Overview

Comprehensive Description

Description

Small, rather variable jerboa. Upper parts varying in color from orangish to  reddish  brown. Fur long and soft. Flanks orange to gray. Thighs orange to reddish brown with pale, gray to white thigh bands meeting at base of tail. Underparts and forelimbs white. Hind limbs elongated, white, and may or may not be black at the back of the lower leg. Hind feet greatly elongated with three toes, the central one being longest. Sole of hind foot naked with toe pads obscured by long, silky white fur that probably gives the jerboa pur­chase on soft sand. Head proportionately large with prominent eyes, and large, rounded ears, not highly elongated and only pigmented at tip. Face largely pale. White patch above eye prominent. White patch behind ear indistinct. Tail long, colored same as the upper parts above, paler below. Coloration of feathered tip complex and tricolored-white, black, white. Terminal tip white preceded by sub termi­nal black band that may or may not be white below. This is, in turn, preceded by a whitish band.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found throughout North Africa and the Arabian Peninsula as far east as southwestern Iran. It is found in desert and semi-desert with patchy records from Senegal and Mali through Mauritania and Morocco to Algeria, Tunisia, Libya, Egypt, Eritrea and Somalia (though absent from the Nile Delta). The distribution is likely somewhat more continuous, though nevertheless dependent on suitable habitat. The species has been recorded to elevations of 1,500 m asl (Egypt).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Jaculus jaculus can be found in central Asia, North Africa and Arabia in countries such as Sudan, Israel, and Morocco. The species is especially common in Egypt, where it gets its common name, Lesser Egyptian Jerboa.

Biogeographic Regions: palearctic (Native )

  • Brown ET AL., 1994. Coexistence of Negev Desert Rodents. Ecology, 75: 2290-2297.
  • The Johns Hopkins University Press. 1997. "Walker's Mammals of the World" (On-line). Accessed February 10, 2004 at http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/rodentia.dipodidae.jaculus.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

170 records. Latest in 2001 (El-Dab’aa, Matruh, Ras El-Hekma).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO=96.6 km². EOO=950904.8 km². 11 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Narrow (Mauritania & Senegal to Egypt & Ethiopia, east to Iraq).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Jaculus jaculus is the smallest species in the genus Jaculus. It is very small with a darkish back and lighter colored underbelly. There is also a light-colored stripe across its hip. Jerboas are a lot like a tiny kangaroo in locomotion and posture. The hind feet are incredibly large, 50 to 75 mm, and used for jumping. Each hind foot has three toes. The tail is very long, 128 to 250 mm, with a clump of hairs at the tip which is used for balance. It has moderately large eyes and ears. Females are larger than males.

Range mass: 43 to 73 g.

Average mass: 55 g.

Range length: 95 to 110 mm.

Average length: 100 mm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average basal metabolic rate: 0.515 W.

  • 2002. "BBC - Nature Wildfacts" (On-line). Accessed February 10, 2004 at http://www.bbc.co.uk/nature/wildfacts/factfiles/620.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 95-120 mm, tail 150-205 mm, weight 55 gm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck & J. Shaw
Year Collected: 1962
Locality: Agedabia, 10 km S, Cyrenaica, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 242.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1962
Locality: Garian, 25 km N, Tripolitania, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 240.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1962
Locality: El Giof, Cufra Oasis, Cyrenaica, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1962
Locality: Tazerbo Oasis, Cyrenaica, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 236.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1962
Locality: Edri, Fezzan, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1962
Locality: Wadi er Rueis, Gebel el Harug el Asued, 340 km WNW Tazerbo Oasis, Cyrenaica, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 230.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): H. Setzer
Year Collected: 1961
Locality: Gebel Uweinat, Ain Zueia, Cyrenaica, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 228.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Jaculus jaculus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): G. Ranck
Year Collected: 1961
Locality: El Gheddahia, 7 km S, Tripolitania, Libya, Africa
  • Type: Ranck, G. L. 1968 Oct 02. United States National Museum Bulletin. 275: 226.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Type specimen from Giza pyramids area. Many names described of sspp, but none recognised now.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat of this species varies across the range, from sand dunes to rocky substrates, however, it is always found near to vegetation. It is a strictly nocturnal species, and its remains are commonly found in owl pellets. The species has a litter size of four to five young.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Jaculus jaculus lives in desert and semi-desert areas that can be sandy or stony. They can also be found in less numbers in rocky valleys and meadows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhibits desert areas of soft sand or rocks from sea level to foot of mountains.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Although lesser Egyptian jerboas lives in the desert, they do not drink, depending on the greens and insects that they eat to provide enough water and moisture. Their diet consists of roots, grass, seeds, grains, with some insects.

Animal Foods: insects

Plant Foods: roots and tubers; seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Jaculus jaculus as prey provides nourishment and water to other animals in the desert. It helps to disperse seeds in the desert. A vacated jerboa burrow could become home to spiders and scorpions. Jerboas are also homes themselves for numerous kinds of parasites such as ticks, fleas, mites, lice.

Ecosystem Impact: disperses seeds; creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Jaculus jaculus is very fast when hopping and escape seems to be its defense against predators. Individuals often run down into their burrows to get away as well. They do not bite often when handled, so they do not have any real means of defense against predators when caught. The predators of this species are desert carnivores including pallid foxes (Vulpes pallida), Nile foxes (Vulpes vulpes), striped weasels (Ictonyx striatus), saw-scaled vipers (Echis carinatus), and moila snakes (Malpolon moilensis). Some humans eat jerboas as well.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Because J. jaculus is solitary, not much is known about how individuals communicate with one another. Animals in captivity seem to recognize each other by smell. They close their eyes and come together until thier noses touch and keep contact for 1 to 5 seconds in this way.

Communication Channels: tactile ; chemical

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

The lesser Egyptian jerboa is a strictly nocturnal species, feeding on seeds, insects and succulent parts of desert grasses, which it detects using its acute sense of smell. Amazingly, it does not need to drink in order to survive the arid desert conditions, relying on its food to provide it with all its water needs. The lesser Egyptian jerboa can travel long distances in search of food, up to ten kilometers a day, which it easily covers thanks to its large feet and hopping stride; the jerboa is known to leap up to three meters in a single bound.

The lesser Egyptian jerboa lives in burrows, dug in counter clockwise spirals with its forelimbs and teeth, which it uses for a variety of functions. The permanent burrows are often complex systems with multiple entrances and exits, consisting of storage chambers, hibernation chambers and a nesting chamber at the very bottom. The burrows are well-hidden and sealed with a plug of sand in late spring and summer to keep the heat out and moisture in, providing an ideal place for the animal to rest, evade predators and escape from the heat of the day. During particularly hot or dry spells the jerboa will aestivate in the burrow and in winter it is thought to hibernate, but this has only been reported in a few individuals.

Not much is known about the breeding habits of jerboas due to their solitary and nocturnal nature. However, breeding is known to occur at least twice a year, between June to July and from October to December. Males attempt to attract females by performing a bizarre ritual display; standing on its hind legs in front of an approaching female, the male faces his potential mate and then begins to slap the female at regular intervals with his short front limbs. A successful mating usually produces a litter of four to five young that become independent at around eight to ten weeks, and sexually mature at eight to twelve months. On the whole, the lesser Egyptian jerboa is silent but when disturbed or handled it can emit grunting noises or shrill shrieks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Jaculus jaculus cannot be bred in captivity due to lack of maternal care. However, captured young jerboas have been successfully tamed and kept as pets. These tame jerboas can live up to 6 years. The oldest jerboa found in the wild was 4 years old.

Range lifespan

Status: wild:
3 to 4 years.

Range lifespan

Status: captivity:
5 to 6.4 years.

Typical lifespan

Status: wild:
2 to 3 years.

  • 2000. "UAE INTERACT" (On-line). Accessed February 10, 2004 at http://uaeinteract.com/nature/mammal/mam17.asp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.3 years (captivity) Observations: These animals are difficult to breed in captivity, though some success has been obtained recently in several institutions. One captive specimen lived for 7.3 years (Richard Weigl 2005). There is a considerable variance in the age at sexual maturity and the gestation period reported for this species in different sources.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Not much is known about the mating system of J. jaculus because they are solitary and nocturnal. However, it appears as though a male will mate with any number of females he comes across, while a female will mate with only one male.

Mating System: polygynous

A male jerboa attracts a mate by standing on his hind legs in front of a female. When the female approaches, he faces her and slaps her at regular intervals with his short front limbs. Lesser Egyptian jerboas breed at least twice yearly, and every three months in captivity. Breeding occurs from June to July and from October to December. Females have an average of 3 young per litter. Young reach independence at 8 to 10 weeks, and become sexually mature at 8 to 12 months.

Breeding interval: Lesser Egyptian jerboas breed at least twice yearly, and every three months in captivity.

Breeding season: Breeding occurs from June to July and from October to December.

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Average gestation period: 25 days.

Average weaning age: 6 weeks.

Range time to independence: 8 (low) weeks.

Average time to independence: 10 weeks.

Range age at sexual or reproductive maturity (female): 8 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 2 g.

Average gestation period: 45 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
137 days.

Jaculus jaculus bred in captivity do not survive. The mother will not touch the pups after they are born. In one case, the mother kicked the babies out of the nest. In the wild, however, the babies and the female are brought into close contact in the burrow. At birth, the pups are hairless and tiny with a head and body around 25 mm, tail around 16 mm. They weigh about 2 g and their hind feet are much shorter in proportion to adults at around 9 mm. Their eyes are closed over, but they can crawl around using their front limbs. The young will not leave the burrow until they are able to be self-sufficient at around 8 weeks of age.

Parental Investment: altricial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female); pre-independence (Provisioning: Female)

  • 2002. "BBC - Nature Wildfacts" (On-line). Accessed February 10, 2004 at http://www.bbc.co.uk/nature/wildfacts/factfiles/620.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Jaculus jaculus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0097-06|AJ416890|Jaculus jaculus| ACACGTTGACTTTTCTCAACTAACCACAAAGACATCGGAACTCTATACATAATCTTCGCTGCTTGGGCCGGGATAATTGGTACTGCCTTG---AGCATCCTCATTCGAGCCGAACTTGGCCAACCAGGGGCCCTAATAGGAGAC---GACCAGATTTACAACGTTGTTGTAACCGCTCATGCCTTCGTAATAATTTTCTTCATAGTTATACCGATAATGATTGGAGGATTTGGCAACTGACTAGTACCACTAATA---ATCGGAGCCCCAGACATAGCCTTCCCTCGAATAAACAATATGAGCTTTTGGCTTCTACCTCCATCATTCCTTCTCCTCTTAGCCTCATCTATAATTGAAGCAGGCGCCGGCACAGGGTGAACTGTATACCCACCATTAGCTGGAAATCTAGCCCACGCAGGAGCATCAGTAGACCTA---GCCATTTTCTCTCTCCACTTAGCCGGAGTATCATCCATTCTTGGCGCTATCAATTTTATTACAACTATCATCAACATAAAACCTCCAGCTCTTTCCCAATACCAGACACCCTTATTTGTATGATCCGTCCTTATTACAGCAGTCCTTCTACTTCTCTCCCTACCCGTCTTAGCAGCA---GGTATCACAATACTTCTAACAGATCGTAACCTAAATACCACATTTTTCGATCCCGCTGGAGGAGGAGACCCGATCCTCTATCAGCACTTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTCCCTGGGTTCGGCATTATTTCTCATATCGTTACTTACTATTCCGGCAAAAAA---GAACCATTCGGCTACATAGGAATAGTCTGAGCCATAATATCAATCGGTTTCTTAGGGTTTATCGTATGAGCCCACCATATATTTACTGTAGGCCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Jaculus jaculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G., Palomo, L.J. & Aulagnier, S.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because this species has a wide (albeit patchy) distribution range and a large population. Although there is significant exploitation in parts of the range, this is not currently thought to be causing population declines sufficient to trigger listing in a more threatened category.

History
  • 2004
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As of right now, this species is not on any conservation lists.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Uncommon.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A widespread species, although somewhat patchily distributed in parts of its range. Reported to be common in a number of range states (e.g. Qatar, Jordan), but not considered an abundant species in African parts of the range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In some areas in Jordan, the species is spotlighted and hunted for food and bait for falconry. Locally eaten by humans, since they are easily caught through their burrow systems. Can be trapped during grooming outside the burrow and are considered edible by several tribes of Bedouin in Jordan and the Negev (Qumsiyeh 1996). In Syria, there is massive capture (using spotlights at night), and the species is sold to falconers for food (G. Serra pers. comm.). In Africa there are no major threats to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is presumed to occur in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of J. jaculus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Some humans eat jerboas for food. Jerboas are becoming popular pets because they are easily tameable and do not commonly bite.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser Egyptian Jerboa

The Lesser Egyptian Jerboa الجربوع, Jaculus jaculus, is a small rodent of Africa and the Middle East. Its diet consists of seeds and grasses, however the Jerboa needs very little water to survive.

Lesser Egyptian Jerboa skeletons mounted to show a sequence of jump movements, Muséum national d'histoire naturelle, Paris

References

  1. ^ Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G., Muñoz, L.J.P. & Aulagnier, S. (2008). Jaculus jaculus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 16 March 2009. Database entry includes a brief justification of why this species is of least concern
  • Holden, M. E. and G. G. Musser. 2005. Family Dipodidae. pp. 871–893 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!