Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range Description

Michoacan, Sinaloa, and Tamaulipas (Mexico) to Ecuador, Peru, west of the Andes only; Greater and Lesser Antilles (south to Granada), S Bahamas (Larsen et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The northern range of Artibeus jamaicensis extends into central Mexico and continues south throughout Central America, and into northern South America. In South America, A. jamaicensis lives west of the Andes, in northern Venezuela, northwest Columbia, and western Ecuador. Resident populations have been reported in the lower Florida Keys. The distribution of A. jamaicensis in the Caribbean is continuous throughout and encompasses the Bahamas, Greater and Lesser Antilles, as well as the Netherlands Antilles, and Trinidad and Tobago. The range of A. jamaicensis once was thought to extend south to Amazonian Brazil, Paraguay and Northern Argentina, but mammalogists have recently recognized those populations as separate species, Artibeus obscurus and Artibeus jamaicensis planirostris.

Biogeographic Regions: neotropical (Native )

  • 2004. American leaf-nosed bats (Phyllostomidae). Pp. 413-434 in M McDade, ed. Grzimek's Animal Life Encyclopedia, Vol. Volume 13 Mammals II. Farmington Hills, Michigan: Gale Group.
  • Wildscreen. 2011. "Jamaican Fruit-Eating Bat (Artibeus jamaicensis)" (On-line). ARKive Images of Life on Earth. Accessed April 01, 2011 at http://www.arkive.org/jamaican-fruit-eating-bat/artibeus-jamaicensis/.
  • Emmons, L. 1997. Neptropical Rainforest Mammals: A Field Guide. Chicago: Univeristy of Chicago Press.
  • Marques-Aguiar, S. 2007. Genus Artibeus. Pp. 301-321 in A Gardner, ed. Mammals of South America, Volume 1: Marsupials, Xenarthrans, Shrews, and Bats. Chicago: The University of Chicago Press.
  • Miller, B., F. Reid, J. Arroyo-Cabrales, A. Cuaron, P. de Grammont. 2010. "Artibeus jamaicensis" (On-line). The IUCN Red List of Threatened Species. Accessed March 25, 2011 at http://www.iucnredlist.org/apps/redlist/details/2135/0.
  • Ortega, J., I. Castro-Arellano. 2001. Mammal Species: Artibeus jamaicensis. American Society of Mammalogists, 662: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Artibeus jamaicensis weighs between 40 and 60 g, and reaches 70 to 85 mm in length with a wingspan ranging from 48 to 67 mm wide. It has short fur that is either brownish, grayish or black in color. Hair roots are white giving A. jamaicensis a slightly hoary appearance. Ventral pelage is usually lighter than dorsal pelage and no dorsal line is present. The genus Artibeus is characterized by four white facial stripes, one above and below each eye. These stripes are distinct on A. jamaicensis, but fainter than on other related species. This species lacks an external tail, and the naked uropatagium is a characteristic not present in other members of the genus. Like other phyllostomatids, members of this species have a well-developed noseleaf, which is broad, fleshy, and spear-shaped. Artibeus jamaicensis has large canines relative to other members of the genus, which are used for impaling the hard skinned unripe fruit they eat. Artibeus jamaicensis also has a characteristic V-shaped row of bumps on its chin. Six subspecies of A. jamaicensis are recognized.

Range mass: 40 to 60 g.

Range length: 70 to 85 mm.

Range wingspan: 96 to 150 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.359 W.

  • Fleming, T. 2003. A Bat Man in the Tropics : Los Chasing El Duende. Los Angeles, CA: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Jamaican fruit bats roost in a very wide range of structures, including caves, rock overhangs, rock fissures, hollow trees, foliage, and even man-made structures such as buildings. These bats have been observed to eat pollen, nectar, fruit, and insects though they are most commonly associated with large cultivated and wild fruits (Mango, Papaya, but never citrus fruits).
This species normally gives birth twice a year. Pregnant females have been found during February and July, while nursing mothers have been found April-July and as late as September. Births are timed to coincide with the rains/times when most food (flowers or fruit) is available.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Artibeus jamaicensis is primarily found in mature lowland rainforests, but lives in a variety of habitats including seasonal dry forests, deciduous forests, and human plantations. This species uses an array of different roosts including hollowed trees, dense foliage, caves, and sometimes even buildings. Along with several other species of the family Phyllostomidae, A. jamaicensis modifies large leaves to make "tents" as roosts. They have been found in a wide range of elevations from sea level to 2300 m.

Range elevation: sea level to 2300 m.

Average elevation: 500 m.

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: agricultural ; caves

  • Beletsky, L. 1998. Costa Rica The Ecotraveller's Wildlife Guide. San Diego: Academic Press Natural World.
  • Beletsky, L. 1999. Tropical Mexico The Ecotraveller's Wildlife Guide. San Diego: Natural World Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

As its common name suggests, Jamaican fruit-eating bats are frugivores and feed primarily on Ficus figs. They also consume pollen, nectar, flower parts, and insects during the dry season when fruit is less abundant. Other members of Artibeus are known to use fruits such as mangoes, avocados, and bananas. Jamaican fruit-eating bats travel up to 8 km a night to forage. Once they select a fruit, they may fly an additional 25 to 200 meters to find a feeding roost rather than consuming the fruit where it was found. Once at this roost, bats use their robust molars, modified for crushing fruit, to mash up the fruit, which is usually unripe and often hard. They suck out the juices and spit out the leftover pulp with any seeds remaining inside. One research team described the feeding habits of Artibeus as causing "a continuous rain of fruit and bat excrement throughout much of the night and with sunrise came herds of aggressive local pigs to gather the night's fallout of figs." Jamaican fruit-eating bats quickly digests their food. as most of the fruit passes through the digestive system in 15 to 20 minutes. Given the relatively short gut retention time, it is unlikely that digestion is aided by bacteria. It is not uncommon to see multiple individuals feeding at the same Ficus tree.

Animal Foods: insects

Plant Foods: fruit; nectar; pollen; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Artibeus jamaicensis plays an important role in the dispersal of seeds of many tropical fruits. Additionally, it disperses seeds crucial for secondary and successional growth in areas disturbed by natural disasters, which helps restore forests following disturbance and helps maintain plant species richness. It is possible that some species depend on the uneaten remains of discarded fruit. One research team described the foraging habits of Artibeus as  "a continuous rain of fruit and bat excrement throughout much of the night and with sunrise came herds of aggressive local pigs to gather the night's fallout of figs." Because A. jamaicensis sometimes consumes nectar and pollen, it likely helps pollinate many Neotropical plant species. Jamaican fruit-eating bats are host to an array of ectoparasites, including four species of ticks from the families Ixodidae and Argasidae, six species of mites from the families Trombiculidae, Macronyssidae, Gastronyssidae, Spinturnicidae, and Ercynetidae, and four species of batflies from the families Nycteribiidae and Streblidae. Little information is available on endoparasites specific to A. jamaicensis.

Ecosystem Impact: disperses seeds; pollinates

Commensal/Parasitic Species:

  • Morrison, D. 1978. Lunar Phobia in a Neoptropical Fruit Bat, Artibeus jamaicensis (Chiroptera: Phyllostomidae). Animal Behaviour, 26: 852-855.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Jamaican fruit-eating bats are preyed upon by a number of owl species, including barn owls, spectacled owls, mottled owls, and Guatemalan screech owls. Other predators include common opossums, gray four-eyed opossums, boa constrictors, white-nosed coatis, false vampire bats, and Bat Falcons. One week before and after a full moon, Jamaican fruit-eating bats cease feeding activity and return to their day roost while the moon is at its highest peak and cloud cover does not prevent this behavior. When the moon is not full, Jamaican fruit-eating bats forage continuously though the night. Lunar phobia is thought to be an adaption to nocturnal predators that detect prey visually. Because they roost in dark habitats and are nocturnal, their dark coloration helps camouflage them from potential predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Artibeus jamaicensis is prey of:
Epicrates inornatus
Diptera
Secernentia nematodes
Streblidae
Labidocarpidae
Spinturicidae
Spelaeorhynchidae

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Artibeus jamaicensis preys on:
fruit

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Jamaican fruit-eating bats use echolocation as their primary means of orientation. Olfaction and sight are also used to detect food. Although many microchiropterans emit sound pulses orally, Artibeus jamaicensis emits sound pulses through its noseleaf while its mouth is closed. One researcher described the noseleaf of Jamaican fruit-eating bats as "an acoustic lens that focuses the outgoing sound into a narrow beam." Jamaican fruit-eating bats are often called "whisper bats" because they emit very low intensity sounds. These sounds provide short range information on the location of food in densely vegetated areas. Pups use rapidly repeated long and short notes (i.e., "double notes") to assist in reuniting with their mothers in densely populated caves. Jamaican Fruit-Eating bats produce warning calls when captured in mist nets, which attract conspecifics as well as additional species. Jamaican fruit-eating bats respond to other species' alarm calls as well. Distress calls also warn conspecifics of approaching predators.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; ultrasound ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of Jamaican fruit-eating bats. One individual in the wild was recaptured 7 years after it had been tagged. Some sources report a lifespan of up to 9 years in the wild. Captive individuals can live to be more than 10 years old.

Range lifespan

Status: wild:
7 to 9 years.

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.2 years (captivity) Observations: One 19.2 year old specimen was still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Artibeus jamaicensis is polygynous, and individuals males defend harems of 4 to 18 females and their young. Males of this species are known to form stable, sized-based hierarchies. Larger, heavier males successfully defend larger harems, and dominant males remain with their harems for multiple years. However, females frequently move among harems, and solitary females are sometimes incorporated into existing harems. Reproduction is not limited to dominant males as bachelor males occasionally copulate with solitary females. During breeding season, dominant males living in caves or tree hollows attack neighboring “bachelor” male roosts. At night, dominant males defend their roost from rival males.

Mating System: polygynous

The reproductive cycle of Artibeus jamaicensis alternates between periods of normal and delayed development and is best described as seasonal polyestry. In late March or early April, females give birth to a single pup. Immediately following parturition, females enter postpartum estrous and may be pregnant and lactating at the same time. Following a gestation period of no more that 4 months, females give birth to another pup around late July or early August. Again, parturition is followed by a postpartum estrous; however, the resulting blastocyst implants in the uterus and becomes dormant for 2.5 months. In mid-November the blastocyst resumes development, and the pregnant females give birth to a single young in late March or early April. On rare occasions, females give birth to twins. Research suggests that this pattern of delayed development synchronizes the birth of young with the end of the dry season, which allows weaning to occur when large fruits are at peak availability. Acyclic reproductive patterns are seen in some populations in Central Mexico and Columbia. Reproductive cycles are likely moderated by food abundance and the timing of wet and dry seasons. Artibeus jamaicensis can fly by 31 to 51 days after birth and reaches adult size around 80 days old.

Breeding interval: Jamaican fruit-eating bats breed twice every year.

Breeding season: Copulation occurs 2 to 25 days after the birth of young in March/April and July/August

Average number of offspring: 1.

Range gestation period: 4 to 7 months.

Range birth mass: 5.9 to 15.5 g.

Range age at sexual or reproductive maturity (female): 8 to 12 months.

Range age at sexual or reproductive maturity (male): 8 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; embryonic diapause ; post-partum estrous

Average number of offspring: 1.

Little is know about parental care in Artibeus jamaicensis. Like all mammals, mothers provision and protect young while carrying them in the womb and continues until weaning. Prior to learning how to fly, pups are carried by their mothers while they forage for food.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 2001. Bats. D Macdonald, ed. The New Encyclopedia of Mammals. Oxford: Oxford University Press.
  • Wildscreen. 2011. "Jamaican Fruit-Eating Bat (Artibeus jamaicensis)" (On-line). ARKive Images of Life on Earth. Accessed April 01, 2011 at http://www.arkive.org/jamaican-fruit-eating-bat/artibeus-jamaicensis/.
  • Emmons, L. 1997. Neptropical Rainforest Mammals: A Field Guide. Chicago: Univeristy of Chicago Press.
  • Fleming, T. 2003. A Bat Man in the Tropics : Los Chasing El Duende. Los Angeles, CA: University of California Press.
  • Fleming, T. 1971. Artibeus jamaicensis: Delayed Embryonic Development in a Neotropical Bat. Science, Vol. 171, No. 3969: 402-404.
  • Kunz, T., P. August, C. Burnett. 1983. Harem Social Organization in Cave Roosting Artibeus jamaicensis (Chiroptera: Phyllostomidae). Biotropica, 15(2): 133-138.
  • Marques-Aguiar, S. 2007. Genus Artibeus. Pp. 301-321 in A Gardner, ed. Mammals of South America, Volume 1: Marsupials, Xenarthrans, Shrews, and Bats. Chicago: The University of Chicago Press.
  • Merritt, J. 2010. The Biology of Small Mammals. Baltimore: John Hopkins University Press.
  • Ortega, J., H. Arita. 1999. Structure and social dynamics of harem groups in Artibeus Jamaicensis (Chiroptera: Phyllostomidae). Journal of Mammalogy, 80 (4): 1173-1185.
  • Ortega, J., I. Castro-Arellano. 2001. Mammal Species: Artibeus jamaicensis. American Society of Mammalogists, 662: 1-9.
  • Vaughn, T., J. Ryan, N. Czaplewski. 2011. Mammalogy 5th. Edition. Sudbury, Massachusetts: Jones & Bartlett Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Artibeus jamaicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 96 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0541-06|NC_002009|Artibeus jamaicensis| TCCCGTTGATTTTTCTCAACAAATCACAAAGATATTGGTACTCTATACCTATTATTTGGTGCTTGAGCAGGTATAGTAGGCACTGCACTA---AGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGAGCCCTATTAGGTGAT---GATCAAATCTATAATGTAATCGTAACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGGTTCGGCAATTGACTAGTACCACTAATA---ATTGGCGCACCCGATATAGCATTCCCACGAATAAATAATATAAGCTTCTGGCTTCTCCCCCCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTCGGAACAGGTTGAACCGTATACCCACCACTAGCCGGAAATCTAGCACATGCCGGAGCTTCAGTTGACCTG---GCTATTTTCTCTCTTCACCTAGCCGGAGTATCATCAATCCTCGGACGTATTAATTTTATCGCTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCTTTATTTGTTTGATCTGTTTTAATTACTGCTGTCCTACTACTCCTCTCCCTTCCTGTCTTAGCAGCA---GGTATTACCATACTCCTAACAGACCGAAATCTTAATACCACATTCTTTGACCCAGCTGGAGGGGGAGACCCCATTTTATATCAGCACTTATTCTGGTTCTTCGGCCACCCCGAAGTATATATTCTTATTTTACCAGGCTTTGGCATCATCTCCCATGTAGTAACCTACTATTCCGGTAAAAAA---GAACCTTTCGGATATATAGGAATAGTTTGAGCTATAATATCCATTGGATTCCTAGGCTTTATTGTATGAGCCCACCATATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Artibeus jamaicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 93
Species: 257
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Artibeus jamaicensis is as "least concern" on the IUCN Red List of Threatened Species and has no special status according to the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
These bats are widely distributed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is found in Protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Artibeus jamaicensis is known to occasionally forage on cultivated fruit crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The seeds of market fruits sold by humans are dispersed by Artibeus jamicensis. This species is also helps pollinate some economically-important crop plants. Although insects make up only a minor part of their diet, A. jamicensis may help control certain insect pest species.

Positive Impacts: pollinates crops

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Jamaican fruit bat

The Jamaican, Common or Mexican fruit bat (Artibeus jamaicensis) is a fruit bat native to Central and South America, as well as the Greater and many of the Lesser Antilles. It is also an uncommon resident of the Southern Bahamas. Its distinctive features include the absence of an external tail and a minimal, U-shaped interfemoral membrane.

Contents

Description

Closeup of head of Jamaican fruit bat

The Jamaican fruit bat is a medium-sized bat, having a total length of 78-89 mm with a 96-150 mm wingspan and weighing 40 to 60 g. It has broad but pointed and ridged ears with a serrated tragus.[1] Its prominent noseleaf has an array sebaceous glands.[2] The lower lip is littered with warts with a relatively large one in the center. Sebaceous holocrine glands can be found in both lips.[2] On the back the fur is an ashy-shade of gray or brown with visible white hair bases.[3] The wings of the fruit bat are broad and dark gray in color.[1] The underfur is paler in color. The fruit bat has no external tail. It has broad dark grey wings and a narrow hairless interfemoral membrane with a short calcar.[1]

Ecology

The Jamaican fruit bat ranges from southern Mexico southward toto northwestern Argentina. It also lives on the islands of Trinidad, Tobago, Greater and Lesser Antilles and the Florida Keys.[4] It can be found in elevations from sea level to 2,135m.[5] This species is found in a variety of habitats. It prefers that are humid and tropical but has also adpated to cloud forests and drier tropical habitats.[5] Fruit bats roost in caves, hollow trees, dense foliage, buildings and leaf tents.[6] The fruit bat may create its own "tent" to roost in by altering broad leaves.[6] These "tents" are only temporarily used.

The Jamaican fruit bat is a frugivore. They eat an number of kinds of fruit but focus mostly on figs; at Barro Colorado Island, Panama, figs make up more than 78% of the fruits eaten.[1] Bats will also supplement leaves of plants with high amounts of protein.[7] Overall, the fruit bat consumes a diverse amount of plants but locally only eats certain types.[1] A Jamaican fruit-eating carries plucks it food and carries it away with its mouth before eating it in its roosts. As such it can disperse seeds fairly far.[8] Fruit bats have been recorded carrying fruits weighing of 3-14 g or even as much as 50 g. Jamaican fruit bats relys on sight and smell to find fruit of certain colors and odors.[1]

The maximum longevity for the Jamaican fruit bat is nine years in the wild. Predators of fruits bats include owls, snakes, large oppossums, and coati. Bats from various sites have been found with Histoplasma capsulatum. Some individual bats may have rabies.[9] Fruit also are susceptible to various internal parasites: nematodes and ringworms and external parasites: mites, ticks and chiggers.[1]

Behavior and life history

Jamaican fruit bats in an abandoned termite nest in the Amazon rainforest, near Nauta, Peru
Jamaican fruit bats in an abandoned termite nest in the Amazon Rainforest near Nauta, Peru

When in their roosts, the Jamaican fruit bat has a reproductive system known as "resource defensive polygyny".[10] That is, males will claim an area as a territory and females select the best territories to roost and mate in.[11] Subadult males may remain in their natal roosts while females may leave to gather with other females elsewhere.[12] In caves where there are enough roosting sites, some "female defensive polygyny".[13] Here, harem males actively defend females during the breeding seasons and will attack satellite males that roost in the walls and ceilings of caves.[14] However, they tolerate males who are subordinate to them in their harems. Satellite males are more common in large group than smaller groups and dominant and subordinates males will cooperative to defend harem females.[14] In large groups, dominant males may be the fathers of the subordinates.[15]

When bats going on foraging trips, it is the dominant males that are the first to leave to the roosting sites and the last to return.[16] At dusk, males spend much time flying near the tree roosts displacing any intruders.[17] Jamaican fruit bats are most active at midnight, following that, activity begins to die down.[18]

When captured, a Jamaican fruit bat will warn conspecifics with distress call made of a long series of pulses typically lasting 15 kHz.[19] The Jamacian fruit bat will also retacts to the distress calls of other species and to their own recorded calls.[19] The fruit bat is considered a whisper bat and makes 3 low-intensity FM pulses during flight and when resting.[1]

Breeding in the Jamaican fruit bat that is bimodal and polyestrous with births being dependant on fruit abundance. Females give birth twice a year with one young on average for each birth. Mating is highest at the end of the wet season and births take place in the dry months.[1] Embryonic development may delay in the second breeding season but parturition will occur in the follow breeding period.[20] The testes of the males enlarge when females enter estrous.[21] The testes tend to be slightly larger in harem males than bachelors and the canine teeth tend to be more worn in the former.[22] Copulations occurs until 2–25 days after the previous births. Pups born in a harem may sometimes be sired by satellite or subordinate males depending on the size of the group.[15] Gestation is usually 3.5-4 months but can be as long as 7 months when there's delayed embryonic development. The females gives births while perching and the newborn emergesm unaided, head first.[1] The mothers will eat the placenta. Mothers carry their pups when they are one day old but later leave in the roosting area for the day.[1] The female’s nipples become enlarged during lactation. Young are weaned by 15 days.[1] Young gain a full, permanent set of teeth at 40 days and can fly by 50 days when their forearms are fully developed. Female are sexually mature by eight months and males by 12 months.[1]

Status

Throughout its most of its range, the Jamaican fruit bat is numerous. It was found to be the most influential of the frugivorous bat community.[23] The fruit bat has greater ecological importance in wet habitats.[1] The Jamaican fruit eating bat does not seem to be threatened from a conservation standpoint.[24] It appears to common regardless of any habitat disruption.[25] However, it may be damage fruit crops in certain areas.[26]

References

  1. ^ a b c d e f g h i j k l m n Ortega, J., I. Castro-Arellano. 2001. Artibeus jamaicensis. Mammal Species 662: 1-9.
  2. ^ a b W W Dalquest, H J Werner, J H Roberts, 1952. The facial glands of a fruit-eating bat, Artibeus jamaicensis (Leach) Journal of Mammalogy 33(1):102-103.
  3. ^ Davis W.B. 1970. The large fruit bats (genus Artibeus) of middle America, with a review of the Artibeus jamaicensis complex, Journal of Mammalogy 51:105-122.
  4. ^ Redford K. H., J. F. Eisenberg. 1992. Mammals of the Neotropics: The southern cone, University of Chicago Press, 2:1-430.
  5. ^ a b Eisenberg. 1989. Mammals of the Neotropics: The northern Neotropics, University of Chicago 1:1-449.
  6. ^ a b Timm R. M. 1987. Tent construction by bat of the genera Artibeus and Uroderma. Pp 187-212 in Studies in Neotropical mammalogy, essays in honor of Phillip Hershkovitz (B. D. Patterson and R. M. Timm, eds.) Fieldiana Zoology, New Series 39:1-506.
  7. ^ TH Kunz, CA. Dias (1995) Folivory in Fruit-Eating Bats, with New Evidence from Artibeus jamaicensis (Chiroptera: Phyllostomidae), Biotropica 27(1):106-120.
  8. ^ Fleming T. H., E. R. Heithaus. 1981. Frugivorous bats, seed shadows, and the structure of tropical forest, Reproductive Botany 13:45-53.
  9. ^ Constantine D. G. 1988. Health precautions for bat reseachers. Pp. 491-528 in Ecological and behavioral methods for the study of bats (T. H. Kunz ed) Smithsonian Institution Press.
  10. ^ Morrison D. W. 1979. Apparent male defense of tree hollows in the fruit bat Artibeus jamaicensis, Journal of Mammalogy 60:11-15.
  11. ^ Morrison D. W. 1980. Foraging and day-roosting dynamics of canopy fruit bats in Panama, Journal of Mammalogy 61:20-29.
  12. ^ Morrison D. W., C. O. Handley Jr. 1991. Roosting behavior. Pp. 131-136 in Demography and natural history of the common fruit bat Artibeus jamaicensis on Barro Colorado Island, Panama (C. O. Handley Jr, D. E. Wilson and A. L. Gardner, eds.) Smithsonian Institution Press.
  13. ^ Ortega J., Artia. 1999. Structure and social dynamics of harem groups of Artibeus jamaicensis (Chiroptera: Phyllostomidae). Journal of Mammalogy 80:1173-1185.
  14. ^ a b Oretega J., Artia, 2000. Defensive behavior of females by dominant males of Artibeus jamaicensis (Chiroptera: Phyllostomidae). Ethology 106:395-407.
  15. ^ a b Jorge Ortega1, Jesús E. Maldonado, Gerald S. Wilkinson, Héctor Arita, Robert C. Fleischer, (2003) Male dominance, paternity, and relatedness in the Jamaican fruit-eating bat (Artibeus jamaicensis), Molecular Ecology 12(9):2409-2415.
  16. ^ Morrison D. W., S. H. Morrison. 1981. Economics of harem maintenance by a Neotropical bat, Ecology 62:864-866.
  17. ^ Flight speeds of tropical forest bats, The American Midland Naturalist 104:189-192.
  18. ^ Fenton M. B., T. H. Kunz. 1977. Movements and behavior Pp. 351-364 in Biology of the bats of the New World family Phyllostomatidae. Part II (R. J. Baker, J. K. Jones, D. C. Carter, eds). Special Publications, The Museum, Texas Tech University Press 13:1-364.
  19. ^ a b August P. V. 1985. Acoustical properties of the distress calls of Artibeus jamaicensis and Phyllostomus hastatus (Chiroptera:Phyllostomidae). The Southwestern Naturalist 30:371-375.
  20. ^ Fleming T. H. 1971. Artibeus jamaicensis: delayed embryonic development in a neotropical bat, Science 171:401-404.
  21. ^ Fleming T. H., E. T. Hooper, D. E. Wilson. 1972. Three Central American bat communities: structure, reproduction eycles and movement pattern, Ecology 53:555-569.
  22. ^ Kunz T. H., P. V. August, C. D. Burnett. 1983. Harem social organization in cave roosting Artibeus jamaicensis, Biotropica 15:133-138.
  23. ^ Cardner A. L., C. O. Handley Jr., D. E. Wilson. 1991. Survival and relative abundance. Pp. 53-76 in Demography and natural history of the common fruit bat Artibeus jamaicensis on Barro Colorado Island, Panama (Handley Jr., D. E. Wilson, ed). Smithsonian Institution Press.
  24. ^ Artia H. T, G. Ceballos. 1997. The mammals of Mexico: distribution and conservation status, Revista Mexicana de Mastozoologia 2:33-71.
  25. ^ Fenton M. B. 1992. Phyllostomid bats (Chiroptera:Phyllostomidae) as indicators of habitat disruption in the Neotropics, Biotropica 24:440-446.
  26. ^ Goodwin R. E. 1970. The ecology of the Jamaican bats, Journal of Mammalogy 51:571-579.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!