Overview

Brief Summary

Biology

The fat dormouse is nocturnal, and lives in groups with related individuals (4). Adapted for climbing and leaping through the tree canopy (3), this species feeds on nuts, fruit, bark and fungi as well as animal matter including insects, bird eggs and even small birds (4). The breeding season occurs between June and August, during this time, fighting between males may occur over access to females (3). Females attract males to mate with them by rubbing their anal area along the ground. This produces an odour trail, which the male sniffs and scent-marks (5). Whistling sounds also indicate readiness to mate. The male will pursue the female for a while; she may rebuff him aggressively, but when he gives up she often follows him, and mating occurs (5). Males usually leave the female after mating takes place in order to find more potential mates (5). Females produce one litter a year, consisting of 2-9 young (4), typically in a nest inside a hollow tree (3), lined with grass, feathers and hairs (5). The young are born blind, naked and helpless, and are weaned by about 4 weeks of age (3). Mother and offspring seem to learn to recognise each other by exchanging saliva (7). The fat dormouse hibernates underground or in grass-lined hollows in trees from October to April (4). Towards the end of summer they begin to construct tunnels in the ground; they enter these tunnels to hibernate as soon as the weather begins to get cold, and groups of fat dormice have been found hibernating together (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The fat, or edible dormouse was introduced to Britain in 1902 (3). This is a fairly large dormouse, with a very bushy tail and short, thick silvery grey fur which is white or yellowish-white underneath (3); overall it has a somewhat squirrel-like appearance (2). The hands and feet have hard pads, which are adaptations for climbing (3). The name 'edible' dormouse arose as the Romans used to eat them as a delicacy (2); the alternative name of 'fat' dormouse refers to the appearance of this species before it goes into hibernation (4). Furthermore, the Romans used to fatten these rodents on chestnuts and acorns inside clay pots called 'glisaries' or enclosures prior to eating them (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Glis glis has a global distribution that extends across Europe and through northern Turkey to the Caucasus, northern Iran and Turkmenistan. In the Mediterranean, it occurs from northern Spain through central and eastern Europe, as far as Latvia in the north and Italy and the Balkan Peninsula in the south (Kryštufek 1999). It is found on a number of Mediterranean islands, but the population in the British Isles is the result of an introduction in 1902 (Kryštufek 1999, Battersby 2005). It is recorded from sea level to 2,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Glis glis is a European species. It occurs from France and northern Spain to the Volga River and northern Iran. Glis glis also occurs on the islands of Sardinia, Corsica, Sicily, Crete, and Corfu. (Nowak 1991)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In Great Britain, this dormouse has a small distribution that is restricted to the Chiltern Hills, but its range is expanding. It occurs throughout central Europe (4), but has declined in many areas and is uncommon (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The approximate length of the head-body is 14-20 cm. They have a gray back and head with dark, narrow rings around the eyes. The underparts are white or yellowish. Their pelage is short, soft, and thick. These animals are squirrel-like with large and rounded ears, small eyes, and a long bushy tail (11-19 cm). The hands and feet are both equipped with hard pads for use in climbing. The four digits of the forefeet and the five digits of the hindfeet have short, curved claws. Glis glis is sciurognathous and myomorphous. Dental formula: 1/1, 0/0, 1/1, 3/3. (Nowak 1991; Niethammer 1990; MacDonald 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is typically found in mature deciduous and mixed woodland, where it frequents the canopy, although it also occurs in maquis and shrubland on rocky areas along the Mediterranean coast. Man-made habitats such as gardens and orchards are sometimes used, and the species often enters buildings (Macdonald and Barrett 1993, Kryštufek 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Glis glis inhabits inhabits deciduous or mixed forests and fruit orchards in both the lowlands and mountains. The most common site for daily shelter is the hollow of trees. The hollows may be lined with grass or other vegetation. Glis glis also shelters in crevices between rocks, burrows among tree roots, woodpecker holes, piles of mulch, attics, barns, and artificial nest boxes. (Nowak 1991)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits mature broadleaved woodland, gardens, houses and orchards (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Glis glis is omnivorous. It feeds mainly on seeds, leaves, buds, nuts, berries, acorns, and soft fruits. They eat insects occasionally and have been known to eat small birds. (Niethammer 1990; Nowak 1991)

Animal Foods: birds; insects

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
8.7 years.

Average lifespan

Status: wild:
9.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.7 years (captivity) Observations: One animal lived 8.7 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Glis glis have one litter a year. The litter can consist of 1-11 individuals, but usually falls in the range of 4-6 offspring. Their gestation period is 30-32 days and the young weigh 1-2 g at birth. G. glis is usually weaned at 5-6 weeks and reaches maturity after 1-2 years. To attract males to mate, the females will drag their anal region across the ground to produce an odor marking. These trails are eagerly sniffed by the males, which then leave their marks on top. Also, edible dormice can make a whistling sounds at short intervals over long periods, which announce their willingness to mate. The wanting male pursues the female and makes a fine chirping sound with its mouth closed. At first, the female runs away or defends itself, purring and rattling its teeth and beating its paws. It may even jump the male and bite it. These acts are believed to be play because when the male gives up the female will follow it.

After mating, the female spends more time bringing nesting material into the den and becomes very sensitive to interference. It uses hairs and feathers as lining material. The nests are usually off the ground, in a hole in a tree for example. The young of G. glis exit the womb with the hind end first. The offspring are quite undeveloped at birth. The external ears unfold after 5 days; the auditory canal opens after 12 days; the eyelids separate after 21 days; the lower rodent teeth come through after 13 days while the upper ones come through after 2o days.

Mating season for G. glis is usually in July. The young are born around August, which gives about two months of growing time before they have to hibernate at the end of October.

(Niethammer 1990; MacDonald 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Glis glis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0081-06|AJ001562|Glis glis| AACCGTTGATTCTTTTCAACAAATCACAAAGACATTGGCACGCTATATCTACTATTTGGTGCTTGAGCCGGAATAGTTGGTACAGCCTTA---AGTCTCTTAATCCGTGCTGAACTAGGCCAACCCGGAGCACTACTGGGTGAT---GATCAAATCTATAACGTTATTGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTTATACCAATTATGATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATA---ATTGGAGCCCCTGATATAGCGTTCCCACGAATAAATAATATAAGCCTCTGACTCCTTCCACCTTCCTTTCTTCTTCTCTCAGCCTCCTCTATAGTAGAAGCAGGGGCAGGTACAGGTTGAACTGTATATCCCCCTCTTGCAGGAAATTTAGCTCACGCAGGAGCCTCTGTTGACTTA---ACATTTTTTTCACTTCATCTAGCAGGGAGCGCCTCAATTTTAGGTGCCATTAATTTTATCACAACAATTATTAATATAAAACCTCCTGCAATATCTCAATATCAAACTCCATTATTCGTATGGTCAGTATTAATTACTGCTGTCTTAATTATTCTATCTCTTCCAGTACTAGCAGCA---GGTATTACTATATTACTAACAGACCGTAATCTCAATACTACCTTTCTTTACCCTGCTGGAGGAGGAGACCCTATTTTATACCAACACCTATTCTGATTCTTTGGTCACCCCGAAGTATATATTCTACTTTTTACCTGGTTTGGAATTATTTCACATCGGACCACCTATTATTCAGGAAAAAAA---GAACCCTTCGGATATATAGGCATGGTAGGAGCCATAATATCCATTGGATTCCTAGGATTTATTGTATGAGCTCACCATATATTTACCGTAGGATTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Glis glis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G., Muñoz, L.J.P, Meinig, H. & Juškaitis, R.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
A common and widespread species. Declines are occurring in the northernmost part of the range, but in the southern part it is abundant and considered a pest species. Consequently it is assessed as Least Concern.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Glis glis is still rather common in Europe, occurring about 1 animal per hectare to 30 animals per hectare. Their numbers have decreased as a result of habitat destruction. (Niethammer 1990)

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk/ near threatened by the IUCN Red List 2002 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In northern parts of its range it is scarce and may be declining, whereas in southern parts of its range it is sufficiently abundant to be considered an agricultural pest in years of high population density. In central Europe, typical population densities may be c.5 individuals per hectare, although densities of 20-22 individuals per hectare have been recorded (Kryštufek 1999).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In parts of its range, including Slovenia, Croatia, and Italy, there is a tradition of hunting this species. In the past, it was a source of meat, fat, and skins for subsistence and trade, but today it is hunted recreationally (Kryštufek 1999). The species is protected in Italy, but is sometimes illegally hunted (G. Amori pers. comm. 2006). In northeastern Europe, cutting of oak forests is a threat (Juškaitis 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This introduced species is considered to be a pest of orchards and forestry, as it can damage fruit crops and its habit of bark stripping is very destructive (4). In houses they can cause serious problems by chewing through wires and wood. They are therefore controlled in some areas (4). They have declined in many parts of the European range as a result of deforestation (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appenix III of the Bern Convention. It occurs in protected areas throught its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In Great Britain there is no conservation action in place for this non-native mammal (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In some areas Glis glis is considered very harmful to the production of fruit and wine. G. glis has been known to do considerable damage to trees and is considered a nuisance. (Hoodless 1993; Nowak 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Glis glis is known for its luxuriant fur. In ancient Rome, its meat was considered a delicacy. In some parts of Europe, the meat of G. glis is still considered a gourmet dish. (Nowak 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Edible dormouse

The edible dormouse or fat dormouse (Glis glis) is a large dormouse and the only living species in the genus Glis.[2]

Contents

Description

The edible dormouse is the largest of all dormice, being around 14 to 19 centimetres (5.5 to 7.5 in) in head-body length, plus a 11 to 13 centimetres (4.3 to 5.1 in) tail. It normally weighs from 120 to 150 grams (4.2 to 5.3 oz), but may almost double in weight immediately prior to hibernation. It has a generally squirrel-like body, with small ears, short legs, and large feet. Its fur is grey to greyish-brown in colour over most of the body, with a clear line separating off the white to pale buff underparts. Unlike most other dormice, there are no dark markings on the face, aside from faint rings around the eyes. The tail is long and bushy, with fur slightly darker than that on the body. Females have from four to six pairs of teats.[3]

The edible dormouse is capable of limited autotomy; if another animal grasps the tail, the skin breaks easily and slides off the underlying bone, allowing the dormouse to escape. The exposed vertebrae then break off and the wound heals over, forming a fresh brush of hair.[3]

Distribution

The edible dormouse is found throughout much of western Europe, although it is absent from Portugal, Scandinavia, and most of Spain and the British Isles, as well as from the northern coasts of France, Germany, and the Low Countries. It is rather more sparsely distributed through central Europe and the Balkans, but can be found as far north-east as the upper Volga River. It is also found on a number of Mediterranean and Baltic islands, including Sardinia, Corsica, Sicily, and Crete. Beyond Europe, it is found in scattered populations throughout northern Anatolia, the Caucasus region, and along the southern coast of the Caspian Sea.[3]

It was accidentally introduced to the town of Tring in England through an escape from Lionel Walter Rothschild's private collection in 1902.[4] As a result, the British edible dormouse population, now 10,000 strong,[5] is concentrated in a 200-square-mile (520 km2) triangle between Beaconsfield, Aylesbury and Luton.[6]

Though this animal is regarded as a pest by some,[4] in the United Kingdom the Wildlife and Countryside Act 1981 prohibits certain methods of killing and taking it, and removing them may require a licence.[5]

Ecology and habitat

Edible dormice inhabit deciduous forests dominated by oak and beech, from sea level to the upper limits of such forests at 1,500 to 2,000 metres (4,900 to 6,600 ft). They prefer dense forests with rocky cliffs and caves, but may be found in maquis vegetation, orchards, and urban margins. They have frequently been reported from caves as deep as 400 metres (1,300 ft), where they can shelter from predators.[3]

Population densities range from 2 to 22 individuals per hectare.[7] Females inhabit only very small home ranges, of 0.15 to 0.76 hectare (0.37 to 1.9 acres), but males occupy much larger ranges of 0.8 to 7 hectares (2.0 to 17 acres), with several burrows.[8]

Edible dormice are primarily herbivorous, feeding mainly on berries, apples, and nuts. However, they are adaptable, and have also been reported to eat bark, leaves, flowers, invertebrates, and even eggs. When present in large numbers, they may cause damage to orchards and be considered a pest. Their primary predators include owls, foxes, pine martens, and wildcats.[3]

Behaviour

Edible dormouse

Edible dormice are nocturnal, spending the day in nests taken from birds, or located in hollow trees or similar shelter. They are good climbers, and spend most of their time in the trees, although they are relatively poor jumpers. They are not generally social animals, although small groups of closely related adults have occasionally been reported.[9]

Communication is partly by sound, with the animals making various squeaks or snuffling sounds, and partly by scent. Scent glands are present on the feet and at the base of the tail, and are used to mark the ground, especially during periods of sexual activity.[3]

Edible dormice hibernate from roughly October to May, depending on local climatic conditions. They prepare a den in soft soil or hidden in a cave, and rely on fat reserves to survive through the winter. During hibernation, metabolic rate and body temperature fall dramatically, and the animal may cease breathing altogether for periods of up to an hour.[10]

Reproduction

The breeding season is from late June to mid August, and results in only one litter per year. Males are non-territorial, and may visit the territories of several nearby females to mate, becoming aggressive to any other males they encounter. The male attracts a female by squeaking, then conducts a circular courtship dance before mounting her.

Gestation lasts from 20–31 days, and results in the birth of anything up to eleven young, although four or five is more typical. The young are initially blind and helpless, and weigh around 2 to 3 grams (0.071 to 0.11 oz). They develop their fur by 16 days, and open their eyes after around 3 weeks. They begin to leave the nest after around 30 days, and are sexually mature by the time they complete their second hibernation.[3] Compared with similarly sized mammals, they have an unusually long lifespan, and have been reported to live up to twelve years in the wild.[11]

Evolution

Although the edible dormouse is the only living member of its genus, a number of fossil species are also known. The genus Glis first originated in the middle Oligocene, although it did not become common until the Pliocene. By the Pleistocene, only one species, Glis sackdillingensis, is known to have survived, and this is likely the ancestor of the modern species, which first appeared in the early to mid Pleistocene.[3]

In cuisine

Edible dormouse in a cellar

It was farmed and eaten by the ancient Romans (usually as a snack), hence the word edible in its name. The dormice were kept and raised either in large pits or (in less spacious urban surroundings) in terra cotta containers, the gliraria,[12] something like contemporary hamster cages.

To this day, wild edible dormice are consumed in Slovenia, where they are considered a rare delicacy and dormouse trapping an ethnic tradition.[13] Use of dormice for food and fur and of dormouse fat as a medicament is documented there since the 13th century. Seasonal dormice feasts were welcome protein supplements for the impoverished peasantry.[14]

References

  1. ^ Amori, G. et al. (2010). Glis glis. In: IUCN 2010. IUCN Red List of Threatened Species. Downloaded on 9 October 2010.
  2. ^ Holden, Mary Ellen (16 November 2005). "Family Gliridae (pp. 819-841)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 841. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12500044. 
  3. ^ a b c d e f g h Kryštufek, B. (2010). "Glis glis (Rodentia: Gliridae)". Mammalian Species 42 (1): 195–206. doi:10.1644/865.1. http://www.asmjournals.org/doi/full/10.1644/865.1. 
  4. ^ a b "Invasion of the glis glis". Daily Mail. 2006-10-23. http://www.dailymail.co.uk/pages/live/articles/news/news.html?in_article_id=406658&in_page_id=1770. Retrieved 2008-03-29. 
  5. ^ a b "Edible Dormice (Glis glis)". Natural England. 2008-11-11. http://www.naturalengland.org.uk/ourwork/regulation/wildlife/species/edibledormice.aspx. Retrieved 2009-05-02. 
  6. ^ "The Glis Glis Around Amersham." Amersham - News, Views and Information. 3 October 2007
  7. ^ Bieber, C. (1995). "Dispersal behaviour of the edible dormouse (Myoxus glis L.) in a fragmented landscape in central Germany". Hystrix 6 (1): 257–263. http://leo.cilea.it/index/hystrix/article/download/4037/3973. 
  8. ^ Ściński, M. & Borowski, Z. (2008). "Spatial organization of the fat dormouse (Glis glis) in an oak-hornbeam forest during the mating and post-mating season". Mammalian Biology 73 (2): 119–127. doi:10.1016/j.mambio.2007.01.002. http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B7GX2-4NYSHBK-1&_user=10&_coverDate=03%2F15%2F2008&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_searchStrId=1491278178&_rerunOrigin=google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=a05164b81b497d059f832cf3a281b702&searchtype=a. 
  9. ^ Marin, G. & Pilastro, A. (1994). & Pilastro 1994 Anim Behav.pdf "Communally breeding dormice, Glis glis, are close kin". Animal Behaviour 47: 1485–1487. http://www.bio.unipd.it/behavecol/pdf/Marin & Pilastro 1994 Anim Behav.pdf. 
  10. ^ Wilz, M. et al. (2000). ventilation in hibernating dormice—is ventilation always necessary to meet metabolic demands%3F&f=false "Intermittent ventilation in hibernating dormice—is ventilation always necessary to meet metabolic demands?". Life in the cold. Eleventh International Hibernation Symposium: 169–178. http://books.google.com/books?id=oBw3U2916qQC&pg=PA169&lpg=PA169&dq=Intermittent+ventilation+in+hibernating+dormice—is+ventilation+always+necessary+to+meet+metabolic+demands%3F&source=bl&ots=FJ52L3gPWf&sig=Yn7J7rb5R_RpOpkiQhsydO-xSj8&hl=en&ei=c8mwTMjxGcj34AbXlIHsBg&sa=X&oi=book_result&ct=result&resnum=1&ved=0CBIQ6AEwAA#v=onepage&q=Intermittent ventilation in hibernating dormice—is ventilation always necessary to meet metabolic demands%3F&f=false. 
  11. ^ Pilastro, A. et al. (2003). et al 2003 Ecology.pdf "Long living and reproduction skipping in the fat dormouse". Ecology 84 (7): 1784–1792. http://www.bio.unipd.it/~pilastro/pdf/Pilastro et al 2003 Ecology.pdf. 
  12. ^ E. Saglio, "Glirarium". In Daremberg and Saglio, Dictionnaire des Antiquités Grecques et Romaines, Tome II (Volume 2), page 1613, Librairie Hachette et Cie., Paris, 1877–1919.
  13. ^ Krofel, Miha (2009). "Confirmed presence of territorial groups of golden jackals (Canis aureus) in Slovenia". Natura Sloveniae: Journal of Field Biology (Association for Technical Culture of Slovenia) 11 (1): pp. 65–68. ISSN 1580-0814. http://web.bf.uni-lj.si/bi/NATURA-SLOVENIAE/pdf/NatSlo_11_1_4.pdf. Retrieved 18 January 2011. 
  14. ^ Haberl, Werner. "Dormouse Hunting in Slovenian Tradition." Dormouse Culture, Tradition & Myths. 2007. 3 October 2007
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!