Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide in subtropical and warm temperate oceans (see Rice 1998 for further information).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 1400 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Tropical and warm temperate waters, often near shore in areas of high productivity. Small coastal form occurs within 30 km of coast (South Africa, Japan, Brazil, probably Baja California); larger form occurs offshore (Leatherwood and Reeves 1983). In Gulf of California, most often within 3 km of shore (Tershy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some tropical populations may be sedentary, especially inshore form (IUCN 1991); temperate populations apparently are migratory. Apparently resident populations occur in the Gulf of Mexico and southeastern Caribbean (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Coastal and offshore populations apparently prefer schooling fishes (e.g., Tershy 1992), including pilchards, anchovies, herring, and mackerel; euphausiids are an important element of the diet in some areas (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population in the mid-1980s was estimated at 30,000-55,000, though census data were incomplete (NMFS 1987). See IUCN (1991) for a fairly detailed discussion of population estimates for several regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually solitary or in small groups (e.g., Tershy 1992), though concentration have been observed in several areas (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In the Gulf of California, fed throughout the day, most often at dawn and dusk (Tershy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Gestation lasts about 1 year. In the Northern Hemisphere, calving peaks in fall. Lactation lasts probably less than a year. Females give birth usually every second year. Sexually mature apparently in about 10 years (females) or 9-13 years (males).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera brydei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCCTATATTTATTATTTGGTGCATGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAACTAGGTCAGCCCGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTGTTGGTAACAGCTCACGCCTTCGTGATAATCTTCTTCATAGTCATACCCATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCCCCTTCTTTCCTACTATTAATAGCATCCTCAATAGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTGTATCCCCCTTTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTTACCATCTTCTCCCTACATCTAGCCGGTGTATCCTCAATCCTTGGAGCCATCAATTTCATTACAACTATTATTAATATAAAACCACCTGCCATGACCCAATATCAAACGCCCCTCTTCGTATGATCCGTCCTAGTTACAGCAGTGCTACTCCTATTATCGTTACCTGTCTTAGCAGCCGGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCAATTCTGTACCAACACTTATTCTGATTCTTTGGCCACCCCGAAGTATATATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATCGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGCTACATGGGAATAGTCTGAGCTATGGTATCTATCGGGTTCTTAGGATTTATCGTATGAGCTCACCATATGTTTACAGTAGGAATAGACGTTGATACGCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera brydei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Concern has been expressed about the stocks off South Africa and in the East China Sea; populations of whale food resources (fishes) have been depleted (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Rarely exploited prior to the 1920s; subsequently harvest increased, especially off Peru and in the western North Pacific (Leatherwood and Reeves 1983). Has been subject to coastal whaling also off Chile and southern Africa. In the western North Pacific, coastal whaling continued until 1987 (IUCN 1991). Much of the range was closed to pelagic whaling beginning in the 1930s, through measures intended to protect the breeding grounds of other baleen whale species (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Balaenoptera brydei

Balaenoptera brydei is a species of cetacean, marine mammals, in a complex group known as the Bryde's whales. They are the least-known and in many ways the most unusual of the rorquals. They are small by rorqual standards—no more than about 25 tonnes—prefer tropical and temperate waters to the polar seas that other whales in their family frequent; are largely coastal rather than pelagic, and although they retain the characteristic plates of whalebone that the Mysticeti use to sieve small creatures from the waters with, their diet is composed almost entirely of fish.

Bryde’s whale is named for the Norwegian consul to South Africa, Johan Bryde, who helped set up the first whaling station in Durban, South Africa in 1908.

Bryde’s whales feed on pelagic schooling fish, such as anchovy, herring and sardine.

They are distributed widely throughout tropical and subtropical waters, with a separate, smaller, pygmy species found in tropical Western Pacific and South-East Asia.

Taxonomy[edit]

Baleen plate of Bryde's whale

The population currently described as Balaenoptera brydei is part of a group with taxonomic confusion resulting from disputed systematics and misidentification, sometimes termed the Balaenoptera edeni complex after the early description Balaenoptera edeni Anderson, 1879. The group are very similar in appearance to sei whales (Balaenoptera borealis), and almost as large, and commercial whaling harvests termed all these as Bryde's whale until the 1970s. Specimens of Balaenoptera omurai have also been identified by the common name 'Bryde's whale'. The taxa are poorly known and further research is required to resolve the arrangements of these sister groups.[2]

Phylogenetic evidence suggests that it is closely related to B. edeni, but they may be separated as sister species. The names and distribution of these may be summarised as:

  • Balaenoptera brydei, Bryde’s whale. A worldwide tropical and semi-tropical distribution, grows to 26 tonnes and 15 metres long.
  • Balaenoptera edeni; Eden's whale, small-type Bryde's whale, pygmy bryde's whale. Found in coastal waters of the eastern Indian and western Pacific oceans.

However, a recommendation to the International Whaling Commission in 2006 suggested B. brydei should be recognised and named B. edeni.[3] Likewise, MSW3 list this name as a synonym, but acknowledges the earlier revision (Rice, 1998). The authors note further confusion over which of the proposed species is the smaller, the lack of a type specimen, and the need to split B. omurai if revised.[4] The database ITIS lists all three as valid taxa, with a similar caveat on Balaenoptera systematics.[5]

Balaenoptera edeni described a stranded specimen on the coast of Burma in 1878. In 1913 whales off the coast of South Africa were described as Balaenoptera brydei; the name commemorates Johan Bryde, a Norwegian consul and pioneer of the South African whaling industry.[6]

By the 1950s, it was thought that they were a single species, which became B. edeni (because the first proposed name for any species always has priority) but retained Bryde's whale as the common name.[who?] Recent genetic work, however, indicates that there are in fact two separate species:[7]

"Bryde" is pronounced /ˈbrdə/ BREW-də, and "Bryde's whale" is sometimes misheard as "brutus whale". Five different types have been identified, including at least two smaller ones that tend to stay closer inshore. Alas from the point of view of taxonomic simplicity, DNA testing shows that the newly confirmed pygmy species of South-east Asia is not the same as the similar-looking small form found in the Caribbean. Complicating matters still further, there are forms which appear to be intermediate between Bryde's whale and the sei whale.[citation needed]

The conservation status of Balaenoptera brydei may be listed and discussed as a subgroup of B. edeni; it is listed as Data Deficient by the IUCN,[1] and by CITES Appendix I, which prohibits international trade.

Description[edit]

The descriptions of Balaenoptera brydei are complicated by its systematic arrangement and lack of research. The species is a smaller member of the family, up to 11.5 metres (37-ft), whereas B. edeni reaches 15.5 (50-ft), male and female dimorphism is around half a meter. This species is also described as a smaller coastal dwelling form of the latter.[2]

In general, Bryde's whales have a very broad and short head, with between 40 and 70 ventral grooves, and relatively large eyes.

Bryde’s whale is in the rorqual family (Balaenopteridae) of baleen whales and is unique amongst these in that it has three longitudinal ridges on its head, from the tip of the snout back to the blowhole – the other rorquals have just one ridge.[2]

The whale has twin blowholes with a low splashguard to the front. Like other rorquals it has no teeth but has two rows of baleen plates.

The prominently curved, pointed dorsal fin is readily seen when a Bryde's whale surfaces. The flippers are small and slender; the broad, centrally notched tail flukes never break the surface.

Colour varies: the back is generally dark grey or blue to black, the ventral area a lighter cream, shading to greyish purple on the belly. Some have a number of whitish-grey spots, which may be scars from parasites or shark attacks.

Bryde’s whales are believed to breed year round and their gestation period is estimated to be 12 months. Calves are about 4 m (13-ft) long at birth and weigh 1,000 kg.[clarification needed]

See also[edit]

Bibliography[edit]

  • Baker A.N.; Madon B.(2007) Bryde's whales (Balaenoptera cf. brydei Olsen 1913) in the Hauraki Gulf and Northeastern New Zealand waters. Science for Conservation 272. p. 23. Department of Conservation, New Zealand. [1]
  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, 2002, ISBN 0-375-41141-0
  • Whales & Dolphins Guide to the Biology and Behaviour of Cetaceans, Maurizio Wurtz and Nadia Repetto. ISBN 1-84037-043-2
  • Encyclopedia of Marine Mammals, editors Perrin, Wursig and Thewissen, ISBN 0-12-551340-2
  • Whales, Dolphins and Porpoises, Carwardine (1995, reprinted 2000), ISBN 978-0-7513-2781-6
  • Rice, D.W. (1998). Marine mammals of the world. Systematics and distribution. Special publication number 4. Kansas: Society for Marine Mammalogy.

References[edit]

  1. ^ a b Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera edeni. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 26 February 2009.
  2. ^ a b c Balaenoptera edeni, Species Profile and Threats Database, Department of the Environment and Heritage, Australia.
  3. ^ Perrin, W.F. & R.L. Brownell, Jr (2006).Proposed Updates to the List of Recognised Species of Cetaceans.
  4. ^ Balaenoptera edeni Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  5. ^ "Balaenoptera brydei Olsen, 1913". Integrated Taxonomic Information System. 
  6. ^ Named after a Norwegian diplomat, The Star, December 16, 2006.
  7. ^ SPRAT, citing: Sasaki, T., M. Nikaido, S. Wada, T.K. Yamada, Y. Cao, M. Hasegawa & N. Okada (2006). Balaenoptera omurai is a newly discovered baleen whale that represents an ancient evolutionary lineage. Molecular Phylogenetics and Evolution. 41 (1):40-52.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: In North America, this whale was formerly known as B. edeni, but molecular and other data indicate that B. edeni and B. brydei are not conspecific, and only the latter species occurs in North American waters (Dizon et al. 1998, Rice 1998, Yoshida and Kato 1999, Baker et al. 2003; see also Wada and Numachi 1991).

Based on external morphology, osteology, and mtDNA, Wada et al. (2003) described B. omurai (known from the Sea of Japan, Soomon Sea, and eastern Indian Ocean) and also recognized B. brydei and B. edeni as distinct species. Molecular data indicate that Balaenoptera brydei and B. borealis (sei whale) are more closely related to each other than are B. edeni and B. brydei, and B. edeni, B. brydei, and B. borealis form a clade separate from B. omurai. Mead and Brownell (in Wilson and Reeder 2005) noted that multiple species in the B. edeni complex have been described and may be valid, but they recognized only B. edeni, pending further studies of Balaenoptera systematics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!