Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Distribution

Range Description

This species ranges from northeastern South Asia, into southern China, and mainland Southeast Asia. In South Asia, this species is presently known from India (Nagaland and West Bengal) (Das 2003, Molur et al. 2002); it has been recorded from around 1,100 m asl. In China it is known only from a single record from Yunnan (Wang 2002; Smith and Xie 2008). In Southeast Asia, it ranges from northern Thailand (Corbet and Hill 1992), probably through much of Lao PDR (Francis et al. 1999) and in southern Cambodia (Hendrichsen et al. 2001). It is unclear if this species is present in Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In South Asia, little is known about the habitat or ecology of this species except that this species is found in montane forests and valleys (Molur et al. 2002). In Southeast Asia it has been recorded from wet evergreen forest. In Viet Nam, one specimen has been taken in second growth along a river valley (Smith and Xie 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myotis annectans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATATTATTATTCGGCGCTTGAGCCGGTATAGCTGGTACCGCTTTAAGTCTACTAATTCGTGCAGAATTAGGTCAACCAGGAGCCCTATTAGGTGATGACCAAATCTATAATGTAATTGTTACTGCTCATGCTTTCGTAATAATTTTTTTTATAGTGATGCCTATCATGATTGGAGGCTTTGGAAACTGATTAGTGCCCTTAATAATTGGGGCCCCTGATATAGCTTTTCCTCGAATAAACAATATAAGTTTCTGACTTCTTCCTCCCTCTTTTTTACTGCTGTTGTCTTCATCTATAGTTGAAGCAGGAGCAGGAACTGGTTGGACCGTTTATCCCCCCCTGGCAGGAAATCTTGCCCACGCAGGAGCTTCTGTTGATCTTGCTATTTTTTCTCTCCATCTAGCAGGTGTATCTTCAATCCTAGGAGCAATTAACTTCATTACCACCATTATCAATATAAAACCCCCCGCACTTTCTCAATACCAAACACCGTTATTTGTTTGATCTGTGTTAATTACAGCTGTATTACTTTTGCTCTCTTTGCCAGTTTTAGCTGCTGGAATTACAATGCTATTAACAGATCGAAATATTAATACTACTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis annectans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myotis cf. annectans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bates, P., Francis, C., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In South Asia the abundance, population size and trends for this species are not known (Molur et al. 2002). In Southeast Asia it is widespread but uncommon to moderately common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species remain unknown (Molur et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In South Asia, there are no conservation measures in place, and this species is not recorded from any protected areas. Surveys, ecological and populations studies are recommended (Molur et al. 2002). The species has been recorded from protected areas in Cambodia and Lao PDR (C. Francis pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hairy-faced bat

The hairy-faced bat (Myotis annectans) is a species of vesper bat. It can be found in the following countries: India, Indonesia, Laos, Myanmar, and Thailand.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!