in Austin, Texas at dusk.

In Austin, Texas, a colony of Mexican free-tailed bats summers (they winter in Mexico) under the Congress Avenue Bridge ten blocks south of the Texas State Capitol. It is the largest urban colony in North America, with an estimated 1,500,000 bats.[6] Each night they eat 10,000 to 30,000 lb (4,500 to 13,600 kg) of insects. Each year they attract 100,000 tourists who come to watch them. In Houston, Texas, a colony is living under the Waugh Street Bridge over Buffalo Bayou. It is the home to 250,000 bats and also attracts viewers. The Mexican free-tailed bat is the official "flying mammal" of the state of Texas.[7]

Bats ranging eastward from East Texas do not migrate, but local shifts in roost usage often occur seasonally.[3] Also, a regional population that ranges from Oregon to California, has a year-round residence.

Diet[edit]

Mexican free-tailed bats are primarily insectivores. They hunt their prey using echolocation. The bats eat moths, beetles, dragonflies, flies, true bugs, wasps, and ants. Bats usually catch flying prey in flight.[8] Large numbers of Mexican free-tailed bats fly hundreds of meters above the ground in Texas to feed on migrating insects.[9] The consumption of insects by these bats can be quite significant.[10][11]

Additionally, Mexican free-tailed bats are also efficient pollinators.[11] Their pollination of sugar cane as well as their consumption of insects that damage sugar cane may be among the reasons why Bacardi rum features the Mexican free-tailed bat as its icon. Bacardi Ltd. themselves attribute the use of the bat in the logo to, "... Don Facundo’s wife, Amalia, who suggested using a bat for the company logo. It was an insightful choice, because according to Cuban and Spanish lore, bats symbolize good health, good fortune and family unity."[12]

Health and mortality[edit]

One individual bat was recorded to have lived eight years, based on dentition.[13] Predators of the bat include large birds such as red-tailed hawk, American kestrels, great horned owls, barn owls, and Mississippi kites.[3] Mammal predators include Virginia opossums, striped skunks, and raccoons.[3] Snakes such as eastern coachwhips and eastern coral snakes may also prey on them, but at a lesser extent. Certain types of beetles prey on neonate and juvenile bats that have fallen to the ground.[3] This species seems to have a low incidence of rabies, at least in the United States.[3] They do, however, contain certain pesticides.[3]

Behavior[edit]

A male displays and sings in the presence of females (watch in slow motion).

Mexican free-tailed bats are nocturnal foragers and begin feeding after dusk. They travel 50 km in a quick, direct flight pattern to feed. This species flies the highest among bats, at altitudes around 3300 m.[14] Bats appears to be most active in late morning and afternoon between June and September.[15] Free-tailed bats are more active in warm weather.[16]

Echolocation[edit]

Mexican free-tailed bats use echolocation for navigation and detecting prey. Traveling calls are of a brief but constant frequency. However, they switch modulated frequency calls between 40 and 75 kHz if they detect something.[17] Typically, the frequency range of their echolocation is between 49 and 70 kHz, but can be between 25 and 40 kHz if something crosses their path while in flight.[17]

Mating and reproduction[edit]

Free-tailed bats roosting at a cave in the Bahamas

During the breeding season, females aggregate into maternity roosts. The size of these roosts depends on the environment, with caves having the larger roosts. Mating can occur in an aggressive or passive form. In the aggressive form, the male controls the female's movements, keeping her away from the other bats in the roost.[18] He also tends to vocalize when mating. During passive copulation, the males simply flies to a female in her roost and quietly mounts her with no resistance. This species is a promiscuous breeder and both sexes copulate with multiple partners.[18] Females become sexually mature at about 9 months, while males take even longer, at two years. Females enter estrus once a year, which typically lasts five weeks in the spring. The gestation period of the bat lasts 11–12 weeks, with only one young being born. A number of pups are left in "creches", while their mothers roost elsewhere. The female uses vocalizations and scent to identify her pup. The mother imprints her scent on the young early on.[19] However, young try to steal a suckle from any female that passes through the cluster. A mother will nurse her young daily, and by 4–7 weeks old they are full grown, fully weaned, and independent.[20]

Protection[edit]

Though abundant and widespread, some local populations have prompted protection and conservation efforts. For instance, during the spring and summer, one of the largest Mexican free-tailed bat populations inhabits Cueva de la Boca, a cave near Monterrey, Mexico. In 2006, the Mexican environmental conservation NGO, Pronatura Noreste, purchased the property. Because of a reduction of more than 95% of the original 20 million bat population, as a result of vandalism, pollution, and uncontrolled tourism, the organization decided to buy the property to place it under conservation. Other species of high ecological value that inhabit the cavern are also being protected.

See also[edit]

Bat bomb, an experimental incendiary weapon that used Mexican free-tailed bats as a dispersal mechanism

References[edit]

  1. ^ "Carlsbad Caverns National Park – Bats' Wintering Sites (U.S. National Park Service)". 
  2. ^ "Freetail Brewing Company webpage - "Where'd We Get That Silly Name?"". 
  3. ^ a b c d e f g h i j k l m n o Wilkins, K. (1989). "Tadarida brasiliensis". Mammalian Species , 331: 1-10.
  4. ^ Baker, R. J., Genoways, H. H. 1978. Zoogeography of Antillean bats. In. Zoogeography in the Caribbean, ed. F. B. Gill pp. 53-97. Philadelphia: Acad
  5. ^ Glass BP (1982) Seasonal movements of Mexican free- tail bats Tadarida brasiliensis mextcana banded in the Great Plains. Southwestern Nat., 27:127-133.
  6. ^ "Bat Conservation International page on the Congress Avenue Bridge Bat Colony". 
  7. ^ "Texas State Symbols, Texas State Library and Archives Commission". 
  8. ^ McWilliams, L. 2005. Variation in diet of the Mexican free-tailed bat (Tadarida brasiliensis mexicana). Journal of Mammalogy, 86/3: 599-605.
  9. ^ Gary F. McCracken, Erin H. Gillam, John K. Westbrook, Ya-Fu Lee, Michael L. Jensen and Ben B. Balsley (2008) "Brazilian free-tailed bats (Tadarida brasiliensis: Molossidae, Chiroptera) at high altitude: links to migratory insect populations", Integrative and Comparative Biology 48(1):107-118.
  10. ^ [1] Do Bats Control Mosquitoes?
  11. ^ a b [2] Animal Fact Sheet: Mexican Free-Tailed Bat, Desert Museum
  12. ^ [3] Bacardi Ltd. Official Web Site - The Early Years
  13. ^ Gannon, M., A. Kurta, A. Rodriquez-Duran, M. Willig. 2005. Bats of Puerto Rico. Jamaica: The University of the West Indies Press.
  14. ^ Williams, T., L. Ireland, J. Williams. 1973. High altitude flights of the free-tailed bat, Tadarida brasiliensis, observed with radar. Journal of Mammalogy, 54/4: 807-821.
  15. ^ Svoboda, P., J. Choate. 1987. Natural history of the Brazilian free-tailed bat in the San Luis Valley of Colorado. Journal of Mammalogy, 68/2: 224-234.
  16. ^ Allen, L., A. Turmelle, M. Mendonca, K. Navara, T. Kunz, G. McCracken. 2009. Roosting ecology and variation in adaptive and innate immune system function in the Brazilian free-tailed bat (Tadarida brasiliensis). Journal of Comparative Physiology, 179: 315–323.
  17. ^ a b Gillam, E., G. McCracken. 2007. Variability in the echolocation of Tadarida brasiliensis: effects. Animal Behavior, 74: 277-286.
  18. ^ a b Keeley, A., B. Keeley. 2004. The Mating System of Tadarida brasiliensis (Chiroptera: Molossidae) in a Large Highway Bridge Colony. Journal of Mammalogy, 85/1: 113-1.
  19. ^ Loughry, W., G. McCracken. 1991. Factors influencing female-pup scent recognition in Mexican free-tailed bats. Journal of Mammalogy, 72/3: 624-626.
  20. ^ Kunz, T., S. Robson. 1995. Postnatal growth and development in the Mexican free-tailed bat (Tadarida brasiliensis mexicana): birth size, growth rates, and age estimation. Journal of Mammalogy, 76/3: 769-783.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The specific relationships of Antillean populations of Tadarida remain obscure; it has been suggested that Caribbean populations represent a distinct species or that they are related to T. b. cynocephala (of the southeastern U.S.) but not to other populations of the brasiliensis complex (Jones 1989). Two of the nine subspecies (T. b. mexicana and T. b. cynocephala) occur in the U.S. Though morphological data suggest intergradation (Schmidly 1977), these two subspecies differ widely in behavior (migratory vs. nonmigratory) and roost preference, and gene flow between them has been reported to be minimal and unidirectional at most (Owen et al. 1990). However, McCracken and Gassel (1997) found high genetic similarity and evidence of gene flow between these nominal subspecies, such as typically seen between geographic populations of the same subspecies.

The generic name Rhizomops was proposed in 1984 for Tadarida brasiliensis (and presumably all subspecies), but this was rejected by Owen et al. (1990) because the genus was based entirely on plesiomorphic characters.

McCracken et al. (1994) examined allozyme data from several maternity and winter colonies within the range of subspecies mexicana and determined that populations are not structured genetically into distinct geographic units.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!