Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Serotine bats are relatively large bats. They leave their colony later in the evening than the common noctule, which explains its Dutch name 'late flyer'. People often mix up these two species because they are about the same size. You can see serotines flying in the twilight around street lanterns, along the edges of woods and above water. They are busy hunting insects. During the day, the bats are found in buildings, in cavity walls, under roof tiles, behind partitions and in attics. They rarely fly further than 3 kilometers from their roosting sites. Serotines usually spend the winter close by their roosting site.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Bats are the only true flying mammals. In Britain they are insectivorous (eat insects), and contrary to popular misconception they are not blind; many can actually see very well (6). All British bats use 'echolocation' to orient themselves at night. Bats emit bursts of sound that are of such high frequencies they are beyond the human range of hearing, and are therefore called 'ultrasound' (5). They then listen to and interpret the echoes bounced back from objects, including prey, around them, allowing them to build up a 'sound-picture' of their surroundings (5). The serotine bat emits echolocation calls in the range of 15- 65 kHz, but most calls are at 25-30 kHz (4). It emerges at early dusk (2), often when it still fairly light (4), and hunts mainly for beetles such as chafers and dung beetles as well as flies and moths (4). The mating season starts in August, but its duration is unknown (2); very little is known of the mating behaviour of the serotine (4). Fertilisation is delayed; the females store sperm internally throughout the winter hibernation until spring (6). Maternity colonies, usually consisting of 10-50 females (6) begin to form in May (4). A single young is produced, usually in early July, and if the colony is disturbed during its first few days of life, the mother may carry it to a new site (4). By the third week of life the young bat is able to fly, and at around 5 weeks it is able to forage independently (2). During the summer, males are solitary or occur in small groups (4), but they occur with females in spring and autumn (6). This species hibernates between October and late March or April (2). Serotine bats can live up to 19 years of age (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

One of the largest bats in Britain (4), the serotine bat has long fur, the back is smoky-brown in colour, while the belly is a paler yellowish-brown, the nose and triangular shaped ears are black, and the wing membranes are dark black or brown (2). Juveniles are darker in colour than adults (2). This species is easy to identify in flight, as its broad wings and slow, highly manoeuvrable flapping flight interspersed with brief glides is characteristic (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eptesicus serotinus is widely distributed through the Palaearctic from the Atlantic to the Pacific seaboards, across the Mediterranean from Portugal eastwards to Turkey, and is marginal to North Africa. It occurs north to about 57ºN in Denmark, south-west to North Africa (found in Morocca, Algeria, Tunisia, and to western Libya), and east into northern parts of the Indian subcontinent and south-east Asia. In the Middle East it is recorded from Syria and Lebanon. Records from the Canary Islands (Lanzarote) refer to a single vagrant that died shortly after arrival (Trujillo 1991). Its altitudinal range is from sea level to to 1,440 m in the Alps (Spitzenberger 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs throughout much of continental Europe, extending as far north as southern Sweden, southern England and Denmark, and south to the Mediterranean and Balkans (2). In Great Britain it occurs roughly to the south of a line drawn between south Wales and The Wash (4); it is abundant in Sussex and Dorset, but very rare in Wales, and it is not known if the population is declining or stable (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in a variety of habitats across its wide range including semi-desert, temperate and subtropical dry forest, Mediterranean-type shrubland, farmland and suburban areas. Favoured feeding areas include pasture, parkland, open woodland edge, tall hedgerows, gardens, and forested regions. Feeds on larger beetles, moths and flies.
Most summer (maternity) colonies are in buildings and occasionally tree holes or rock fissures.
In winter it roosts singly or in small numbers in buildings and rock crevices, or often in underground habitats in north central Europe. Winter roosts are usually in fairly cold, dry sites. It is a largely sedentary species, with movements to 330 km recorded (Havekost 1960 in Hutterer et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs mainly in lowland areas, where there are human settlements. This species has become very well adapted to man-made roosting sites, so much so that it is now only rarely found in natural sites (5). In summer they roost in buildings that have high gables and cavity walls, they are thought to typically remain in the same building to hibernate during winter. Some hibernating serotines have been found in caves, but this is rare (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite / blood sucker
adult of Cimex pipistrelli sucks the blood of Eptesicus serotinus

Animal / parasite / ectoparasite
Nycteribia kolenatii ectoparasitises Eptesicus serotinus
Other: minor host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eptesicus serotinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTCTACCTTCTATTCGGCGCCTGAGCCGGAATGGTGGGCACAGCCCTTAGCTTGCTAATTCGTGCCGAATTAGGCCAACCAGGGGCTCTGCTAGGAGACGACCAGATTTATAACGTAATTGTTACTGCTCATGCCTTTGTGATAATTTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTTGGAAATTGATTGGTACCCTTAATGATTGGAGCCCCTGATATGGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTTCTAGCATCATCTATAGTAGAAGCCGGGGCTGGCACCGGTTGGACAGTCTACCCTCCTCTGGCAGGTAACCTTGCCCACGCTGGGGCCTCTGTGGATCTAACCATTTTCTCATTACATTTAGCAGGTGTATCCTCAATTCTAGGAGCAATTAATTTTATTACAACAATTATTAATATAAAACCTCCTGCTCTTTCTCAATATCAAACACCGCTATTCGTATGATCCGTCTTAATCACAGCTGTCCTTCTTCTGCTATCTCTCCCTGTACTGGCTGCTGGTATTACAATATTATTAACAGATCGAAATTTAAATACAACCTTTTTTGACCCAGCTGGTGGAGGGGACCCAATCCTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eptesicus serotinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Aulagnier, S., Alcaldé, J.T., Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Gumal, M., Kingston, T. & Benda, P.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
A very widespread and abundant species. Global and regional population trends are difficult to determine, as the species is decreasing in some range states (sometimes dramatically) whilst increasing in others. Overall, it is not believed to approach the threshold for the population decline criterion of the IUCN Red List (i.e. declining more than 30% in ten years or three generations). For these reasons, it is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

In Britain all bats are fully protected under Schedule 5 of the Wildlife and Countryside Act (1981) as amended, and by the Conservation (Natural habitats etc) Regulations (1994) (3). An agreement on the Conservation of European Bats in Europe (EUROBATS) under the auspices of the Bonn Convention, also known as the Convention on Migratory Species (CMS) is in force, and all European bats are listed under Appendix II of the CMS (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A very widespread and abundant species, with decreases recorded in some areas and increases in others. It may be increasing in some parts of northern Europe (e.g. Denmark) and decreasing in others, slightly (e.g. UK), or severely (e.g. Austria). In Austria, a 70% decline has been recorded in the eastern part of the country (the former stronghold) over the last 15 years, and the species is now absent from lowland regions with bare arable land (F. Spitzenberger pers. comm. 2006). It is suspected to be declining in the rest of Pannonian basin. It is known from a single locality in European Turkey, and the total population in Turkey is small (A. Karatas pers. comm. 2005). In Iran it is at the edge of the its range, the species occurs in low numbers (M. Sharifi pers. comm. 2005). There is a large North African population: it is the most common bat species in northwest Algeria and Libya.

Summer maternity colony size is generally 10-50 females (occasionally up to 300). It winters singly or in small groups.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In some areas it is affected by habitat loss and disturbance and destruction of colonies in houses. Population decline in Austria might be related to food reduction due to large scale mosquito control with the bacterium Bacillus thuringiensis, used in the Danube and Moravia regions (F. Spitzenberger and I. Coroiu pers. comm. 2006). The species is a host of the rabies-related virus EBLV1. There is increasing interest in the occurrence, risk to humans and epidemiology of this virus (e.g. Stantic-Pavlinic 2005), which could have an effect on the public image of this house-dependent bat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The serotine bat has declined in many areas throughout Europe. Loss of feeding habitat is thought to have played a part in the decline. Furthermore, as this bat roosts in buildings, it is vulnerable to disturbance from building work and toxic timber treatments (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention in parts of range where these apply. It is included in Annex IV of EU Habitats and Species Directive, and there is some habitat protection through Natura 2000. No specific conservation actions known in North Africa or South Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

In Britain, bats benefit from a very comprehensive level of legal protection (7). Under the Wildlife and Countryside Act it is illegal to intentionally kill, injure, take or sell a bat, posses a live bat or part of a bat, to intentionally (or in England and Wales, recklessly) damage, obstruct or destroy access to bat roosts. Under the Conservation Regulations it is an offence to damage or destroy breeding sites or resting places. Fines of up to £5,000 per bat affected and six months imprisonment are in place for these offences (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Serotine bat

The serotine bat (Eptesicus serotinus) is a fairly large European bat with quite large ears. It has a wingspan of around 37 cm (15 in) and often hunts in woodland. It sometimes roosts in buildings, hanging upside down, in small groups or individually.

Diet[edit]

Similarly to Nyctalus or Plecotus species, the Serotine is mainly an aerial hawker focusing on hunting flying prey.[2][3][4]

Echolocation[edit]

The frequencies used by this bat species for echolocation lie between 25–55 kHz, have most energy at 31 kHz and have an average duration of 8.8 ms.[5][6]

References[edit]

  1. ^ Hutson, A.M., Spitzenberger, F., Aulagneir, S., Alcaldé, J.T., Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Gumal, M., Kingston, T., & Benda, P. (2008). "Eptesicus serotinus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 16 March 2013. 
  2. ^ GAJDOŠÍK M. & GAISLER J., 2004: Diet of two Eptesicus bat species in Moravia (Czech Republic). Folia Zoologica, 53: 7–16.
  3. ^ ANDĚRA M. & HORÁČEK I., 2005: Poznáváme naše savce [We Identify Our Mammals]. Sobotáles, Praha, 328 pp. [in Czech]
  4. ^ MIKULA, P., & ČMOKOVÁ, A. Lepidopterans in the summer diet of Eptesicus serotinus in Central Bohemia. Vespertilio 16: 197-201.
  5. ^ Parsons, S.; Jones, G. (2000). "Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks". J Exp Biol 203: 2641–2656. 
  6. ^ Obrist, M.K.; Boesch, R. and Fluckiger, P.F. (2004). "Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergic pattern recognition approach". Mammalia 68 (4): 307–32. doi:10.1515/mamm.2004.030. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!