Overview

Brief Summary

Biology

Bats are the only true flying mammals. In Britain they are insectivorous (eat insects), and contrary to popular misconception they are not blind; many can actually see very well (6). All British bats use 'echolocation' to orient themselves at night; they emit bursts of sound that are of such high frequencies they are beyond the human range of hearing and are called 'ultrasound' (7). They then listen to and interpret the echoes bounced back from objects, including prey, around them, allowing them to build up a 'sound-picture' of their surroundings (7). Brandt's bats produce echolocation calls of frequencies between 35 and 80 kilohertz (5). They emerge during early dusk, and with fast, agile flight they hunt over water or at low levels through woodland (2), feeding on moths, other small insects and spiders (5). Mating tends to occur in autumn (5), but fertilisation is delayed until the following spring (7). Females gather into maternity colonies in summer, typically numbering 20 to 60 females (7). They give birth to a single young in June or July. At three weeks of age the young bat can fly, and it is able to forage independently by about six weeks of age (5). In Britain, only small numbers of Brandt's bats have been found hibernating in caves and tunnels, so it seems likely that the majority of the population spends the winter hibernating in as yet unknown sites (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Brandt's bat was first discovered in Europe in 1958 (2), but was only separated from the very similar species, the whiskered bat (Myotis mystacinus) in 1970 (5). Both species have shaggy fur (5), which is light brown in colour with a golden sheen (2). The belly is a paler grey with yellowish tinges (2). The wing membrane, nose and ears are light brown (2). Distinguishing features between whiskered and Brandt's bats are in the shape of the tragus, the teeth and the penis, which in Brandt's bat has a club-shaped tip (2). Brandt's bats also tend to be somewhat lighter in colour and larger in size (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

A predominantly boreal Palaearctic species, distributed from Great Britain, western and central Europe and Fennoscandia through the Russian Federation and central Asia, including Mongolia and northeast China, to the northern Far East, including Japan,where it is found only on Hokkaido (Abe, et al., 2005 as Myotis gracilis Ognev, 1927). It has a scattered distribution in south-east Europe and Anatolia. In Mongolia it is known from the Hövsgöl, Hangai and Hentii mountain ranges, and along the Halh and Nömrög river basins in Ikh Halh Mountain Range (Bannikov, 1954; Sokolov and Orlov, 1980; Tinnin et al., 2002). In China, in addition to the distribution in the northeast, there is a disjunct distribution in southwest Xizang. It occurs from sea level up to 1,800 m asl.

This species has a fairly limited range within the Mediterranean region. There is a record from central Italy (the Abruzzo, Lazio and Molise National Park; Russo pers. comm. 2006; Agnelli et al.2004), a record from eastern Montenegro close to the border with Serbia, and it is reported to occur in northern Greece and in Bulgaria. Within Turkey the species was primarily known from the Caucasus area in the northeast but recently Benda and Karatash (2006) published a record from central Anatolia. Occurrence of this species in Bosnia and Herzegovina and in Macedonia has not yet been confirmed (M. Paunovic and B. Krystufek pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

In Britain, this species is widespread in the north and west of England and Wales, but rare elsewhere (7). It has been found in southern Scotland (2), but its status there is not known (7). It occurs from central to northern Europe, but is absent from southern and western areas (7). This bat is rare in Germany and endangered in Austria (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits mixed and broadleaf forest, and sometimes coniferous forest, often in close proximity to water (K. Tsytsulina pers. comm. 2005; Gerell 1999). It is less often found near human habitation than its congener M. mystacinus. Summer roosts are in buildings, tree holes, and bird and bat boxes, but most often in tree holes. In winter it hibernates in caves, tunnels, cellars and mines. It is an occasional migrant, with movements of up to 618 km recorded (Hutterer et al. 2005). It hunts near inland waters, but feeds on non-aquatic insects, breeding in June and July (Sokolov and Orlov 1980).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated with woodland habitats, particularly where there is water. Summer roosts are often in the roof timbers of buildings and in bat boxes, hibernation sites are in caves, cellars, mines and tunnels (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 41 years (wild) Observations: One banded animal lived for 41 years in the wild (Podlutsky et al. 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis brandtii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 54 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTGATATTTGGTGCCTGAGCTGGTATAGTAGGCACTGCACTGAGCCTACTAATCCGCGCCGAACTGGGTCAGCCAGGAGCCTTGCTGGGGGATGATCAAATTTATAATGTAATCGTCACTGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCCATCATAATTGGGGGCTTCGGAAATTGACTGGTGCCTCTAATAATTGGCGCCCCCGACATGGCTTTTCCCCGAATAAATAACATAAGCTTTTGACTACTCCCTCCGTCTTTTCTATTATTACTGGCTTCCTCTATAGTTGAAGCAGGGGCGGGCACTGGTTGAACAGTATACCCACCTCTAGCAGGGAATCTTGCTCATGCAGGAGCCTCGGTCGACCTTGCTATTTTCTCCCTACACCTAGCAGGTGTGTCTTCAATTCTAGGAGCAATCAACTTCATCACTACTATTATTAATATAAAACCCCCTGCACTTTCTCAATATCAAACACCATTATTTGTTTGATCTGTCTTAATTACAGCTGTCTTGCTTCTTCTCTCTCTTCCAGTTCTGGCTGCCGGAATTACAATACTATTGACAGACCGTAACCTCAACACCACTTTCTTTGACCCTGCCGGAGGAGGAGATCCGATTCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis brandtii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 52
Specimens with Barcodes: 60
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Coroiu, I., Aulagnier, S., Juste, J., Karataş, A., Palmeirim, J. & Paunović, M.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is widespread and abundant, and there is no indication of any significant decline in population.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

In Great Britain, all bats are fully protected under Schedule 5 of the Wildlife and Countryside Act (1981) as amended, and by the Conservation (Natural Habitats &c.) Regulations (1994) (3). An agreement on the Conservation of Bats in Europe (EUROBATS) under the auspices of the Bonn Convention, also known as the Convention on Migratory species (CMS) is in force, and all European bats are listed under Appendix II of the CMS (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
One of the more common species within northern parts of its regular distribution area in Europe. It is decreasing in NE Turkey, at the southern edge of its global range (A. Karatash pers. comm. 2005). In Mongolia there is no population data available on this species, but it is thought to be evenly distributed over a wide geographic range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known. Localized possible threats include changes in land-use practices (including woodland loss, infrastructure development and pesticide use). Human disturbance to roosts in buildings and underground habitats may also be a problem. In the eastern Black Sea area, it prefers to roost behind window shutters in older buildings, and these sites are not provided in modern buildings. Another popular roost site in this region is barrels hung in trees for honey bee farming, and when the barrels are removed to check for honey, roosting individuals are disturbed (A. Karatash pers. comm. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brandt's bat is threatened by the decline of woodland, and intensive agricultural practices, particularly the use of pesticides. Disturbance of their roosting and hibernation sites may also be a problem (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention, in parts of its range where these apply. It is included in Annex IV of EU Habitats and Species Directive, and there is some habitat protection through Natura 2000. Its range includes several protected areas.

Reserach into the distribution range, population size and trends is required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

In Britain, bats benefit from a very comprehensive level of legal protection (4). Under the Wildlife and Countryside Act it is illegal to intentionally kill, injure, take or sell a bat, posses a live bat or part of a bat, to intentionally (or in England and Wales, recklessly) damage, obstruct or destroy access to bat roosts. Under the Conservation Regulations it is an offence to damage or destroy breeding sites or resting places. Fines of up to £5,000 per bat affected and six months imprisonment are in place for these offences (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brandt's bat

Brandt's bat (Myotis brandtii) is a species of vesper bat in the family Vespertilionidae. It is found throughout most of Europe and parts of Asia. It is known for its extreme longevity quotient, approximately twice that of humans.[2]

It is named for the German zoologist Johann Friedrich von Brandt.

Echolocation[edit]

The frequencies used by this bat species for echolocation lie between 32 and 103 kHz, have maximum energy density at 51 kHz and have an average duration of 4.2 ms.[3][4]

References[edit]

  1. ^ Hutson AM, Spitzenberger F, Coroiu I, Aulagnier S, Juste J, Karataş A, Palmeirim J & Paunović M (2008). Myotis brandtii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2008-01-27.
  2. ^ Robert Locke (2006). "The oldest bat". BATS Magazine 24 (2). 
  3. ^ Parsons S and Jones G (2000). "Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks". J Exp Biol 203: 2641–2656. PMID 10934005. 
  4. ^ Obrist MK, Boesch R and Flückiger PF (2004). "Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergic pattern recognition approach". Mammalia 68 (4): 307–32. doi:10.1515/mamm.2004.030. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!