Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide in subtropical and warm temperate oceans (see Rice 1998 for further information).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 1400 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Tropical and warm temperate waters, often near shore in areas of high productivity. Small coastal form occurs within 30 km of coast (South Africa, Japan, Brazil, probably Baja California); larger form occurs offshore (Leatherwood and Reeves 1983). In Gulf of California, most often within 3 km of shore (Tershy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some tropical populations may be sedentary, especially inshore form (IUCN 1991); temperate populations apparently are migratory. Apparently resident populations occur in the Gulf of Mexico and southeastern Caribbean (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Coastal and offshore populations apparently prefer schooling fishes (e.g., Tershy 1992), including pilchards, anchovies, herring, and mackerel; euphausiids are an important element of the diet in some areas (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population in the mid-1980s was estimated at 30,000-55,000, though census data were incomplete (NMFS 1987). See IUCN (1991) for a fairly detailed discussion of population estimates for several regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually solitary or in small groups (e.g., Tershy 1992), though concentration have been observed in several areas (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In the Gulf of California, fed throughout the day, most often at dawn and dusk (Tershy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Gestation lasts about 1 year. In the Northern Hemisphere, calving peaks in fall. Lactation lasts probably less than a year. Females give birth usually every second year. Sexually mature apparently in about 10 years (females) or 9-13 years (males).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera brydei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCCTATATTTATTATTTGGTGCATGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAACTAGGTCAGCCCGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTGTTGGTAACAGCTCACGCCTTCGTGATAATCTTCTTCATAGTCATACCCATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCCCCTTCTTTCCTACTATTAATAGCATCCTCAATAGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTGTATCCCCCTTTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTTACCATCTTCTCCCTACATCTAGCCGGTGTATCCTCAATCCTTGGAGCCATCAATTTCATTACAACTATTATTAATATAAAACCACCTGCCATGACCCAATATCAAACGCCCCTCTTCGTATGATCCGTCCTAGTTACAGCAGTGCTACTCCTATTATCGTTACCTGTCTTAGCAGCCGGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCAATTCTGTACCAACACTTATTCTGATTCTTTGGCCACCCCGAAGTATATATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATCGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGCTACATGGGAATAGTCTGAGCTATGGTATCTATCGGGTTCTTAGGATTTATCGTATGAGCTCACCATATGTTTACAGTAGGAATAGACGTTGATACGCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera brydei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Concern has been expressed about the stocks off South Africa and in the East China Sea; populations of whale food resources (fishes) have been depleted (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Rarely exploited prior to the 1920s; subsequently harvest increased, especially off Peru and in the western North Pacific (Leatherwood and Reeves 1983). Has been subject to coastal whaling also off Chile and southern Africa. In the western North Pacific, coastal whaling continued until 1987 (IUCN 1991). Much of the range was closed to pelagic whaling beginning in the 1930s, through measures intended to protect the breeding grounds of other baleen whale species (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bryde's whale

Bryde's whales (pron.: /ˈbrdə/ BREW-də) are baleen whales, the "great whales" or rorquals. They prefer tropical and temperate waters over the polar seas that other whales in their family frequent. They are largely coastal rather than pelagic. Bryde's whales are very similar in appearance to sei whales and almost as large.

The whales are named after Norwegian entrepreneur, Johan Bryde, who helped set up the first whaling station in Durban, South Africa in 1908.[2]

They inhabit tropical and subtropical waters worldwide. Bryde's whales are considered medium-sized for balaenopterids, dark gray in color with a white underbelly.

Contents

Etymology [edit]

In Japan, early whalers called it "iwashi" or "kutsuo kujira", the "anchovy" or "skipjack whale". It preys on the former, while it was commonly associated with the latter. As modern whaling shifted to Sanriku, whalemen confused it for the sei whale, and now the term "iwashi kujira" only applies to the latter species. Incidentally, anchovies are dominant prey for both species off Japan. They are now called "nitari kujira", or "look-alike whale", for their resemblance to the sei whale.[3]

Taxonomy [edit]

The taxonomy is poorly characterized. Three genetically distinct, candidate species/subspecies/morphologies, Bryde's whale B. brydei, Bryde's/Eden's whale B. edeni,[4] and Omura's whale B. omurai,[5] differentiate by geographic distribution, inshore/offshore preferences, and size. For at least two of the species, the scientific name B. edeni is common. Omura's whale, a pygmy, is only recently described and reaches only 11.5 m (38 ft).[6]

In 1878, the Scottish zoologist John Anderson, first curator of the Indian Museum in Calcutta, described Balaenoptera edeni, naming it after the former British High Commissioner in Burma, Sir Ashley Eden, who helped obtain the type specimen. Eden's Deputy Commissioner, Major A.G. Duff, sent a Mr. Duke, one of his assistants, to Thaybyoo Creek, between the Sittang and Beeling rivers, on the Gulf of Martaban, where he found a 37-ft whale, which had stranded there in June 1871 after swimming more than twenty miles up the creek — it was said to have "exhausted itself by its furious struggles" to get free and "roared like an elephant" before finally expiring. Despite terrible weather, he was able to secure almost the entire skull as well as nearly all its vertebrae, along with other bones. These were sent to Anderson, who described the specimen, which was physically mature, as a new species.[7] In 1913, the Norwegian scientist Ørjan Olsen, based on the examination of a dozen "sei whales" brought to the whaling stations at Durban and Saldanha, in South Africa, described Balaenoptera brydei, naming it after the Norwegian consul to South Africa Johan Bryde.[8] In 1950, the Dutch scientist G.C.A. Junge, after comparing specimens of B. edeni and B. brydei with a 39-ft physically mature specimen that had stranded on Pulu Sugi, an island between Singapore and Sumatra, in July 1936, synonymized the two species into B. edeni (Anderson, 1878).[9]

Description [edit]

Bryde's Whales are moderately-sized rorquals, falling behind sei whales but being larger than the relatively small minke whales. The largest measured by Olsen (1913) was a 14.95 m (49 ft) female caught off Durban in November 1912,[8] while the longest of each sex measured by Best (1977) at the Donkergat whaling station in Saldanha Bay, South Africa, were a 15.51 m (50.9 ft) female caught in October 1962 and a 14.56 m (47.8 ft) male caught in April 1963 – both were the offshore form.[10] At physical maturity, the coastal form off South Africa averages 13.1 m (43 ft) for males and 13.7 m (45 ft) for females, while the South Africa offshore form averages 13.7 m (45 ft) and 14.4 m (47.2 ft). The coastal form off Japan is slightly smaller, with adult males averaging 12.9 m (42.3 ft) and adult females 13.3 m (43.6 ft). At sexual maturity, males average 11.9 m (39 ft) and females 12 m (39.3 ft) off Japan. Sexual maturity is reached at 8–11 years for both sexes in the offshore form off South Africa. At birth, they are 3.95-4.15 m (13-13.5 ft).[11] The body mass of Bryde's whales can range from 12 to 25 metric tons (13 to 28 short tons).

Anatomy [edit]

A Bryde's whale, showing faint lateral ridges

The Bryde's whale is a baleen whale, more specifically a rorqual belonging to the same group as blue whales and humpback whales. It has twin blowholes with a low splashguard to the front. Like other rorquals, it has no teeth, but has two rows of baleen plates.

Bryde's whales closely resemble their close relative the sei whale. They are remarkably elongated (even more so than fin whales), with the greatest height of the body being 1/7 their total length – compared to 1/6.5 to 1/6.75 in fin whales and only 1/5.5 in sei whales. Bryde's are dark smoky gray dorsally and usually white ventrally, whereas sei whales are often a galvanized blue-gray dorsally and have a variably sized white patch on the throat, a posteriorly oriented white anchor-shaped marking between the pectoral fins, and are blue-gray beyond the anus – although Bryde's off South Africa can have a similar irregular white patch on the throat. Bryde's have a straight rostrum with three longitudinal ridges that extend from the blowholes, where the auxiliary ridges begin as depressions, to the tip of the rostrum. The sei whale, like other rorquals, has a single median ridge, as well as a slightly arched rostrum, which is accentuated at the tip. Bryde's usually have dark gray lower jaws, whereas sei whales are lighter gray. Bryde's have 250-370 pairs of short, slate gray baleen plates with long, coarse, lighter gray or white bristles that are 40 centimetres (16 in) long by 20 centimetres (7.9 in) wide, while sei whales have longer, black or dark gray baleen plates with short, curling, wool-like bristles.[8]

The forty to seventy ventral pleats extend to or past the umbilicus, occupying about 58% and 57% of the total length, respectively – sei whales, on the other hand, have ventral pleats that extend only halfway between the pectoral fins and umbilicus, occupying only 45-47% of the total body length, whereas their umbilicus is usually 52% of the total body length. Both species are often covered with white or pink oval scars caused by bites from cookie-cutter sharks.[12]

Bryde's have an upright, falcate dorsal fin that is up to 46.25 cm (18.5 in) in height, averages 34.4 cm (13.75 in), and is usually between 30 and 37.5 cm (12 and 15 in).[10] It is often frayed or ragged along its rear margin and located about two-thirds the way along the back. The broad, centrally notched tail flukes never break the surface. The flippers are small and slender.[6]

Behavior [edit]

A Bryde's whale in False Bay, South Africa, showing upright dorsal fin, which is often nicked or frayed on its trailing edge (shown here)
A Bryde's whale off La Gomera, showing its culumnar blow

Their blow is columnar or bushy, about 10–13 feet (3.0–4.0 m) high. Sometimes they blow or exhale while under water. Bryde's whales display seemingly erratic behavior compared to other baleens, because they surface at irregular intervals and can change directions for unknown reasons.[6]

They usually appear individually or in pairs, and occasionally in loose aggregations of up to twenty animals around feeding areas.[6]

Breathing [edit]

They regularly dive for about 5–15 minutes (maximum of 20 minutes) after 4–7 blows. Bryde's whales are capable of reaching depths up to 1,000 feet (300 m). When submerging, these whales do not display their flukes. Bryde's whales commonly swim at 1–4 miles per hour (1.6–6.4 km/h), but can reach 12–15 miles per hour (19–24 km/h).[6]

They sometimes generate short (0.4 seconds) powerful, low frequency vocalizations that resemble a human moan.[6]

Diet [edit]

These whales opportunistically feed on plankton (e.g., krill and copepods), and crustaceans (e.g. pelagic red crabs, shrimp), as well as schooling fish (e.g., anchovy, herring, sardine, mackerel, and pilchard). Bryde's whales use several feeding methods, including skimming the surface, lunging, and bubble nets.[6]

Reproduction and nurturing [edit]

Bryde's whales breed in alternate years, apparently in any season, with an autumnal peak. Their gestation period is estimated at 12 months. Calves are about 11–13 feet (3.4–4.0 m) long at birth and weigh 1,000 kilograms (2,200 lb). They become sexually mature at 8–13 years of age, when females are 39 feet (12 m). The mother nurses for 6–12 months.[6]

Range and habitat [edit]

Bryde's whales prefer highly productive tropical, subtropical and warm temperate waters of 61–72 °F (16–22 °C). Pygmies may prefer waters near the coast and continental shelf.[6]

Bryde's whales inhabit the Atlantic, Indian, and Pacific oceans, from 40° South to 40° North. Vagrants have been reported as far north as California and Washington. Some populations migrate seasonally, moving towards higher latitudes during the summer and towards the equator during the winter. Uniquely among baleen whales, some populations do not migrate.[6]

Population [edit]

There may be up to 90,000–100,000 animals worldwide, with two-thirds inhabiting the Northern Hemisphere.

For management purposes, the U.S. population is divided into three groups: the Eastern Tropical Pacific stock (11,000–13,000 animals), Hawaiian stock (350–500), and Northern Gulf of Mexico stock (25–40). Prior to 2006, there had only been two confirmed sightings of Bryde's whale in the eastern North Pacific north of Baja California—one in January 1963, only a kilometer off La Jolla (originally misidentified as a fin whale), and another in October 1991 west of Monterey Bay. Between August 2006 and September 2010, six sightings were made by scientists in the Southern California Bight. Five were west of San Clemente Island, and one between San Clemente Island and Santa Catalina Island. All but one involved single individuals.[13] Another sighting was made off Dana Point, California on September 19, 2009, which was originally misidentified as a fin whale.

There are insufficient data to determine population trends.

Conservation [edit]

An underwater view of a Bryde's whale off Thailand

Bryde's whale is listed as Data Deficient by the International Union for the Conservation of Nature and Natural Resources (IUCN). It is also listed in Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) Appendix I, which prohibits international trade.

The Bryde's whale is listed on Appendix II [14] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II [14] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the Bryde's whale is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU).[15]

Whaling [edit]

Historically, this species was not significantly targeted by commercial whalers, but became more important in the 1970s as the industry depleted other targets. The Japanese hunt this species as part of their scientific whaling program. Artisanal whalers have taken them off the coasts of Indonesia and the Philippines.

Modern whaling for Bryde's whales is thought to have begun from coastal stations in Japan in 1906, where it continued uninterrupted until 1987—they were also caught offshore in the western North Pacific by both Japanese (1971–79) and Soviet (1966–79) fleets, as well as from Taiwan (1976–80), the Bonin Islands (1946–52 and 1981–87) and the Philippines (1983–85). In 1997 it was estimated that over 20,000 Bryde's whales had been caught in the western North Pacific between 1911 and 1987 (it was later learned that the Japanese had falsified their reported take from the Bonin Islands between 1981–87, reporting a catch of only 2,659 instead of the true take of 4,162). A population assessment done in the mid-1990s stated that the population in the western North Pacific may have declined by as much as 49% during 1911–96. Norwegian factory ships off Baja California took an additional 34 Bryde's whales between 1924–29;[16] two were also caught off central California in 1966.[17]

An estimated 5,542 Bryde's whales were caught off Peru between 1968–83, including a reported catch of 3,589 between 1973–83. An unknown number were also caught off Chile between 1932–79. Over 2,000 were caught off Cape Province, South Africa, between 1911–67, most (1,300) during 1947–67. The majority of the 2,536 sei whales caught by the pirate whaler Sierra in the South Atlantic between 1969–76 are believed to have been Bryde's whales. At least some Bryde's whales were among the 5,000 sei whales recorded in the catch off Brazil between 1948–77, but possibly only 8%.[1]

Over 30,000 Bryde's whales were caught between 1911–87, including over 1,400 taken by the Soviets in the Southern Hemisphere between 1948–73 (only 19 were reported).[18] The peak reported catches were reached in 1973–74 and 1974–75, when over 1,800 were taken each year. In 2000 the Japanese began implementing a scientific research program involving an annual catch of 50 Bryde's whales in the western North Pacific. Nearly 500 have been caught since the program began (as of 2009).[19]

Other threats [edit]

Bryde's whales have not been reported as taken or injured in fishing operations. Bryde's whales are also sometimes killed or injured by ship strikes. Anthropogenic noise is an increasing concern for all rorquals, which communicate via low-frequency sounds.[6]

These whales are protected in the USA by the Marine Mammal Protection Act of 1972.[6]

See also [edit]

References [edit]

  1. ^ a b Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). "Balaenoptera_brydei". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 5 August 2011. 
  2. ^ Best, Peter B. 2007. Whales and Dolphins of the Southern African Subregion ISBN 978-0-521-89710-5
  3. ^ Omura, Hidero. "Review of the Occurrence of the Bryde's Whale in the Northwest Pacific". Rep. Int. Commn. (Special Issue 1), 1977, pp. 88-91.
  4. ^ Olsen, 1913
  5. ^ Wada, Oishi, and Yamada, 2003
  6. ^ a b c d e f g h i j k l "Bryde's Whale (Balaenoptera edeni)". Retrieved December 2009. 
  7. ^ Anderson, J. 1878. "Anatomical and Zoological Researches: Comprising an Account of the Zoological Results of the Two Expeditions to Western Yunnan in 1868 and 1875; and a Monograph of the Two Cetacean Genera, Platanista and Orcaella". Quaritch, London.
  8. ^ a b c Olsen, Ørjan. 1913. "On the External Characters and Biology of Bryde's Whale (Balaenoptera brydei), a new Rorqual from the Coast of South Africa". Proc. Zool. Soc. Lond., pp. 1073-1090.
  9. ^ Junge, G.C.A. 1950. "On a Specimen of the Rare Fin Whale, Balaenoptera edeni Anderson, stranded on Pulu Sugi near Singapore". Zool. Verhandl. 9, pp. 3-26.
  10. ^ a b Best, Peter B. "Two Allopatric Forms of Bryde’s Whale off South Africa". Rep. Int. Whal. Commn. (Special Issue 1), 1977, pp. 10-38.
  11. ^ Evans, Peter G. H. (1987). The Natural History of Whales and Dolphins. Facts on File.
  12. ^ Omura, H. 1966. "Bryde's whales in the Northwest Pacific". In Whales, Dolphins, and Porpoises (ed. K.S. Norris): 70-8. Univ. Calif. Press, Berkeley and Los Angeles.
  13. ^ Smultea, Mary A., Annie B. Douglas, Cathy E. Bacon, Thomas A. Jefferson, and Lori Mazzuca. "Bryde's Whale (Balaenoptera brydei/edeni) Sightings in the Southern California Bight". Aquatic Mammals (2012), 38 (1), pp. 92-97.
  14. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  15. ^ Official webpage of the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region
  16. ^ Tønnessen, Johan; Arne Odd Johnsen (1982). The History of Modern Whaling. University of California Press, Berkeley. ISBN 0-520-03973-4. 
  17. ^ Whaling in 1965–66 and summer 1966 (IWS). Luna.pos.to. Retrieved on 2011-09-15.
  18. ^ Berzin, A. 2008. The Truth About Soviet Whaling (Marine Fisheries Review), p 57.
  19. ^ International Whaling Statistics.

Bibliography [edit]

  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, 2002, ISBN 0-375-41141-0
  • Whales & Dolphins Guide to the Biology and Behaviour of Cetaceans, Maurizio Wurtz and Nadia Repetto. ISBN 1-84037-043-2
  • Encyclopedia of Marine Mammals, editors Perrin, Wursig and Thewissen, ISBN 0-12-551340-2
  • Whales, Dolphins and Porpoises, Carwardine (1995, reprinted 2000), ISBN 978-0-7513-2781-6
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Balaenoptera brydei

Balaenoptera brydei is a species of cetacean, marine mammals, in a complex group known as the Bryde’s Whales. They are the least-known and in many ways the most unusual of the rorquals. They are small by rorqual standards—no more than about 25 tonnes—prefer tropical and temperate waters to the polar seas that other whales in their family frequent; are largely coastal rather than pelagic, and although they retain the characteristic plates of whalebone that the Mysticeti use to sieve small creatures from the waters with, their diet is composed almost entirely of fish.

The Bryde’s whale is named for the Norwegian consul to South Africa, Johan Bryde, who helped set up the first whaling station in Durban, South Africa in 1908.

Bryde’s whales feed on pelagic schooling fish, such as anchovy, herring and sardine.

They are distributed widely throughout tropical and subtropical waters, with a separate, smaller, pygmy species found in tropical Western Pacific and South-East Asia.

Contents

Taxonomy

The population currently described as Balaenoptera brydei is part of a group with taxonomic confusion resulting from disputed systematics and misidentification, sometimes termed the Balaenoptera edeni complex after the early description Balaenoptera edeni Anderson, 1879. The group are very similar in appearance to Sei Whales (Balaenoptera borealis), and almost as large, and commercial whaling harvests termed all these as Bryde's whale until the 1970s. Specimens of Balaenoptera omurai have also been identified by the common name 'Bryde's whale'. The taxa are poorly known and further research is required to resolve the arrangements of these sister groups.[2]

Phylogenetic evidence suggests that it is closely related to B. edeni, but they may be separated as sister species. The names and distribution of these may be summarised as:

  • Balaenoptera brydei, Bryde’s Whale. A worldwide tropical and semi-tropical distribution, grows to 26 tonnes and 15 metres long.
  • Balaenoptera edeni; Eden's Whale, small-type Bryde's Whale, Pygmy Bryde's Whale. Found in coastal waters of the eastern Indian and western Pacific oceans.

However, a recommendation to the International Whaling Commission in 2006 suggested B. brydei should be recognised and named B. edeni.[3] Likewise, MSW3 list this name as a synonym, but acknowledges the earlier revision (Rice, 1998). The authors note further confusion over which of the proposed species is the smaller, the lack of a type specimen, and the need to split B. omurai if revised.[4] The database ITIS lists all three as valid taxa, with a similar caveat on Balaenoptera systematics.[5]

Balaenoptera edeni described a stranded specimen on the coast of Burma in 1878. In 1913 whales off the coast of South Africa were described as Balaenoptera brydei; the name commemorates Johan Bryde, a Norwegian consul and pioneer of the South African whaling industry.[6]

By the 1950s, it was thought that they were a single species, which became B. edeni (because the first proposed name for any species always has priority) but retained Bryde's Whale as the common name.[who?] Recent genetic work, however, indicates that there are in fact two separate species:[7]

"Bryde" is pronounced /ˈbrdə/ BREW-də, and "Bryde's whale" is sometimes misheard as "brutus whale". Five different types have been identified, including at least two smaller ones that tend to stay closer inshore. Alas from the point of view of taxonomic simplicity, DNA testing shows that the newly confirmed pygmy species of South-east Asia is not the same as the similar-looking small form found in the Caribbean. Complicating matters still further, there are forms which appear to be intermediate between Bryde's Whale and the Sei Whale.[citation needed]

The conservation status of Balaenoptera brydei may be listed and discussed as a subgroup of B. edeni; it is listed as Data Deficient by the IUCN,[1] and by CITES Appendix I, which prohibits international trade.

Description

The descriptions of Balaenoptera brydei are complicated by its systematic arrangement and lack of research. The species is a smaller member of the family, up to 11.5 metres (37-ft), whereas B. edeni reaches 15.5 (50-ft), male and female dimorphism is around half a meter. This species is also described as a smaller coastal dwelling form of the latter.[2]

In general, Bryde's Whales have a very broad and short head, with between 40 and 70 ventral grooves, and relatively large eyes.

The Bryde’s whale is in the rorqual family (Balaenopteridae) of baleen whales and is unique amongst these in that it has three longitudinal ridges on its head, from the tip of the snout back to the blowhole – the other rorquals have just one ridge.[2]

The whale has twin blowholes with a low splashguard to the front. Like other rorquals it has no teeth but has two rows of baleen plates.

The prominently curved, pointed dorsal fin is readily seen when a Bryde's Whale surfaces. The flippers are small and slender; the broad, centrally notched tail flukes never break the surface.

Colour varies: the back is generally dark grey or blue to black, the ventral area a lighter cream, shading to greyish purple on the belly. Some have a number of whitish-grey spots, which may be scars from parasites or shark attacks.

Bryde’s whales are believed to breed year round and their gestation period is estimated to be 12 months. Calves are about 4 m (13-ft) long at birth and weigh 1,000 kg.[clarification needed]

See also

Bibliography

  • Baker A.N.; Madon B.(2007) Bryde's whales (Balaenoptera cf. brydei Olsen 1913) in the Hauraki Gulf and Northeastern New Zealand waters. Science for Conservation 272. p. 23. Department of Conservation, New Zealand. [1]
  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, 2002, ISBN 0-375-41141-0
  • Whales & Dolphins Guide to the Biology and Behaviour of Cetaceans, Maurizio Wurtz and Nadia Repetto. ISBN 1-84037-043-2
  • Encyclopedia of Marine Mammals, editors Perrin, Wursig and Thewissen, ISBN 0-12-551340-2
  • Whales, Dolphins and Porpoises, Carwardine (1995, reprinted 2000), ISBN 978-0-7513-2781-6
  • Rice, D.W. (1998). Marine mammals of the world. Systematics and distribution. Special publication number 4. Kansas: Society for Marine Mammalogy.

References

  1. ^ a b Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera edeni. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 26 February 2009.
  2. ^ a b c Balaenoptera edeni, Species Profile and Threats Database, Department of the Environment and Heritage, Australia.
  3. ^ Perrin, W.F. & R.L. Brownell, Jr (2006).Proposed Updates to the List of Recognised Species of Cetaceans.
  4. ^ Balaenoptera edeni Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3.
  5. ^ "Balaenoptera brydei Olsen, 1913". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=612597.
  6. ^ Named after a Norwegian diplomat, The Star, December 16, 2006.
  7. ^ SPRAT, citing: Sasaki, T., M. Nikaido, S. Wada, T.K. Yamada, Y. Cao, M. Hasegawa & N. Okada (2006). Balaenoptera omurai is a newly discovered baleen whale that represents an ancient evolutionary lineage. Molecular Phylogenetics and Evolution. 41 (1):40-52.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: In North America, this whale was formerly known as B. edeni, but molecular and other data indicate that B. edeni and B. brydei are not conspecific, and only the latter species occurs in North American waters (Dizon et al. 1998, Rice 1998, Yoshida and Kato 1999, Baker et al. 2003; see also Wada and Numachi 1991).

Based on external morphology, osteology, and mtDNA, Wada et al. (2003) described B. omurai (known from the Sea of Japan, Soomon Sea, and eastern Indian Ocean) and also recognized B. brydei and B. edeni as distinct species. Molecular data indicate that Balaenoptera brydei and B. borealis (sei whale) are more closely related to each other than are B. edeni and B. brydei, and B. edeni, B. brydei, and B. borealis form a clade separate from B. omurai. Mead and Brownell (in Wilson and Reeder 2005) noted that multiple species in the B. edeni complex have been described and may be valid, but they recognized only B. edeni, pending further studies of Balaenoptera systematics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!