Articles on this page are available in 2 other languages: Chinese (Simplified) (1), Dutch (1) (learn more)

Overview

Brief Summary

The Daubenton's bat hunts almost exclusively above water, catching non-biting midges and other insects. It can also pluck little creatures from the water's surface, such as mosquito larvae. Daubenton's bats are found in many places in the Netherlands, including the coastal regions. They are a regular guest on Texel, but are not known on any of the other Wadden Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Daubenton’s bat is a medium-sized bat species, sometimes known as the water bat or hairy footed bat.It has a steady flight, and often flies within a few centimetres of the water surface - reminiscent of a small hovercraft. It feeds on small flies including chironomid midges, caddisflies and mayflies.The bats roost in tunnels and bridges close to canals and sometimes in stone buildings, such as old waterworks.They usually feed within 6km of the roost, but have been recorded following canals for 10km - flying at speeds of up to 25kph.They usually take insects from close to the water and sometimes directly from the water surface - using their large feet as a gaff, or the tail membrane as a scoop.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Bats are the only true flying mammals. In Britain they are insectivorous (eat insects), and contrary to popular misconception they are not blind; many can actually see very well (6). All British bats use echolocation to orient themselves at night; they emit bursts of sound that are of such high frequencies they are beyond the human range of hearing and are called 'ultrasound' (7). They then listen to and interpret the echoes bounced back from objects, including prey, around them, allowing them to build up a 'sound-picture' of their surroundings (7). Daubenton's bats produce echolocation calls of frequencies between 35 and 85 kHz, but most calls peak at 45-50 kHz (5). They emerge at twilight, and with fast, agile flight they hunt over water, close to the surface (2), taking small flies, midges, mayflies (5) and moths (2). They have been seen taking prey from the surface of the water using the tail membrane or the feet (5), eating the prey whilst flying (2). Mating tends to occur in autumn (5), but fertilisation is delayed until the following spring (7). Females gather into maternity colonies in summer, the young bats are suckled for several weeks, reaching independence at around 6-8 weeks of age (5). Males and non-breeding females may gather into communal roosts in the summer, or they may live in the maternity roosts (5), but in separate groups to the breeding females (7). Hibernation occurs between the end of September and late March or April (2). Daubenton's bats are known to live to a maximum of 20 years, although the average life expectancy is closer to 4- 4.5 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Daubenton's bat is a medium-sized to small species (2). The fur has a fluffy appearance, is brownish-grey to bronze on the back, and silvery grey on the belly (2). The ears, which are held folded at right angles if the bat is agitated, and the wing membranes are greyish brown in colour; the nose and face is reddish pink, and there is a bare area around the eyes (5). Juveniles are darker in colour than adults (2). The large feet are bordered with long bristles (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Daubenton’s bats have red brown fur, pale underneath, and a pinkish face which is bare around the eyes.They also have the following features:
  • head and body length: 45–55mm
  • forearm length: 34–41mm
  • wingspan: 240–275mm
  • weight: 7g–12g


Echolocation
Bats emit calls out to the environment and listen to the echoes of those calls that return from various objects in the environment. They use these echoes to locate, range, and identify the objects.Daubenton’s bat calls range from 35 to 85kHz and are loudest at 45 to 50kHz.On a bat detector, the calls are heard as a machinegun-like series of regular clicks for bursts of 5 to 10 seconds.

Life cycle
Mating takes place in the autumn and active males will continue to seek out and mate with females throughout the winter.Maternity roosts are occupied from late spring until October.Young bats are suckled for several weeks and are fully weaned and able to forage for themselves at 6–8 weeks.Males or non-breeding females may aggregate during the summer to form their own communal roosts, but sometimes join maternity colonies.Colony size ranges between 20 and 50 bats, but can be up to 200.Daubenton’s bats can live for up to 22 years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Daubenton’s bats, Myotis daubentonii, inhabit the majority of the Paleartic region, occurring from Ireland, Portugal and Norway through continental Europe and northern Asia to continental Japan, Kamchatka, China and Korea. In Europe, they range from 63 °N in Scandinavia to 40 °N in Greece. Within Japan, they is only found on the island of Hokkaido. Daubenton’s bats can also be found in south-western and central China.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Myotis daubentonii is distributed from Portugal, Ireland and Norway through Europe and northern Asia to the Far East (Korea and Japan). It is absent in Central Asia from the Caspian region to the Altai mountains, and only a few records are known from Asia Minor and the western Caucasus.

In some parts of Europe it is more patchily distributed than the map suggests (e.g., Spain and Turkey). It has a patchy occurrence in Italy and is also not found throughout the Balkans, being absent from Montenegro and much of Bosnia and Herzegovina and Albania. It is recorded from the Mediterranean islands of Corsica and Sardinia. In Japan, it is found only on Hokkaido (Abe et al. 2005), and in China it is known from the northeastern provinces of Heilongjiang, Jilin and Nei Mongol. It is absent in Central Asia from the Caspian region to the Altai mountains, and only a few records are known from Asia Minor and the western Caucasus. It is widespread throughout northern Mongolia, associated with rivers and water sources including the Bulgan River in northern Dzungarian Govi Desert. Also occurs in Mongol Altai Mountain Range, Great Lakes Depression, Hövsgöl, Hangai and Hentii mountain ranges, Mongol Daguur Steppe, northern Middle Halh Steppe, and northern parts of Eastern Mongolia (Stubbe and Chotolchu 1968, Dulamtseren 1970).

There are records from sea level to 1,400 m asl in the Alps (Spitzenberger 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread throughout Britain, reaching northern Scotland. Daubenton's bat is also widespread throughout much of Europe, extending as far east as Japan and Korea (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Daubenton’s bats are medium-sized bats with a body mass between 5 and 15 g. Females are on average slightly larger than the males. Daubenton’s bats have a head and body length of 40 to 60 mm and a wingspan of 240 to 275 mm. The forearm measures 33 to 42 mm and the tail length is between 27 and 48 mm.

Newborn bats typically have a mass of 1.6 to 2.4 g. Their mean head and body length is 32.8 mm, and they have a mean tail and forearm length of 15.7 and 14.9 mm respectively.

The short, dense fur of Daubenton’s bats is characterized as brown-gray to a slightly red dark bronze on the dorsum and silver-gray to white on the belly. The wings are reddish or dark brown but never black. The face is blunt and pinkish with bare, hairless patches around the eyes. The ears are short and rounded and clearly separated. The pinnae have 4 to 5 transverse folds and are 10.5 to 14.2 mm in length. The tragus has a height half that of the pinna and a width one-fifth the pinna length.

Newborn Daubenton’s bats have short, gray-brown hair on the dorsal side and a pinkish ventral side. The ears and wing membranes are gray-brown.

Some diagnostic characters of Daubenton’s bats include a large foot that is half the length of the tibia, a long and slender calcar that is about two-thirds the margin of the uropotagium, a plagiopatagium that inserts in the middle of the metatarsus, and a relatively broad penis that is not bulbous.

Daubenton’s bats have a smooth and relatively flat and broad skull. The postorbital processes, temporal crest, and sagittal crest are weak and not very prominent. The lambdoidal crest is quite laterally strong but is obscure medially. The auditory bullae are also quite large and cover two-thirds of the cochleae. The dental formula is: I2/3, C1/1, P3/3, M3/3 for a total of 38 teeth. The upper molars have well developed protoconules on the anterior edge.

Range mass: 5 to 15 g.

Range length: 40 to 60 mm.

Range wingspan: 240 to 275 mm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Daubenton's bats prefer to live in areas with extensive still water lakes, ponds, and streams for foraging, and deciduous and mixed forests for roosting. During the summer, Daubenton's bats seem to prefer cavities of deciduous trees for roosting sites, but they may also be found under bridges, in buildings, bird boxes, bat boxes, rock crevices and the nests of sand martins. They prefer oak trees over other tree species and natural cavities over cavities created by woodpeckers. Daubenton’s bats may prefer natural crevices as they are formed by rot, which is indicative of humid conditions. Crevices found near the edge of a wood are also preferred, likely because of increased light exposure during the day, which aids in thermoregulation.

Nursery roosts of Daubenton’s bats are usually found in lower altitudes, most likely because these areas have higher ambient temperatures and lower precipitation. These nursery colonies are predominantly composed of females and can be occupied by more than 100 individuals.

In the winter, hibernacula are typically found in underground sites such as caves, mines, bunkers, and cellars. Temperatures of the hibernaculum can range from 0 to 10 ° C but are usually 2 to 6 °C or 3 to 8 °C. A minimum humidity of 70 % is needed for overwinter survival, and most hibernation roosts occur in sites with over 85 % humidity. It is not uncommon for Daubenton’s bats to form clusters with other bat species with similar thermal preferences (i.e., Myotis natlereri).

In the summer, the upper altitudinal limit of Myotis daubentonii is 400 to 700 m, and in the winter, 300 to 1100 m.

Range elevation: summer 700; winter 1100 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; riparian ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It forages over natural and artificial water bodies (including fjords), sometimes in woodland or scrub. Summer roosts are in tree hollows, caves, buildings and other artificial structures (e.g. bridges, cellars) in mixed sex colonies. It winters in a wide range of underground habitats. Seasonal movements between winter and summer roosts are mostly within a distance of 100-150 km (Hutterer et al. 2005). The longest distance covered is 257 km (Tress et al. 2004 in Hutterer et al.2005).

Due to the distinct foraging niche this species occupies, this species is reliant on water sources. It is highly dependant on aquatic insects for food, hunting over large water bodies and taking prey from the surface waters. It feeds largely on Lepidoptera, Diptera and Hemiptera, usually foraging less than 2 meters above ground or water level. The life span is not known in this species, but capture-mark-release experiments in the Khar Us Nuur region, recorded that the oldest individual recaptured was 4 years old. A ringing programme by the Mongolian-German Biological Expeditions from 1974 up to 2002 found that the oldest individual recaptured was 14 years of age (unpublished data).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated with water bodies such as rivers and canals (7), and found mainly in flat countryside, particularly in woodlands (2). Summer colonies occur in underground tunnels, caves, cellars and mines, or underneath bridges, but are always near water (5). Tree holes and bat boxes are also used. They hibernate during winter in caves, mines and other subterranean sites (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Daubenton’s bats are opportunistic insect predators. They feed primarily on aquatic insects of the order Diptera. Approximately 96 % of their diet consists of male midges that swarm above the water’s surface as females emerge from the water. Other aquatic insects, such as crane flies, black flies, biting midges, fungus gnats, and dagger flies make up 2 % of their diet.

Both in captivity and in the wild, Daubenton’s bats occasionally use their large feet to lift small jumping fish that break the water’s surface. Little data is available regarding the importance of piscivory to the diet of Daubenton’s bats.

Daubenton’s bats catch their prey from still water surfaces using slow hawking and gaffing techniques. Flight path while searching for prey is greatly affected by size of the foraging site. In a more confined site (i.e., small drainage canals), Daubenton’s bats fly alone in straight paths. At larger sites such as lakes and ponds, they forage alongside other individuals. Searching typically takes place within 30 cm of the water’s surface. When a prey insect is detected, Daubenton’s bats approach either directly or with sharp turns. Flight speed is reduced slightly during low catches closer to the water surface and is drastically reduced during high catches farther from the water’s surface. Prey is captured by the feet or the interfemoral membrane and is eaten when seized.

Pregnant females and males undergoing spermatogenesis have a higher energy demand than post-lactating females and normal condition males. Assuming a 92 % catch rate, pregnant females have an insect intake of 8.0 g while post-lactation females have an intake of 4.9 g. Similarly, males undergoing spermatogenesis have an insect intake of 8.0 g while normal males have an intake of 3.6 g.

Animal Foods: fish; insects

Primary Diet: carnivore (Piscivore , Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Daubenton’s bats are effective insect predators and likely have an effect on aquatic insect populations. One individual consumes 3.6 to 4.9 g of insects in one night, and pregnant females and males undergoing spermatogenesis consume approximately 8.0 g of insect material per night.

Daubenton’s bats host a variety of parasites, particularly bat flies. Common bat flies that parasitize Daubenton’s bats are Nycteribia kolenatii, N. schmidlii, N. vexata, Penicillidia monoceros, and Basilia nana. Mites (Spinturnix andegavinus), ticks (Carios vespertilionis), flukes (Plagiorchis vespertilionis), and fleas also parasitize Daubenton's bats. The flea species Ischnopsyllus simplex (in the west) and Myodopsylla trisellis (in the Far East) are commonly found on Daubenton's bats, though neither are host specific.

Commensal/Parasitic Species:

  • bat fly Nycteribia kolenatii
  • bat fly Nycteribia schmidlii
  • bat fly Nycteribia vexata
  • bat fly Penicillidia monoceros
  • bat fly Basilia nana
  • mites Spinturnix andegavinus
  • ticks Carios vespertilionis
  • flukes Plagiorchis vespertilionis
  • fleas Ischnopsyllus simplex
  • fleas Myodopsylla trisellis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although many mammalian and avian species have been recorded preying on Daubenton’s bats, none seem to be habitual predators. In most instances, predators seem to take advantage of high bat densities. Domestic cats, beech martens, dormice, wood mice, and shrews are the most commonly reported species that prey on Daubenton’s bats. Common avian predators include barn, tawny, and long-eared owls, however Daubenton’s bats make up less than 1.0 % of all vertebrates eaten by these owls. Other predators include buzzards, large frogs, and large fish.

Known Predators:

  • domestic cat (Felis silvestris)
  • beech martin (Martes foina)
  • wood mice (Apodemus sylvaticus)
  • dormice (Gliridae)
  • shrews Soricidae
  • barn owl (Tylo alba)
  • tawny owl (Strix aluce)
  • long-eared owl (Asio otus)
  • buzzards (Buteo)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
Nycteribia kolenatii ectoparasitises Myotis daubentoni
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distribution ecology

Habitat
In England and Wales, the majority of summer colonies are in humid, underground sites near water.These include:
  • tunnels or bridges over canals and rivers
  • caves, mines and cellars
  • occasionally, stone buildings such as moated castles and old waterworks - more commonly used in Scotland
  • rarely, tree-holes and earthen roadside banks
Summer colonies can be noisy during the day, especially at sites where they are close to human activity.A variety of temporary night roosts are used, often in trees or tunnels close to feeding sites.Daubenton’s bats have been found clustering with other bats, including:
  • pipistrelle
  • noctule
  • Natterer’s
  • brown long-eared bats
Daubenton’s bats hibernate in caves, mines and other underground sites - in extensive tunnel systems with large numbers of bats present.They enter these winter sites in October, but only small numbers are present at first. Numbers increase dramatically in January and February, and individuals can remain at the site until the end of March, mostly favouring the warmer, more stable areas of the site.Although usually solitary, small groups of 3–4 bats can be observed. Individuals are often lodged in tight crevices and are often barely visible.They may also hide among rocks and scree on the floor of caves and tunnels making them difficult to spot.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Female Daubenton’s bats emit social calls while inside nursery summer roosts. The frequency of social calls while foraging is low but increases dramatically when males chase other males from a foraging area. It is possible that females recognize their young through olfactory and auditory cues.

Daubenton’s bats produce frequency modulated (FM) calls that sweep from 70 to 95 kHz to 25 to 30 kHz and last 3 to 4 milliseconds during the search phase. The bandwidth of the first harmonic during search flight is approximately 70 kHz. Pulse intervals are highly variable. The approach and terminal phases are characterized by an increasing reduction of both sound duration and pulse interval. The terminal phase is separated by a longer interval and involves two buzz phases. The second buzz has a lower frequency than the first, dropping from 25 to 30 kHz to 22 to 18 kHz. At the end of the second buzz phase, the bandwidth of the first harmonic may drop as low as 10 kHz. When emerging from the roost, calls last 2.2 to 3.8 milliseconds and are spaced 56 to 103 milliseconds.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; ultrasound ; echolocation ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The mean life expectancy of Daubenton’s bats in the wild is 4.5 years, and mean longevity is 5.0 years. Although the predicted potential lifespan of a Daubenton’s bat is approximately 20 years, the oldest individual recorded in the wild was 28 years old.

In the Netherlands, survivorship of juveniles within the first half of their life was 50% and was 80% for adults. There was no difference in survival between age and sex groups or between hibernacula (Bogdanowicz, 1994).

Range lifespan

Status: wild:
28 (high) years.

Average lifespan

Status: wild:
4.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28 years (wild) Observations: Unlike most other mammals, this bat appears to have a continuous turnover of auditory hair cells (Kirkegaard and Jorgensen 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Daubenton’s bats are typically promiscuous (males and females mate with multiple partners). Mating is unstructured, with little to no male courtship display. Males, however, actively search roosts for females and create special mating roosts during the late summer. Most copulations occur in these special mating rosts.

Mating System: polygynandrous (promiscuous)

Male and female Daubenton’s bats reach sexual maturity in their first year. Males are typically able to reproduce during and after August of their first year, though some may not reach full maturity until their second summer. Mating typically occurs as soon as the males reach the hibernaculum and continues from August to April. However, most copulation occurs between October and November. Most mating occurs ventro-dorsally and is typically accompanied by distinct vocalizations and body positions. Copulation lasts approximately 15 to 30 min.

Female Daubenton’s bats exhibit delayed ovulation. Fertilization occurs in early spring, and pregnancy lasts from 53 to 55 days. Pups are born from June to July. Although females have a high food requirement during pregnancy, pregnant females often have a reduced foraging rate. Lactating females have lower energy requirements than pregnant individuals but tend to have a further reduced foraging range. While the actual lactation period is not well recorded, it is usually thought to occur between June and July.

During birth, female Daubenton’s bats reverse their typical “head-down” position so that the young are born into the uropatagium of the mother. Litter size typically consists of a single pup, rarely two. Young are born blind but have well developed sensory hairs. The eyes open within 8 to 10 days. The deciduous teeth are almost completed erupted at birth, and permanent teeth erupt on the 8th day. Permanent tooth development and eruption is complete around the 31st day. Pups obtain their complete cover of hair on the 21st day, and hair development is complete between the 31st and 35th day. Young are able to fly by 3 weeks of age and attain full adult form within 9 to 10 weeks.

Breeding interval: Males and female Daubenton’s bats breed multiple times in a year.

Breeding season: Daubenton’s bats generally mate between October and March.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 53 to 55 days.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; sperm-storing ; delayed fertilization

Mother Daubenton’s bats likely use olfactory and auditory cues to recognize their young in nursery roosts. Similar behavior is seen in little brown bats. It is possible that nursing females do not actively groom themselves or their young, as nursing females and juveniles have a significantly higher parasite load compared to non-nursing females and solitary males. Juveniles are weaned around August. Information regarding parental care in this species is poorly documented.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis daubentonii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 39 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATACCTACTATTTGGCGCTTGAGCTGGTATAGCAGGGACTGCTCTAAGTCTATTAATTCGAGCAGAACTAGGTCAACCAGGGGCTTTACTAGGAGATGATCAGATTTATAATGTAATTGTTACTGCTCATGCTTTTGTAATGATTTTCTTTATAGTCATACCTATTATGATTGGAGGTTTCGGGAATTGACTAGTACCCCTAATAATTGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCTTTCCTATTACTATTGGCTTCGTCTATAGTTGAAGCAGGAGCTGGTACTGGTTGAACAGTCTATCCCCCCTTAGCAGGAAATCTTGCCCATGCAGGAGCTTCTGTTGATCTTGCTATTTTCTCCCTTCATTTGGCAGGTGTATCTTCAATCTTAGGGGCCATTAATTTCATTACTACTATTATTAACATGAAACCTCCTGCACTTTCTCAATATCAAACACCATTATTTGTTTGATCTGTCTTAATTACAGCTGTATTACTCCTTCTCTCCCTTCCAGTTTTAGCCGCCGGAATCACAATATTATTAACAGATCGAAATCTAAATACTACCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis daubentonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 41
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Myotis daubentonii is an abundant species found through the majority of the Palearctic region. Within recent decades, population numbers have increased, possibly due to favorable climate change and increased food abundance. It is designated as a “species of interest” by the European Union Directive 92/43/EEC on the Conservation of Natural Habitats and of Wild Fauna and Flora. It is considered a species of "least concern" by the IUCN.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Stubbe, M., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M., Tsogbadrakh, M., Hutson, A.M., Spitzenberger, F., Aulagnier, S., Juste, J., Coroiu, I., Paunovic, M. & Karataş, A.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is widespread and abundant, there are no major threats and there are indications that its population is currently increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Despite severe loss of, and damage to wetlands and waterways, Daubenton’s bat seems to be increasing in parts of its range.This may in part be associated with the increasing number of artificial water bodies, including gravel pits, reservoirs and flooded quarries.Also low level pollution may encourage a more consistent supply of favourable insects.However, the loss of diversity of aquatic insects has a detrimental effect on other animals and, without very careful pollution controls, would also affect Daubenton’s bats.The removal of waterside trees and disturbance to hibernation sites could also lead to a decline in this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

In Great Britain, all bats are fully protected under Schedule 5 of the Wildlife and Countryside Act (1981) as amended, and by the Conservation (Natural Habitats &c.) Regulations (1994). An agreement on the Conservation of Bats in Europe (EUROBATS) under the auspices of the Bonn Convention, also known as the Convention on Migratory species (CMS) is in force, and all European bats are listed under Appendix II of the CMS (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
One of the most abundant bats in many parts of its range, and the only European bat species for which continuing population increase from the 1950s to present has been recorded. A very common species in central and eastern Europe including the Balkans, and in northern Asia. In Mongolia it is known to have a wide distribution and is commonly found. In Turkey it appears to be rare as there are only 4 known records (A. Karatas pers. comm. 2007).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species overall. Changes in water quality may reduce food supply, and loss of or damage and disturbance to roost sites in trees, buildings, other artificial structures, and underground habitats may cause temporary localised losses. However, these are not thought to be serious threats to the survival of this abundant and expanding species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Removal of waterside trees and disturbance of hibernacula (sites of hibernation) could pose problems for this species. However, it seems that Daubenton's bat is increasing in some parts of its range, possibly as a result of the increase in artificial water bodies (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention in parts of its range where these apply. It is included in Annex IV of EU Habitats and Species Directive, and there is some habitat protection through Natura 2000. Its range includes several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

In Britain, bats benefit from a very comprehensive level of legal protection (4). Under the Wildlife and Countryside Act it is illegal to intentionally kill, injure, take or sell a bat, posses a live bat or part of a bat, to intentionally (or in England and Wales, recklessly) damage, obstruct or destroy access to bat roosts. Under the Conservation Regulations it is an offence to damage or destroy breeding sites or resting places. Fines of up to £5,000 for every bat affected and up to six months imprisonment are in place for these offences (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Daubenton’s bat serve as a reservoir species for the EBLV-2 virus, which causes rabies in humans. However, this virus is maintained at low levels in the population and transmission to humans is low. The principle means of transmission of this virus is by bite from an infected bat.

Negative Impacts: injures humans (carries human disease); household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Daubenton’s bats play an important role in controlling populations of the many pest species they feed on

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Daubenton's bat

Daubenton's bat (Myotis daubentonii), is a Eurasian bat with quite short ears. It ranges from Britain to Japan (Hokkaido) and is considered to be increasing its numbers in many areas.

The name commemorates the French naturalist Louis-Jean-Marie Daubenton.

Description[edit]

Daubenton's bat is a medium-sized to small species. The bat's fluffy fur is brownish-grey on the back and silvery-grey on the underside. Juveniles have darker fur than adults. The bats have reddish-pink faces and noses, but the area around the eyes is bare. When the bat is agitated, the ears are held at right angles. The wings and tail membrane are dark brown.

Daubenton's bat is typically 45 to 55 mm long, with an average wingspan of 240 to 275 mm, and weighs between 7 and 15 g.

Lifespan[edit]

Daubenton's bats can live for up to 22 years.

Habitat[edit]

Daubenton's bat is found throughout Ireland and Europe, and as far as Japan and Korea. The bat is mostly found in woodlands and always chooses roosts close to water sources such as rivers or canals.

Summer colonies are formed in underground caves, tunnels, cellars, mines, and underneath bridges. These colonies are also always near water. Daubenton's bat also hibernates in the same type of locations from September to late March or April.

Hunting and diet[edit]

Daubenton's bat is insectivorous and uses echolocation to find prey and orient itself at night. Bats emit sounds too high in frequency for humans to detect and interpret the echoes created to build a "sound picture" of their surroundings. Daubenton's bat emits echolocation calls of frequencies between 32 and 85 kHz, though typical calls peak at 45 to 50 kHz and have a duration of 3.3 ms.[2][3]

The bats emerge at twilight to hunt for insects over the water. Their main diets consist of small flies, midges, mayflies, and moths. Daubenton's bat often eats its prey while still in flight. A seven-gram Daubenton's bat often returns weighing 11 grams after a one hour feeding, increasing its body weight by 57%.

Breeding[edit]

Mating occurs in autumn and fertilisation takes place the following spring. Females gather in maternity colonies of 40 to 80 bats during June and July. Daubenton's bat is able to fly three weeks after birth and reaches independence at 6 to 8 wk of age.

Conservation[edit]

All bats in Britain are protected under Schedule 5 of the Wildlife and Countryside Act of 1981. The bats are also protected by the Conservation Regulations of 1994.

Daubenton's bat is an endangered species in Germany and Austria.[citation needed]

See also[edit]

References[edit]

  1. ^ Chiroptera Specialist Group (1996). Myotis daubentonii. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 10 May 2006.
  2. ^ Parsons, S. and Jones, G. (2000) 'Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks.' J Exp Biol., 203: 2641-2656.
  3. ^ Obrist, M.K., Boesch, R. and Flückiger, P.F. (2004) 'Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergic pattern recognition approach.' Mammalia., 68 (4): 307-32.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Daubenton's Bat

Daubenton's Bat, Myotis daubentonii, is a Eurasian bat with quite short ears. It ranges from Britain to Japan (Hokkaido) and is considered to be increasing its numbers in many areas.

The name commemorates the French naturalist Louis-Jean-Marie Daubenton.

Contents

Description

Daubenton's Bat is a medium sized to small species. The bat's fluffy fur is brownish grey on the back and silvery grey on the underside. Juveniles have darker fur than adults. The bats have reddish pink faces and noses, but the area around the eyes is bare. When the bat is agitated, the ears are held at right angles. The wings and tail membrane are dark brown.


Daubenton's Bat is typically 45 to 55 mm long, with an average wingspan of 240 to 275 mm. Daubenton's Bat weighs between 7 and 15 grams.

Lifespan

Daubenton's Bats can live for up to 22 years.

Habitat

The Daubenton's Bat is found throughout Britain, Europe, and as far as Japan and Korea. The bat is mostly found in woodlands and always chooses roosts close to water sources such as rivers or canals.

Summer colonies are formed in underground caves, tunnels, cellars, mines, and underneath bridges. These colonies are also always near water. Daubenton's Bat also hibernates in the same type of locations from September to late March or April.

Hunting and diet

Daubenton's Bat is insectivorous and uses echolocation to find prey and orientate itself at night. Bats emit sounds too high in frequency for humans to detect and interpret the echoes created to build a "sound picture" of their surroundings. Daubenton's Bat emits echolocation calls of frequencies between 32 and 85 kHz, though typical calls peak at 45 to 50 kHz and have a duration of 3.3 ms.[2][3]

The bats emerge at twilight to hunt for insects over the water. Their main diet consists of small flies, midges, mayflies, and moths. Daubenton's Bat often eats its prey while still in flight. A seven gram Daubenton's Bat often returns weighing 11 grams after a one hour feeding, increasing its body weight by 57%.

Breeding

Mating occurs in autumn and fertilisation takes place the following spring. Females gather in maternity colonies of 40 to 80 bats during June and July. Daubenton's Bat is able to fly three weeks after birth and reaches independence at 6 to 8 weeks of age.

Conservation

All bats in Britain are protected under Schedule 5 of the Wildlife and Countryside Act of 1981. The bats are also protected by the Conservation Regulations of 1994.

Daubenton's Bat is an endangered species in Germany and Austria.

References

  1. ^ Chiroptera Specialist Group (1996). Myotis daubentonii. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 10 May 2006.
  2. ^ Parsons, S. and Jones, G. (2000) 'Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks.' J Exp Biol., 203: 2641-2656.
  3. ^ Obrist, M.K., Boesch, R. and Flückiger, P.F. (2004) 'Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergic pattern recognition approach.' Mammalia., 68 (4): 307-32.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!