Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Distribution

Range Description

A south-west Palearctic species, it occurs in southern Europe, southern parts of central Europe, and non-arid parts of southwestern Asia from Asia Minor, the Caucasus region and Palestine to Kashmir, the Altai mountains, Nepal, and parts of China. The subspecies M. b. oxygnathus occurs in Mediterranean Europe and western Anatolia: Portugal, Spain, France, Italy (including Sicily). Switzerland, Austria, Czech Republic, Slovakia, Romania, Moldova, Ukraine (including Krym), the Balkan Peninsula and parts of Turkey (Topál and Ruedi 2001). In the Caucasus, Turkey, Iran, the Russian Federation and Georgia it is confimed to occur no higher than 1,700 m (K. Tsytsulina, M. Sharifi and A. Karatash pers. comm. 2005). However, it is found at altitudes of up to 2,100 m in the winter in southern Spain (Palomo and Gisbert 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It forages in scrub and grassland habitats, including farmland and gardens. Maternity colonies are usually found in underground habitats such as caves and mines, and sometimes in attics of buildings (particularly in central Europe). In Iberia and in the Balkans it is mainly found in caves and other underground sites (e.g., mines). In Turkey and Syria maternity colonies are found in caves and in very old buildings (castles, inns, etc.). It hibernates in winter in underground sites with a relatively constant temperature of 6-12ºC. The species is an occasional migrant, with movements of up to 488 km recorded (Hutterer et al. 2005; previous reports of 600 km are erroneous).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 33 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis blythii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTACTATTTGGTGCCTGAGCAGGTATAGCAGGCACCGCTTTAAGTCTGTTAATTCGTGCAGAACTGGGTCAACCAGGAGCTCTATTAGGAGACGATCAAATTTATAATGTAATTGTTACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATACCTATTATGATCGGGGGCTTCGGGAATTGACTGGTACCCCTAATAATTGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTTCCCCCCTCTTTCTTACTATTACTGGCCTCATCTATAGTTGAAGCAGGAGCTGGTACCGGTTGAACAGTTTACCCGCCCTTAGCAGGAAATCTTGCCCACACGGGAGCTTCAGTCGATCTTGCTATTTTTTCTCTACATCTAGCAGGTGTATCTTCAATCTTAGGAGCAATTAATTTTATTACTACCATTATTAATATAAAACCCCCTGCACTTTCTCAATATCAAACACCGTTATTCGTATGATCCGTCTTAATTACGGCAGTACTATTACTCCTTTCCCTCCCAGTTCTAGCTGCTGGAATTACAATACTATTAACAGACCGAAATTTAAATACTACTTTCTTTGATCCTGCTGGAGGAGGAGACCCAATTCTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myotis blythii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Aulagnier, S., Juste, J., Karataş, A., Palmeirim, J. & Paunović, M.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Justification
Listed as Least Concern. Although well-documented population declines have occurred in some parts of the range, in other areas it remains abundant and apparently stable. However, population monitoring is required and conservation action is needed in parts of the range where the species' status is unfavourable.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A gregarious species, it congregates in nursery and/or hibernating colonies of up to 500 individuals. There have been large population reductions since the 1950s in several areas, including central Europe, Israel, and central Asia, and there is evidence of ongoing decline in some parts of the range, although in other areas populations appear stable. In parts of its range it remains an abundant species. In Turkey it occurs in large clusters and is the second most common bat species (A. Karatash pers. comm. 2007). In Iran there is evidence of population decline, although it remains one of the most sighted species (M. Sharifi pers. comm. 2005). The Spanish population is estimated to be smaller than 20,000 individuals, and is concentrated in the southern part of the country (Palomo and Gisbert 2002). It is declining, at a rate of one third over the last 10 years in important large colonies in Andalucia (Franco and Rodrigues de los Santos 2001). It is one of the rarest species in Portugal, where its population of c.2,000 individuals is declining (Rodrigues et al. 2003). It is uncommon in the northern part of the range (Austria) but seems stable (Spitzenberger 2002). In France, the population of over 20,000 individuals experienced declines since the 1960s, but may now be stable (S. Aulagnier pers. comm. 2006). In the Balkans, it is regarded as stable (Mediterranean workshop 2007). In Romania, one well-known colony has declined by 95% as a result of disturbance by speleological tourism (Z. Nagy pers. comm. 2006).

In South Asia the population is considered stable (Molur et al. 2002).

It often occurs in mixed colonies with Myotis myotis and identification is sometimes problematic.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Changes in land management, especially agricultural pollution and other agricultural activities, can affect populations of this species. Disturbance to roosts in caves and buildings may also be a problem.

In some caves used by speleologists in Spain, the disturbance affects more than 90% of the population and some large historical colonies in southern Spain have disappeared as a result. The Andalucian population decreased from 30,000 individuals to 14,000 between 1994 and 2002 (unpublished report submitted to Junta Andalucia government).

In Turkey and Syria caves are often used by herders and their livestock; the herders light fires in the cave entrances which disturb the bats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention in range states where that applies. It is included in Annex II (and (IV) of EU Habitats and Species Directive, and hence requires special measures for conservation including designation of Special Areas for Conservation. There is some habitat protection through Natura 2000. In some countries (including Spain, Portugal, and Italy) several colonies are protected by closing entrances to caves with fences. More colonies should be protected, however, the emphasis needs to be on better protection of cave sites generally rather than on 'gating' of cave entrances which is often detrimental to bats causing direct mortality and abandonment of caves.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser mouse-eared bat

The Lesser mouse-eared bat (Myotis blythii) is a species of bat in the Vespertilionidae family.

Contents

Distribution [edit]

Lesser mouse-eared bats can be found in the following countries: Afghanistan, Albania, Austria, Bulgaria, China, France, Georgia, Germany, Greece, Hungary, India, Iran, Iraq, Israel, Italy, Jordan, Kazakhstan, Lebanon, Mongolia, Pakistan, Romania, Russian Federation, Slovenia, Spain, Switzerland, Syrian Arab Republic, Turkmenistan, and Ukraine.

Threats [edit]

The species is decreasing in population due to the pollution and changes in land management. Construction noise has disturbed populations in southern Spain; the population in Andalusia decreased from 30,000 to 14,000 between 1994 and 2002.[1] Herders in Syria and Turkey light fires at cave mouths for their livestock disturbing the bats.[1]

Conservation [edit]

It is protected in most areas of Europe by Bonn and Bern Conversion. The species are required special measures which includes construction of designated areas, which are provided by Special Areas for Conservation. Natura 2000 is also protecting the species. In some European countries the caves are closed with fences so that the visitors wont disturb them.[1]

Characteristics [edit]

Lesser Mouse-eared Bat flying

These large-sized bats are around 62–70 millimetres (2.4–2.8 in) long and weigh around 16–26 grams (0.56–0.92 oz).[2]

Notes [edit]

  1. ^ a b c "Threats and conservation". IUCN Red List. Retrieved 14 November, 2012. 
  2. ^ Lesser Mouse-Eared Bat

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Lesser Mouse-eared Bat

The Lesser Mouse-Eared Bat (Myotis blythii) is a species of vesper bat in the Vespertilionidae family. Syn.: Myotis oxygnathus Monticelli, 1885.

Contents

Habitat

The Lesser Mouse-eared Bat can be found in the following countries: Afghanistan, Albania, Austria, Bulgaria, China, France, Georgia, Germany, Greece, Hungary, India, Iran, Iraq, Israel, Italy, Jordan, Kazakhstan, Lebanon, Mongolia, Pakistan, Romania, Russian Federation, Slovenia, Spain, Switzerland, Syrian Arab Republic, Turkmenistan, and Ukraine.

Characteristics

Lesser Mouse-eared Bat flying

These large-sized bats are around 62 to 70 mm long. They weigh around 16 to 26 grams.[1]

Notes

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!