Overview

Brief Summary

Biology

The elusive aardvark is primarily a nocturnal animal (1), spending the day curled up in its burrow asleep (5). However, it can occasionally be spotted venturing outside in the daylight on a cold afternoon (1), or early in the morning when it may sun itself by the burrow's entrance (5). At night the aardvark leaves the safety of its burrow and begins its search for food (5). It feeds almost exclusively on a smorgasbord of ant and termite species (3), and will forage for its meal by travelling in a zigzag path, inspecting a strip of ground about 30 metres wide with its snout (5). The aardvark tends to walk on its claws, somewhat slowly and awkwardly, and on soft ground its dragging tail leaves a trail behind (5). Once the aardvark has located its food, either after digging into the ground, tearing into a termite nest, or finding an army of ants on the march (5), the aardvark gathers its prey with its long, sticky tongue, which can extend to a remarkable 30 centimetres (5). It does not chew its insect prey, of which it can eat over 50,000 each night, but instead swallows it whole and grinds it up in a muscular area of its lower stomach (3). Digging is a central feature of the aardvark's life, and an activity that it is incredibly adept at. Not only does it dig shallow holes in search of food, it also digs burrows, measuring up to three metres long (5), for daytime rest and to escape predators (1), and also excavates extensive tunnel systems in which it gives birth to its young. These may be up to 13 metres long, with numerous chambers and multiple entrances (5). Its powerful limbs and sharp, spoon-shaped claws make easy work of digging (3), even in hard, stone-baked ground, and it can dig a hole faster than several men with shovels (5). The burrows of the aardvark are used by numerous other African animals, from invertebrates to mammals, making the aardvark an important species in the ecosystems in which it is found (1). The aardvark is a largely solitary animal and is only occasionally seen in the company of other individuals (1), presumably for mating and when a young accompanies its mother (5). The gestation period in this species lasts for between seven and nine months, resulting in the birth of a single, naked, flesh-coloured young. The young aardvark will remain in the burrow for about two weeks before starting to accompany its mother on night time foraging trips. By the age of six months, the young can dig for itself, and by 12 months it has reached the size of an adult. Sexual maturity is obtained at about two years of age (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

While this bizarre and elusive mammal may look similar in appearance to a pig, (aardvark literally means 'earthpig' in Afrikaans (3)), it is actually the only member of the order Tubulidentata (2). The aardvark has a stocky, arched body sparsely covered with bristly hair, a short neck, a long and muscular tail and long, pointed ears (2). Like a pig, the aardvark also has a flexible, tubular snout, although much longer than its namesake's, and a long, extensible tongue, which together are perfectly suited to searching out and consuming a diet of ants and termites (3) (4). The thick skin of the aardvark ranges in colour from pale yellowish-grey to pinkish (4) (5), although this is often stained darker grey or reddish-brown from the soil in which it burrows (4). Its short, powerful limbs bear large, sharp, shovel-shaped claws, four on the forefeet, five on each hindfoot, which enable the aardvark to dig with ease (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

The Aardvark is widely distributed south of the Sahara from Senegal to Ethiopia to South Africa, being absent from the Sahara and Namib Deserts. It is also present in the Congo Basin, although its distribution in West African rainforests is poorly known (Taylor in press). The distribution of the Aardvark is largely determined by the distribution of suitable ant and termite species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aardvarks are found throughout sub-Saharan Africa, except for the West and Central rain forest regions.

Biogeographic Regions: ethiopian (Native )

  • Oxford University Press. 2009. "Oxford Reference Online" (On-line). A Dictionary of Zoology. Accessed March 26, 2010 at .
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Princeton and Oxford: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The aardvark is widely distributed in Africa south of the Sahara, from Senegal, east to Ethiopia and south to South Africa (1), although it is absent from the Namib Desert (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Aardvarks are the size of small pigs, but have very thick skin and do not possess a fat layer. They are notable for their long nose, which is wider at the distal end, their squared-off head, and a tail that tapers off toward the tip. The body is massive and they have very muscular limbs ending in thick-nailed digits. The hair is short on the head, neck, and tail, but longer and darker on the rest of the body, especially the limbs. Hair is often worn off in adults, but apparent on the young. The sides of the face and tail are pale colored, lighter in females and darker in males. During the wet season, aardvarks have fat deposits that are likely fueled by termite consumption.

Aardvarks have 4 toes on the forefeet and 5 toes on the hind feet, each ending in a spade-like claw that helps them to dig with great speed and force. Digging is used both to acquire food and as a means of escape. The stance is digitigrade.

Aardvarks have peg-like molars and premolars, but no incisors or canines; the dental formula is 0/0 0/0 2/2 3/3. Their teeth lack enamel and are made up of densely packed tubules, composed of a modified form of dentine. The tubules are contained in a sleeve of dental cement. Embryos and infants have a full set of vestigial milk teeth, including canines.

Range mass: 40 to 82 kg.

Range length: 100 to 158 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Average basal metabolic rate: 34.275 W.

  • Knöthig, J. 2005. "Biology of the Aardvark" (On-line). Accessed March 18, 2010 at http://www.tierseiten.com/roehrenzaehner/aardvark.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Aardvark occur in a broad range of habitats, including the semi-arid Karoo areas of southern Africa, grasslands, all savanna types, rainforests (but not swamp forests; F. Maisels pers. comm.), woodlands and thickets (Shoshani et al. 1988; Taylor in press). They are absent from hyper-arid habitats and avoid very rocky terrain that is difficult to dig in; for example, they occur in the eastern Namib Desert. Aardvarks have been recorded at 3,200 m asl in the highlands of Ethiopia (Yalden et al. 1996). They feed almost exclusively on ants and termites but sometimes eat other insects, such as pupae of scarabaeid beetles (Taylor et al. 2002). They can obtain all their water requirements from their food. Aardvarks are anatomically adapted to dig, and they extract all their food from underground. They also dig burrows in which they rest during the day and which they use to escape predators (Taylor and Skinner 2003). Because many animals, from invertebrates to other mammals, use these burrows the Aardvark is often considered a keystone species (Cilliers 2002). Aardvarks are generally nocturnal, although they may come out in the afternoon in cold weather. They are solitary, only coming together occasionally for very short periods. Very little is known about reproduction in the wild.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Aardvarks occupy grassland and savanna habitats in sub-Saharan Africa, preferring areas that have a large abundance of ants and termites year round. The location of their burrow may differ from where they forage, in which case they walk between the two sites at night. They are rarely found in areas that have hard, compact soil, rocky areas, or areas that frequently flood. They often live in temporary holes that are a few meters in length, but can also live in complex and intricate burrows, which can have eight or more entrances and extend as much as 6 meters underground. Burrow entrances are often plugged with a vent left at the top.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

  • Lehmann, T. 2009. Phylogeny and systematics of Orycteropodidae (Mammalia, Tubulidentata). Zoological Journal of the Linnean Society, 155: 649-702.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Within its large range, the aardvark occurs in a great variety of habitats, including grasslands, rainforests, savanna and woodland, with its presence largely dictated by the distribution of suitable ant and termite species (1). It shows a preference for areas of sandy soil (5), and will avoid rocky ground that is hard to dig in and habitats that are extremely dry (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Aardvarks eat at night and are myrmecophagous, i.e. they specialize on ants and termites, with the majority of their diet being ants. They dig rapidly into the sides or center of ant and termite nests or mounds, while feeding at the same time. The ants and termites are swept into their small mouth with their long, sticky tongue. Aardvarks swallow without chewing their food, or after chewing their food very little. The insects are digested in the pyloric region of the muscular, gizzard-like stomach. Some of the predator defenses that ants and termites use against myrmecophagous animals, such as pangolins, anteaters, and echidnas, include biting, stinging, chemical defenses, and building hard mounds. These defenses do not seem to affect aardvarks. Colonies of ants and termites are rarely destroyed after an aardvark feeds and can be built back up and reestablished.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Aardvarks are important in their ecosystem because the holes they dig are used by a variety of other animals for shelter. These include hyenas, warthogs, squirrels, hedgehogs, mongooses, and bats, as well as birds and reptiles.

Ecosystem Impact: creates habitat; soil aeration

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

If confronted by a predator, an aardvark will attempt to dig a hole in which to hide, taking about 10 minutes to completely cover itself up. If it cannot dig a hole, it will stand upright on its hind legs and tail, or lay on its back, and defend itself with its large front claws. Humans are the primary predator of aardvarks, but lions, hyenas, and leopards are also known to kill them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The only known sounds made by aardvarks are grunts and, in cases of extreme fear, bleats. Both sexes have glands on their elbows and hips, which may aid in mating or spacing of individuals. However, scent marking has not been observed.

Aardvarks have poor vision because their retinas contain only rods, which allow them to see at night, but leave them colorblind. They have a very acute sense of hearing and long ears that can be moved independently, as well as folded back and closed while tunneling.  Aardvarks have an exceptional sense of smell due to structures in the nose that increase turbinal surface area, improving the detection of olfactory signals. The olfactory region of the brain is highly developed in aardvarks, giving the middle profile of the skull a swollen appearance.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Aardvarks live for up to 18 years in the wild. In captivity, aardvarks are expected to live for about 23 years.

Average lifespan

Status: wild:
18 years.

Average lifespan

Status: captivity:
23 years.

Average lifespan

Sex: male

Status: captivity:
24.0 years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: captivity:
23.0 years.

Average lifespan

Status: wild:
23.0 years.

Average lifespan

Sex: female

Status: captivity:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.8 years (captivity) Observations: One captive specimen lived for 29.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Aardvarks are solitary and territorial, coming together only to breed. They are believed to be polygynous.

Mating System: polygynous

Male aardvarks have genitals that secrete a powerful musk and both males and females have glands on their elbows and hips. These glands might help with individual spacing and/or be involved in mating, but obvious scent marking has not been reported. Northern African aardvarks give birth between October and November, while aardvarks in South Africa give birth between May and July.

Usually one young is born after a gestation period of about 7 months. Offspring are born naked and with eyes open. The young begin to follow their mother at 2 weeks. They nurse until 3 months, at which time they begin to eat insects. At about 6 months, they become independent of the mother, and at about 2 years, they become sexually active. Aardvarks live to be about 18 years of age.

Breeding interval: Aardvarks breed once yearly

Breeding season: It is believed that aardvarks breed earlier in the year the closer they are to they equator.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 7 months.

Average birth mass: 2 kg.

Average weaning age: 3 months.

Average time to independence: 6 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 1800 g.

Average gestation period: 225 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Female aardvarks give birth in their burrow and the young remain underground for several weeks, while maturing. Offspring are taken care of by the mother until they are independent at about 6 months, after which they dig their own burrows.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Princeton and Oxford: Princeton University Press.
  • Knöthig, J. 2005. "Biology of the Aardvark" (On-line). Accessed March 18, 2010 at http://www.tierseiten.com/roehrenzaehner/aardvark.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Limbs dig efficiently: echigo mole
 

Echigo moles and other digging animals break the soil surface and move as much earth as possible per stroke with short, powerful limbs and sharp claws.

   
  "Quite different in character are the feet of the diggers, animals that habitually burrow into the earth. The friction drag of moving through the ground is potentially enormous, so the size of the limbs and the area through which they move must be kept to an absolute minimum; but at the same time, great strength is needed. The limbs of animals that lead an almost completely subterranean life, like the mole, are short and thick, and their feet are broad and powerful. Each short stroke of a foot must move as much earth as possible, and the mole's feet are spade-like with widely spaced digits. In addition, the claws of digging animals are usually large, sharp and strong, to do the work of a pickaxe in breaking the soil surface. The aardvark of South Africa (its Afrikaans name, 'earth-pig', refers to its rather pig-like head) is a curious animal that digs for food in termite's nests. Its feet are short and massive with large, almost hoof-like claws on each toe. It is said that one aardvark can dig a hole faster than six men with shovels. Not only does it dig into termite nests to eat the insects, the aardvark digs burrows 4m or more in length in which to hide during the day.

The armadillos of Central and South America are also powerful diggers, able to conceal themselves at amazing speed; they too have short, strong legs with daunting claws. The feet of the giant anteater, another excavator of ant and termite nests, are not massive as those of the aardvark. They are long and curved -- so much so that the anteater is forced to walk on the sides of its feet with an ungainly bow-legged gait. The anteater is a scratch-digger, not a maker of burrows, so its claws do not need to be as large." (Foy and Oxford Scientific Films 1982:179-180)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orycteropus afer

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0717-06|Y18475|Orycteropus afer| AACCGATGATTATATTCAACCAACCATAAAGATATTGGAACACTATACCTTCTATTCGGTGCTTGAGCCGGAATAGTGGGAACAGCCCTA---AGCTTATTAATCCGAGCTGAACTAGGTCAGCCTGGTGCTCTACTAGGAGAC---GACCAAATCTATAACGTTGTTGTAACAGCTCATGCATTCGTAATAATTTTCTTTATAGTGATGCCTATTATAATTGGAGGTTTTGGAAACTGATTAGTACCCCTAATA---ATTGGAGCACCTGACATAGCATTCCCTCGAATAAACAATATAAGCTTCTGACTATTGCCCCCTTCATTCCTCCTATTATTAGCCTCATCTATAGTAGAAGCTGGTGCAGGGACAGGCTGAACAGTCTACCCGCCCTTAGCAGGAAATCTCGCCCATGCAGGTGCCTCAGTAGACTTA---ACAATCTTTTCCCTTCATCTAGCAGGTGTGTCATCCATCCTAGGAGCAATCAATTTCATTACCACTATTATCAATATAAAACCACCAGCCTTATCACAGTATCAAACACCATTATTTGTATGATCCGTATTAATCACCGCCGTCCTATTACTCTTGTCTTTACCAGTTTTAGCCGCA---GGAATTACTATGCTACTGACTGATCGGAACCTAAATACAACTTTTTTCGATCCTGCTGGAGGAGGAGACCCAATTCTCTATCAACACCTATTCTGATTCTTTGGACACCCAGAAGTGTACATCCTTATTCTTCCAGGTTTTGGAATAATCTCCCATATTGTAACTTACTACTCTGGAAAAAAA---GAACCTTTTGGCTATATAGGAATAGTTTGAGCTATAATATCTATTGGATTTTTAGGCTTTATTGTCTGAGCCCATCACATATTCACCGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orycteropus afer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lindsey, P., Cilliers, S., Griffin, M., Taylor, A., Lehmann, T. & Rathbun, G. (IUCN SSC Afrotheria Specialist Group)

Reviewer/s
Rathbun, G. (Afrotheria Red List Authority) and Hoffmann, M. (Global Mammal Assessment)

Justification
Although Aardvarks are not commonly seen, they are often relatively common in suitable habitats. They are sometimes considered rare because of their elusive behavior and not a result of low numbers. Although their numbers undoubtedly are reduced in areas where their habitat is altered by human activities, given their widespread, nearly pan-African distribution south of the Sahara there are few concerns in regard to the species' overall conservation status. The species is listed as Least Concern.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 2003
    Least Concern
    (IUCN 2003)
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Aardvarks are widespread, however, they have been exterminated in many agricultural areas. They are vulnerable in all settled areas and endangered or extinct in areas with a high concentration of people. They are often hunted by farmers and ranchers who find their hole digging inconvenient or dangerous. Cultivation and pesticide use has resulted in the elimination of their food source in some areas.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Current population trends are not known. In southern Africa there is no reason to believe that they are decreasing or increasing significantly due to any factors other than natural variations due to the variable nature of the arid habitats they occupy. However, in eastern, central, and western Africa, numbers may be declining as a result of the expansion of human populations, the destruction of habitat, and hunting for meat. Densities vary according to habitat suitability, including the abundance of prey.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no known major threats to the species. Localized threats include habitat loss due to agriculture and subsistence hunting. Hatt (1934) recorded indigenous hunters in the Congo killing Aardvarks trapped in burrows, and Mbuti pygmies in the Ituri Forest in DR Congo smoke them out of their burrows (Carpaneto and Germi 1989). The meat is prized, while other parts of the Aardvark, such as the skin, claws and teeth, are used to make bracelets, charms and curios, and for some medicinal purposes (Carpaneto and Germi 1989). In western Kenya (1960s), local hunters flooded burrows to kill animals for food (G. Rathbun pers. comm.)..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although overall, due to its widespread distribution, the global population of the aardvark is not considered to be threatened, in some areas numbers have been reduced as a result of human activities (1). Certain populations in eastern, central and western Africa are thought to be declining, as a growing human population destroys suitable habitat and hunts the aardvark for its meat. The skin, claws and teeth are also used to make bracelets, charms and curios (1), and even the aardvark's bristly hair is reportedly sometimes reduced to a powder and regarded as a potent poison when added to the local beer (3). Aardvark habitat is most often lost to agriculture (1), with intensive crop farming resulting in a decline in aardvark numbers (3). However, not all agriculture has a negative impact on the aardvark; cattle herding may actually benefit this species, as cattle-trampled ground creates the right conditions for termites (3). Conflict may also arise when agriculture encroaches onto aardvark habitat, as burrows can damage farming equipment, roads, dam walls, and fences, and the aardvark may be persecuted by farmers as a result (5) (6). Ironically, in areas where the aardvark and other insect-eating animals have been exterminated, pasture and cereal crops have suffered massive damage from termites (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no major conservation problems facing this taxon, and they are present in a number of large and well-managed protected areas across their range. Therefore, no targeted conservation measures are needed or recommended at present or in the foreseeable future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Throughout its vast range, the aardvark occurs in a number of protected areas (1). Aside from this, the aardvark is not believed to be in any need of conservation action (1). The aardvark plays such a vital role in many ecosystems, creating burrows for other animals and even limiting the enormous damage that termites can inflict on our crops (5), that hopefully the aardvark will remain unthreatened for the foreseeable future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Aardvark burrows can present a hazard for vehicles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sometimes humans hunt aardvarks for their meat and hide, although products made out of aardvarks are subject to trade restrictions. Aardvarks may help control termite and ant populations, which are pests to humans.

Positive Impacts: food ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aardvark

The Aardvark (Orycteropus afer) (afer: from Africa) is a medium-sized, burrowing, nocturnal mammal native to Africa.[2] It is the only living species of the order Tubulidentata,[3] although other prehistoric species and genera of Tubulidentata are known.

It is sometimes called "antbear", "anteater", or the "Cape anteater" after the Cape of Good Hope. The name comes from the Afrikaans/Dutch[4] for "earth pig" or "ground pig" (aarde earth/ground, varken pig), because of its burrowing habits (similar origin to the name groundhog). The aardvark is not related to the pig; rather, it is the sole recent representative of the obscure mammalian order Tubulidentata, in which it is usually considered to form one variable species of the genus Orycteropus, the sole surviving genus in the family Orycteropodidae. The aardvark is not closely related to the South American anteater, despite sharing some characteristics and a superficial resemblance.[5] The closest living relatives of the aardvark are the elephant shrews, along with the sirenians, hyraxes, tenrecs, and elephants. Together with their extinct relatives, these animals form the superorder Afrotheria.

Contents

Description

One of the most distinctive characteristics of the Tubulidentata is their teeth. Instead of having a pulp cavity, each tooth has a cluster of thin, upright, parallel tubes of vasodentin (a modified form of dentine), with individual pulp canals, held together by cementum. The teeth have no enamel coating and are worn away and regrow continuously. The aardvark is born with conventional incisors and canines at the front of the jaw, which fall out and are not replaced. Adult aardvarks only have cheek teeth at the back of the jaw, and have a dental formula of: Upper: 0.0.2-3.3, lower: 0.0.2.3

An Aardvark Skull From the Collections of Skulls Unlimited International.

Genetically speaking, the aardvark is a living fossil, as its chromosomes are highly conserved, reflecting much of the early eutherian arrangement before the divergence of the major modern taxa.[6]

The aardvark is vaguely pig-like in appearance. Its body is stout with an arched back and is sparsely covered with coarse hairs. The limbs are of moderate length. The front feet have lost the pollex (or 'thumb') — resulting in four toes — but the rear feet have all five toes. Each toe bears a large, robust nail which is somewhat flattened and shovel-like, and appears to be intermediate between a claw and a hoof. The ears are disproportionately long, and the tail is very thick at the base and gradually tapers. The greatly elongated head is set on a short, thick neck, and the end of the snout bears a disc, which houses the nostrils. The mouth is small and tubular, typical of species that feed on termites. The aardvark has a long, thin, snakelike, protruding tongue and elaborate structures supporting a keen sense of smell.

An aardvark's weight is typically between 40 and 65 kg. An aardvark's length is usually between 1 and 1.3 metres, and can reach lengths of 2.2 metres[2] when its tail (which can be up to 70 centimetres)[2] is taken into account. The aardvark is pale yellowish gray in color and often stained reddish-brown by soil. The aardvark's coat is thin and the animal's primary protection is its tough skin. The aardvark has been known to sleep in a recently excavated ant nest, which also serves as protection from its predators.

Behavior

Resting aardvark in Himeji City Zoo

The aardvark is nocturnal and is a solitary creature that feeds almost exclusively on ants and termites (formicivore);[7] the only fruit eaten by aardvarks is the aardvark cucumber. An aardvark emerges from its burrow in the late afternoon or shortly after sunset, and forages over a considerable home range encompassing 10 to 30 kilometers,[2] swinging its long nose from side to side to pick up the scent of food. When a concentration of ants or termites is detected, the aardvark digs into it with its powerful front legs, keeping its long ears upright to listen for predators, and takes up an astonishing number of insects with its long, sticky tongue—as many as 50,000 in one night have been recorded. It can dig 2 feet in 15 seconds [8], but otherwise moves fairly slowly. Its claws enable it to dig through the extremely hard crust of a termite or ant mound quickly, avoiding the dust by sealing the nostrils. When successful, the aardvark's long (up to 30 centimeters)[2] tongue licks up the insects; the termites' biting, or the ants' stinging attacks are rendered futile by the tough skin. Its keen hearing warns it of predators: lions, leopards, hyenas, and pythons.

Aside from digging out ants and termites, the aardvark also excavates burrows in which to live: temporary sites are scattered around the home range as refuges, and a main burrow is used for breeding. Main burrows can be deep and extensive, have several entrances and can be as long as 13 meters.[7] The aardvark changes the layout of its home burrow regularly, and from time to time moves on and makes a new one; the old burrows are then inhabited by smaller animals like the African Wild Dog.[2] Only mothers and young share burrows. If attacked in the tunnel, it will seal the tunnel off behind itself or turn around and attack with its claws.

Aardvark mother and young

Aardvarks only pair during the breeding season; after a gestation period of 7 months, one cub weighing around 2 kg is born, and is able to leave the burrow to accompany its mother after only two weeks, and is eating termites at 14 weeks and is weaned by 16 weeks.[2][7] At six months of age it is able to dig its own burrows, but it will often remain with the mother until the next mating season, and is sexually capable by the season after that.

Aardvarks live for up to 24 years in captivity.[2]

The aardvark's main predators are lions, leopards, hunting dogs and pythons. Some African tribes also hunt aardvarks for its flesh. Aardvarks can dig fast or run in zigzag fashion to elude enemies, but if all else fails, they will strike with their claws, tail and shoulders, sometimes flipping onto their backs to lash with all fours. Their thick skin also protects them to some extent.

Habitat

Aardvarks live in subsaharan Africa, where there is suitable habitat for them to live, such as savannas, grasslands, woodlands and bushland, and available food (i.e., ants and termites).[5]

Mythology and popular culture

In African folklore the aardvark is much admired because of its diligent quest for food and its fearless response to soldier ants. Hausa magicians make a charm from the heart, skin, forehead, and nails of the aardvark, which they then proceed to pound together with the root of a certain tree. Wrapped in a piece of skin and worn on the chest the charm is said to give the owner the ability to pass through walls or roofs at night. The charm is said to be used by burglars and those seeking to visit young girls without their parents' permission.[9]

The Egyptian god Set (mythology) is said, by some, to have the head of an Aardvark,[10] or part Aardvark.[11]

The main character of Arthur, a popular animated television series for children produced by WGBH-TV and shown in more than 100 countries, is an aardvark.[12]

One of the main characters of the 1969-1971 animated cartoon The Ant and the Aardvark is a blue aardvark voiced by John Byner, doing an impersonation of Jackie Mason. It depicts the Aardvark attempting, and failing, to catch and eat his antagonist, the Ant, also voiced by Byner impersonating Dean Martin.

The Canadian cartoon series The Raccoons featured an antagonist named Cyril Sneer; he and his son Cedric were both portrayed as being aardvarks.

Cerebus the Aardvark was the title character of a comic-book series by Dave Sim and Gerhard that ran from 1977 to 2004, and is still sold in collected volumes of reprints.

Notes and references

  1. ^ Lindsey, P., Cilliers, S., Griffin, M., Taylor, A., Lehmann, T. & Rathbun, G. (2008). Orycteropus afer. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008.
  2. ^ a b c d e f g h "Aardvark". Encyclopaedia Britannica. 
  3. ^ Schlitter, Duane A. (16 November 2005). "Order Tubulidentata (p. 86)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11300004. 
  4. ^ Obsolete Afrikaans, actually. The modern Afrikaans name is erdvark. aardvark (2010). In Merriam-Webster Online Dictionary. Retrieved February 2, 2010, from Merriam-webster.com
  5. ^ a b "Aardvark". African Wildlife Foundation. http://www.awf.org/content/wildlife/detail/aardvark. Retrieved 2008-01-10. 
  6. ^ "Great Uncle Aardvark?". BBC NEWS online — Science/Nature. 2003-01-20. http://news.bbc.co.uk/2/hi/science/nature/2676377.stm. Retrieved 2008-01-10. 
  7. ^ a b c van Aarde, Rudi J. (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. pp. 466–467. ISBN 0-87196-871-1. 
  8. ^ "Aardvarks at the Bronx Zoo" (flash video). http://www.youtube.com/watch?v=1Z5OoBqqYsk&t=0m46s. Retrieved January 31, 2011. 
  9. ^ "Cute as a Button but a Pain in my Butt: The Aardvark". http://www.themagicalbuffet.com/Issues/Vol02_Iss07/Article_049.html. Retrieved 2008-01-10. 
  10. ^ [1]
  11. ^ [2]
  12. ^ WKYC.com
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!