Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Distribution

Range Description

Southern Veracruz (Mexico), Guatemala, Honduras, Nicaragua, Panama, Colombia, Venezuela, Guyana, Surinam, Equador, Peru, Brazil, Uruguay, Northern Argentina, Paraguay, and Bolivia (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in forests, urban habitats, and parks. Insectivorous.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Myotis albescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myotis albescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATTTAATATTTGGTGCCTGAGCTGGGATAGTAGGCACTGCATTAAGCTTACTAATCCGCGCCGAATTAGGCCAGCCGGGAGCTCTATTAGGAGATGATCAAATTTATAATGTAATTGTCACTGCTCACGCTTTTGTAATAATTTTCTTTATAGTTATGCCCATTATAATTGGAGGCTTCGGAAATTGACTAGTGCCCTTGATAATTGGCGCGCCTGACATAGCCTTCCCTCGAATAAATAACATAAGTTTTTGGCTACTTCCTCCTTCTTTCCTGCTATTACTTGCCTCATCTATAGTTGAAGCAGGAGCGGGTACTGGTTGAACAGTATATCCTCCTCTAGCAGGAAATCTAGCCCACGCAGGAGCCTCCGTCGATCTTGCTATCTTCTCCTTACACTTAGCAGGTGTCTCTTCAATCTTAGGGGCAATTAACTTTATTACTACTATTATTAACATGAAACCCCCCGCACTTTCTCAATATCAAACACCATTGTTTGTATGATCGGTTCTAATTACAGCTGTACTACTTCTCCTATCACTCCCAGTCTTAGCTGCCGGAATTACTATGCTATTAACAGATCGTAATCTTAATACTACTTTCTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATATCAGCACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R. Diaz, M., Samudio, R. & Arroyo-Cabrales, J.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant through out its range. Not common in Mexico (Arroyo-Cabrales pers. comm.).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species needs taxonomic review (Braquez pers. comm.). It is found in protected areas.
In Mexico is listed as subject to special protection under NOM - 059 - SEMARNAT - 2001 (Arroyo-Cabrales pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Silver-tipped myotis

The silver-tipped myotis (Myotis albescens) is a species of mouse-eared bat found in a range of lowland habitats in the Americas.

It is part of the Myotis genus of vesper bats, which includes a large number of common species across the world. Genetic analysis suggests that it is probably most closely related to a group of Neotropical Myotis species that includes Myotis nigricans, Myotis levis, and Myotis oxyotus,[2] or alternatively to Myotis dominicensis alone.[3]

Description[edit]

The silver-tipped myotis is a small bat, with a total length of 7.9 to 9.6 centimetres (3.1 to 3.8 in), and a tail 2.7 to 4.0 centimetres (1.1 to 1.6 in) long.[4] The fur is long and silky, with individual hairs being black or dark brown for most of their length, but white at the tips. This silver ticking gives the bat its common name and "frosted" appearance. Although fur with a similar pattern is found on the undersides of some related species, only in the silver-tipped myotis does it extend across the entire body, thus enabling it to be distinguished from some otherwise very similar bats.[5]

The undersides and legs of the animal are paler than the rest of the body, and the bare skin of the wings varies from light brown to almost black, depending on the individual. The bat has a rounded head with narrow, pointed ears, and unusually large feet. The membranes of the wings attach to the toes at their hindmost part, while the membrane between the legs is partially supported by a long calcar that actually extends beyond its edge to end in a small rounded lump.[5]

Distribution[edit]

The silver-tipped myotis is one of the most widespread members of its genus, being known from every country of South America except Chile and French Guiana.[5] It is possible that it does occur in French Guiana, but has not yet been recorded.[6] In the northern part of its range it is found in Panama, Costa Rica, Nicaragua, Honduras, Guatemala, and parts of Chiapas and Veracruz in southern Mexico.[7] Its wide range is partly due to a tolerance for a wide range of lowland habitats, including forests, shrublands, open wetlands, and pasture below 500 metres (1,600 ft) elevation.[5] However, it usually occurs near open water.[6] It is absent in the Andes and in the colder environments of central and southern Argentina.[5]

There are no recognised subspecies.

Behavior[edit]

Like most bats, silver-tipped myotises are nocturnal, and are most active immediately after sunset and before dawn. They spend the day roosting in small groups in holes or crevices in trees or cliffs, typically close to water. They are not cave-roosting bats, preferring more open environments with some degree of ventilation and light. In more settled areas, they are commonly found roosting under roofs, or inside attic spaces. Although they may occasionally become torpid during cold nights, they do not hibernate.[5]

They have been reported to feed on beetles, flies, lepidopterans, and spiders.[8] They are generally slow flying bats,[9] flying low to the ground or water, and grabbing insects with their large feet.[10] While hunting, they have been reported to use short, 2 to 5 millisecond, frequency modulated calls, sweeping down from 75 to 43 kHz, at sound levels of up to at least 111 dB.[11]

Reproduction[edit]

Males and females roost together, and the females are promiscuous, mating with several of their partners. There is no particular breeding season over most parts of the range, and females typically give birth to two or three young every year. Fertilisation does not occur for up to three months after mating indicating that females can likely store sperm in their bodies for this time, thus being able to control the timing of their pregnancy.[5] Gestation lasts about three months, and results in the birth of a single young.[5]

The young are weaned at about one month of age, by which time all their permanent teeth have erupted. Females become sexually mature at just two months, although males are not fertile for six or seven months after birth.[5]

References[edit]

  1. ^ Barquez, R. Diaz, M., Samudio, R. & Arroyo-Cabrales, J. (2008). "Myotis albescens". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 5 March 2011. 
  2. ^ Stadelmann, B. et al. (2007). "Molecular phylogeny of New World Myotis (Chiroptera, Vespertilionidae) inferred from mitochondrial and nuclear DNA genes". Molecular Phylogenetics and Evolution 43 (1): 32–48. doi:10.1016/j.ympev.2006.06.019. PMID 17049280. 
  3. ^ Lack, Justin B.; Roehrs, Zachary P.; Stanley, Craig E.; Ruedi, Manuel; Van Den Bussche, Ronald A. (2010). "Molecular phylogenetics of Myotis indicate familial-level divergence for the genus Cistugo (Chiroptera)". Journal of Mammalogy 91 (4): 976–992. doi:10.1644/09-MAMM-A-192.1.  edit
  4. ^ López-González, C., et al. (2001). "Taxonomic status of Myotis (Chiroptera: Vespertilionidae) in Paraguay". Journal of Mammalogy 82 (1): 138–160. doi:10.1644/1545-1542(2001)082<0138:TSOMCV>2.0.CO;2. 
  5. ^ a b c d e f g h i Braun, J. et al. (2009). "Myotis albescens (Chiroptera: Vespertilionidae)". Mammalian Species 846: 1–9. doi:10.1644/846.1. 
  6. ^ a b Simmons, N.B. & Voss, R.S. (1998). "The mammals of Paracou, French Guiana: a Neotropical lowland rainforest fauna. Part 1. Bats". Bulletin of the American Museum of Natural History 237: 1–219. hdl:2246/1634. 
  7. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 312–529. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  8. ^ Whitaker, J.O. & Findley, J.S. (1980). "Foods Eaten by Some Bats from Costa Rica and Panama". Journal of Mammalogy 61 (3): 540–544. JSTOR 1379850. 
  9. ^ Aguirre, L.F. (2002). "Structure of a Neotropical savanna bat community". Journal of Mammalogy 83 (3): 775–784. doi:10.1644/1545-1542(2002)083<0775:SOANSB>2.0.CO;2. 
  10. ^ Fenton, M.B. & Bogdanowicz, W. (2002). "Relationships between external morphology and foraging behaviour: bats in the genus Myotis". Canadian Journal of Zoology 80 (6): 1004–1013. doi:10.1139/z02-083. 
  11. ^ Surlykke, A. & Valko E.K.V. (2008). "Echolocating bats cry out loud to detect their prey". PloS One 3 (4): e2306. doi:10.1371/journal.pone.0002036. PMID 18446226. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!