Articles on this page are available in 2 other languages: Chinese (Simplified) (1), Dutch (1) (learn more)

Overview

Brief Summary

As the name indicates, the pond bat likes water. It hunts mosquitoes, flies and moths above the water's surface. In the Netherlands, around 10,000 pond bats are found here in the summer, but most of them disappear mysteriously in the winter. Nevertheless, scientists suspect that these bats also hibernate in the Netherlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Myotis dasycneme occurs from north-west Europe (north-western France and southern Scandinavia) south to Serbia and Montenegro, Ukraine, and north Kazakhstan and east to the River Yenisey in central Russia, with a few records from China. Historic or subfossil records exist from Switzerland, Austria and the former Yugoslavia. Recorded from sea level to 1,500 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species feeds principally over open calm water, particularly canals, rivers and lakes, on small emerging and emergent insects, often taken from the water surface. It prefers water lined by open rough vegetation without trees. Most of the known summer maternity roosts are in buildings, often in large attics and church steeples, in groups of 40-600. Some tree and bat box roosts are recorded. It frequently hibernates in underground habitats ranging from natural caves to cellars and bunkers. It is a partial migrant, with winter and summer roosts often separated by more than 100 km (maximum recorded: 350 km, and it may need good habitat links between summer and winter roosts.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite
Basilia nana ectoparasitises Myotis dasycneme

Animal / parasite / ectoparasite
Nycteribia kolenatii ectoparasitises Myotis dasycneme
Other: minor host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis dasycneme

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTATTTATTATTTGGTGCTTGAGCCGGTATAGCAGGTACTGCACTGAGTCTATTAATTCGTGCAGAGTTGGGTCAACCAGGGGCTCTGTTAGGAGATGATCAGATTTACAATGTAATCGTTACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGCTTTGGAAACTGACTAGTGCCACTAATAATTGGAGCTCCTGACATAGCTTTCCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCCTTCTTATTACTATTAGCTTCATCTATAGTTGAAGCAGGAGCAGGTACTGGTTGGACAGTCTATCCTCCTTTAGCAGGAAATCTTGCACACGCAGGGGCTTCTGTCGACCTTGCCATTTTTTCTTTACATTTGGCAGGTGTATCTTCAATTTTAGGGGCAATTAATTTTATTACTACTATTATTAATATAAAACCTCCTGCCCTTTCTCAGTATCAAACACCCTTGTTCGTTTGATCTGTCTTAATTACAGCTGTACTTCTTCTTCTCTCCCTTCCAGTTTTAGCTGCCGGAATTACAATATTATTAACAGACCGAAATCTGAATACTACCTTTTTTGACCCTGCCGGGGGAGGAGACCCAATCCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis dasycneme

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Aulagnier, S. & Nagy, Z.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
The species' range is wide but it is specialised to feeding above water courses and water bodies. Loss and degradation of aquatic habitats may threaten the species. There has been a rapid decline in the past in at least parts of Europe, and although this decline may now have slowed, it is nevertheless suspected to approach 30% over the last 15 years (3 generations). Consequently the species is assessed as Near Threatened (approaching A2c). Better knowledge on population trends, particularly in eastern parts of its range for which there is currently little information, might result in a downlisting to Least Concern.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is rarely abundant, and ranks among the rarest bat species in Europe. Summer colonies usually less than 100, but can reach 500. In winter sites, usually roost singly or small groups of up to 10, few sites with more than 200 individuals (maximum 700). Although no quantitative data on population trends are available, the species is reported as seriously declining in much of Europe.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threatened by habitat change, including renovation and maintenance of buildings with roosts involving the use of chemicals for remedial timber treatment that are toxic to mammals. Few nursery roost sites are known and many of these have been lost, although numbers in hibernation sites have shown a slower decline in The Netherlands. Water pollution may also be a threat; the species already has a relatively restricted foraging habitat of broad, open flat water of canals, rivers and lakes with relatively open banks, with possibly some further seasonal (summer) restriction within utilised habitat. Such restrictions in summer may be opportunistic rather than enforced, and it may be that the requirements for wider dispersal in spring, and possibly autumn, is more of a conservation problem than concentration in summer in good foraging habitat close to the roost. The requirements during migration are not known and may be a constraint (Limpens et al. 2000, Hutson et al. 2001)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Protected in all European range states, and in some other parts of its global range. In Europe it is included in Annex II of the EC Council Directive on the Conservation of Natural Habitats and of Wild Fauna and Flora 1992 (EC Habitats Directive) requiring full protection and designation of Special Areas of Conservation to maintain it and its habitats. Other international treaties of relevance are the Agreement on the Conservation of Bats in Europe (Bonn Convention 1994), Convention on the Conservation of European Wildlife and Natural Habitats (the Bern Convention 1982) and Bern Convention Recommendation 36 (1992, Conservation of Underground Habitats). Most European range states are party to at least one of these treaties.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pond bat

The pond bat (Myotis dasycneme) is a species of vesper bat. It is found in Eurasia from France to Russia and Kazakhstan.

Physical characteristics[edit]

The bat is medium sized, with a noticeally short tragus for a species in the Myotis genus. Fur is thick and black-brown at the base, with brownish or yellowish-grey fur on the dorsal side and white-grey or yellow-grey fur on the ventral side.

Status[edit]

The species is endangered, with a large decline in numbers in the west of range; where many nursery sites have been lost, especially in the Netherlands. On a global scale the species is only near threatened, but detailed data from the eastern population is needed to draw reliable conclusions.[1]

Habitat[edit]

In the summer this species nests in lowland regions with areas of water, meadows and woods, with winter roosts also occurring in the foothills of mountains. The record for the altitude of a M. dasycneme roost is 1000 meters above sea level, with winter roosts not normally occurring more than 300 meters above sea level. Summer roosts are mostly in roof spaces or church towers, with individuals sometimes found nesting in hollow trees.

Reproduction[edit]

Females reach sexual maturity in the second year. The mating season is from the end of August, with nursery roosts then becoming occupied the following may with 40-400 females, although rarely any males. The maximum recorded age is 19 years.

Hunting[edit]

Members of this species emerge to hunt in late dusk, with either 1 or 2 foraging periods in evening and early morning. Hunting occurs over water, meadows and along woodland edges, with rapid, skillful flight (sometimes only 5–10 cm above water). Prey includes gnats, mosquitoes, moths and insects caught from the surface of the water.

Echolocation[edit]

Echolocation is done with FM singles between 60 and 24 kHz, with a 5-8 millisecond duration. The call sequence occurs every 115 milliseconds on average, with approximately 8-10 signals per second. Signal range is between 5 and 20 meters.

References[edit]

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Pond Bat

The Pond Bat (Myotis dasycneme) is a species of vesper bat in the Vespertilionidae family. It is found in Eurasia from France to Russia and Kazakhstan.

Contents

Physical characteristics

The bat is medium sized, with a noticeally short tragus for a species in the Myotis genus. Fur is thick and black-brown at the base, with brownish or yellowish-grey fur on the dorsal side and white-grey or yellow-grey fur on the ventral side.

Status

The species is world endangered, with a large decline in numbers in the west of range; many nursery sites in the Netherlands have been lost.

Habitat

In the summer this species nests in lowland regions with areas of water, meadows and woods, with winter roosts also occurring in the foothills of mountains. The record for the altitutude of a M. dasycneme roost is 1000 meters above sea level, with winter roosts not normally occurring more than 300 meters above sea level. Summer roosts are mostly in roof spaces or church towers, with individuals sometimes found nesting in hollow trees.

Reproduction

Females reach sexual maturity in the second year. The mating season is from the end of August, with nursery roosts then becoming occupied the following may with 40-400 females, although rarely any males. The maximum recorded age is 19 years.

Hunting

Members of this species emerge to hunt in late dusk, with either 1 or 2 foraging periods in evening and early morning. Hunting occurs over water, meadows and along woodland edges, with rapid, skillful flight (sometimes only 5-10 cm above water). Prey includes gnats, mosquitoes, moths and insects caught from the surface of the water.

Echolocation

Echolocation is done with FM singles between 60 and 24 kHz, with a 5-8 millisecond duration. The call sequence occurs every 115 milliseconds on average, with approximately 8-10 signals per second. Signal range is between 5 and 20 meters.

Source


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!