Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Distribution

Range Description

This species is known from Venezuela to Tamaulipas and Sinaloa (Mexico); also in Trinidad and Tobago (Simmons, 2005). It occurs from lowlands to 1,400 m (Reid, 1997). It does not occur in high zones in Guatemala (McCarthy pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Centurio senex is a neotropical species found in various Central and South American countries, dependent on the season. These countries include Mexico, Venezuela, Colombia, Panama, and the republics of Trinidad and Tobago (Snow et al., 1980).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These bats are very peculiar looking, mostly because of the complex folds and flaps of skin around their faces. Folds of naked skin surrounding the nose and mouth of the broad, flat face give the bats a "wrinkled" appearance. Males have additional skin folds on the face which contain scent glands. Wrinkle-faced bats have a total of 28 teeth. Fur coloration ranges from gray to various shades of brown on the body, with a white "beard" around the bottom of the face. The underside of the body is lighter, there is a white spot on each shoulder, and there are white horizontal stripes on the wings that are more noticeable in males (Reid, 1997). Forearm length varies from 41-47 mm (Nowak, 1997). Although C. senex is classified under the "leaf nosed" family, this species does not have a leaf nose. In fact, the nose is greatly reduced in size, while the eyes are quite large. The ears are yellow and the tragus is of moderate length. The tail is covered with hair but does not extend beyond the uropatagium. Females on average are slightly larger in body size (Snow et al., 1980).

Range mass: 13 to 28 g.

Range length: 53 to 70 mm.

Average length: 55 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found in deciduous and evergreen forest; it is most common in dense second growth and low, seasonally flooded forest, where it is sometimes abundant. In deciduous forest, it is often caught in mist nets set over small pools of water (Reid, 1997). It is also found in dry forest, gallery forest, plantations, and gardens. Apparently adapts well to extremely disturbed habitats and can live in city parks and scrubby forest near cane fields. It roosts in vine tangles and dense foliage. Males roost singly or in groups of two or three; a number may be dispersed around the same tree. Females roost in dense clusters. While roosting, the mask of skin in pulled up tightly completely over the face and forehead and covers the horizontal flaps of the ears; a ridge across the crown holds it in place and/or forms an air channel for breathing. It flies rapidly like big, heavy beetles, with a wobbly motion, sometimes with the body vertical to the ground (Emmons and Feer, 1997). Activity starts soon after sunset but is curtailed around full moon. This bat feeds on fruit, possibly by biting ripe fruits and sucking the juice. The facial folds may be used to direct juice to the mouth. Captives will accept green fruits, however, little is known of their feeding behavior in the wild (Snow et al., 1980; Reid, 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These bats primarily inhabit dense forested areas, either tropical or deciduous, although they are occasionally found in less dense areas (Fenton et al., 1992). Within these forests they live in both moist and dry areas, and from lowlands (Venezuela) to altitudes of 1400 meters (Costa Rica). However, they are most common at altitudes less than 1000 meters (Eisenberg, 1989).

Range elevation: 0 to 1400 m.

Habitat Regions: tropical

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These animals are exclusively frugivorous. Most wrinkle-faced bats prefer overripe fruit, such as soft bananas and mangos, which they suck on. However, they may also eat unripe fruit, depending on the availability of food resources. Small protuberances between the lips and the gums filter juice when these animals feed on mushy fruit (Nowak, 1997). The morphology of these bats allows them to temporarily store fruit pulp in their mouths (Snow et al., 1980).

Foods eaten include: mangos, bananas, pawpaws and other tropical fruits.

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

During pregnancy females usually roost in the same tree with the males. Males use odiferous glands under their chins to attract females. Mating appears to take place anywhere from January through August, although males have been found most sexually active in the month of March (Snow et al., 1980). Females are most likely polyestrous. Lactation in females occurs in February, March and August (Nowak, 1997).

Average number of offspring: 1.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centurio senex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACTTACTATTTGGTGCTTGAGCAGGTATAGTAGGTACTGCACTAAGCCTACTTATTCGTGCAGAACTTGGACAACCCGGGGCTCTATTAGGTGACGATCAAATCTACAATGTTATCGTCACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGGTTCGGCAACTGGCTTGTACCACTAATAATTGGCGCACCTGACATAGCATTCCCACGAATAAATAATATAAGCTTTTGACTTCTCCCACCTTCTTTCCTACTTTTATTAGCCTCCTCAACAGTCGAAGCTGGTGTCGGAACTGGTTGAACCGTATACCCACCTCTAGCAGGAAATCTAGCACATGCTGGTGCTTCAGTCGACCTAGCTATTTTCTCCCTGCACCTAGCAGGAGTTTCATCTATCCTTGGAGCTATCAATTTTATTACTACAATCATTAACATAAAACCACCAGCTCTTTCCCAATATCAAACACCCTTATTTGTCTGATCCGTCCTAATTACTGCTGTCTTATTACTCCTATCGCTCCCAGTACTAGCAGCAGGCATTACTATACTTTTAACAGACCGAAACCTTAACACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATTCTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centurio senex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the species is not endangered, it is still quite uncommon within the areas it inhabits.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is rare to uncommon, but widespread and with a wide habitat range (Emmons and Feer, 1997; Reid, 1997).
May be locally abundant when there is fruit available (Miller pers. comm.)

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research actions. Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Positive Impacts: pollinates crops

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wrinkle-faced bat

The Wrinkle-faced Bat (Centurio senex) is a species of bat in the family Phyllostomidae. It is the only identified member of the genus Centurio. It is found in various countries in and around Central America. It eats fruit but is not classified within the fruit bats. It is classified as a leaf-nosed bat but does not have a leaf nose.[1] It has an unusually shaped skull which is thought to allow the bat to eat a wider range of foods than other bats.[2]

Contents

Description [edit]

C. senex is tail-less, medium sized and generally has a pelage of a drab brown to yellowish-brown colour.[1] They weigh around 17g.[2] Their face is hairless and is covered by convoluted outgrowths of skin (as would be expected from the common name). These skin flaps are more pronounced in males than females and males also possess a skin mask that can be used to cover their face. They have storage pouches in their mouths to allow them to store fruit. C. senex subsp. greenhalli differs from the more common C. senex subsp. senex by being larger and in having a more domed braincase, better developed sagittal crest, and relatively shorter maxillary toothrow.[1] Their skulls are extremely short and wide, which is thought to allow it to produce bite forces up to 20% higher than other bats of a similar size. It is able to generate the largest biting force, relative to its size of any of the leaf-nosed bats.[2]

Diet [edit]

The species is entirely frugivorous (fruit eating) although it is not known which types of fruit they consume.[1] Elizabeth Dumont from the University of Massachusetts believes that the strong biting force of the bat allows it to survive through times when soft fruit is scarce as they are able to eat tougher fruit than other bats.[2]

Reproduction [edit]

Females are thought to be both polyestrous and asynchronous, pregnant females have been recorded every month between January and August except May. Males emit a musky odour from the chin area to attract females. Their sperm morphology is unique in that the sperm head has a rounded nucleus and extremely pointed acrosome.[1]

Range [edit]

C. senex subsp. senex is found in Belize, Colombia, Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama and Venezuela.[3] C. senex subsp. greenhalli is only found in Trinidad and Tobago.[1]

Etymology [edit]

The binomial name Centurio senex is formed from the Latin centurio meaning division into hundreds and senex referring to old people. This name was chosen as it was thought that the face of the bat looked like that of a one hundred-year-old man.[1]

References [edit]

  1. ^ a b c d e f g h Snow, Jennifer; J. Knox Jones and David Webster (Nov. 20, 1980). "Centurio senex". Mammalian Species (Jstor: American Society of Mammalogists) 138 (138): 1–3. JSTOR 3503871. 
  2. ^ a b c d Gill, Victoria (21 August 2009). "Bizarre-looking bat's strong bite". BBC News. Retrieved 2009-08-24. 
  3. ^ Chiroptera Specialist Group 1996. Centurio senex. 2006 IUCN Red List of Threatened Species. Downloaded on 30 July 2007
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!