Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Distribution

Range Description

This species occurs in central and southeast China (Jiangsu, Jiangxi, Guangdong, Hong Kong, Guangxi, Fujian, Hainan, Hunan, Zhejiang, Sichuan, Guizhou, and Yunnan provinces), extending to Thailand, Myanmar and Viet Nam (Smith et al. 2008). It can be expected in northern Lao PDR, but this has not yet been confirmed. In Myanmar it is found between 50-1,000 m asl in elevation (P. Bates pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in a wide range of habitats from lowlands through the hill country. It is known to hibernate in caves (Smith et al. 2008). Most of the recent records in Southeast Asia (Bates et al. 1999, 2001) report it being netted near cave entrances in or adjacent to limestone areas with rivers and streams (Bates et al. 1999, 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis chinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTATTATTTGGTGCTTGAGCAGGTATAGCAGGTACTGCTCTAAGTCTATTAATCCGCGCAGAGCTAGGCCAACCAGGGGCTCTATTGGGAGATGACCAAATCTACAACGTAATTGTCACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTCATACCTATCATAATTGGAGGCTTTGGAAATTGACTAGTTCCACTGATAATCGGGGCCCCTGATATAGCTTTCCCTCGAATAAACAATATAAGCTTTTGACTTCTTCCTCCTTCTTTCTTATTACTATTAGCCTCATCTATAGTTGAAGCAGGAGCTGGTACTGGCTGAACAGTCTATCCACCCTTAGCAGGAAACCTTGCCCACGCGGGAGCTTCAGTTGATCTTGCTATTTTTTCTCTACACCTAGCGGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATTACTACCATTATTAATATGAAACCTCCCGCACTTTCTCAATATCAAACACCACTATTTGTATGATCTGTCCTAATCACAGCAGTATTACTACTCCTTTCTCTTCCAGTTTTAGCTGCCGGAATTACAATACTATTAACAGACCGAAACTTGAATACTACTTTCTTTGATCCTGCTGGAGGAGGAGACCCAATTCTATATCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis chinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Csorba, G., Bates, P. & Furey, N.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority), Chanson, J. & Chiozza, F. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a relatively common species in at least part of its range, for example Myanmar (P. Bates pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is known to occur in protected areas throughout its wide range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Large myotis

The large myotis (Myotis chinensis) is a species of vesper bat. It is found in China, Hong Kong, Myanmar, Thailand, and Vietnam.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Large Myotis

The Large Myotis (Myotis chinensis) is a species of vesper bat in the Vespertilionidae family. It is found in China, Hong Kong, Myanmar, Thailand, and Vietnam.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!